A fluorescence-turn-on nucleoside, its preparation method and application

Abstract

The present invention discloses a fluorescence-turn-on nucleoside, a preparation method thereof and an application thereof. The structural formula of the fluorescence-turn-on nucleoside is shown in formula (1). The present invention designs a fluorescence-turn-on nucleoside with a novel structure and a synthesis method, and can obtain a series of fluorescence-turn-on nucleosides modified with aromatic rings in high yield without silica gel column purification; the fluorescence-turn-on nucleoside can be effectively converted into nucleoside phosphoramidite, and combined with a DNA synthesizer, fluorescent modification can be incorporated at any specified position of nucleic acid, which is applicable to fluorescent labeling of nucleic acid and biomedical applications; the fluorescence-turn-on nucleoside can be effectively converted into nucleoside triphosphate, and can be used in biomedical applications such as DNA enzymatic synthesis, polymerase activity detection, intracellular DNA fluorescent labeling and tracking, etc.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and relates to a fluorescence-on nucleoside and a preparation method and application thereof. Background Art

[0002] Currently, research on the folding, tertiary structure, recognition, and function of nucleic acids (DNA and RNA) is attracting significant attention. Fluorescence spectroscopy, with its simplicity, high sensitivity, and strong specificity, has been widely applied in biomedical research into the structure, activity, location, and interactions of nucleic acids—the genetic material of life. Fluorescent nucleosides and their analogs have attracted significant attention because they can be incorporated into nucleic acid matrixes via enzymatic or solid-phase chemical synthesis with minimal structural or functional effects, while maintaining correct base pairing, enzyme and protein recognition, and providing fluorescent properties.

[0003] It is extremely rare to find fluorescent nucleosides in nature. Currently, scientists have developed a variety of synthetic fluorescent nucleosides with different base stacking, pairing or fluorescence emission characteristics. For example, CN107325141A discloses a fluorescent nucleoside and a preparation method thereof, wherein the fluorescent nucleoside is obtained by reacting coumarin or its derivatives with corresponding uridine compounds. CN106117291A discloses a fluorescent nucleoside for cell imaging, a preparation method and application thereof, wherein the fluorescent nucleoside has low background fluorescence in cell regions and tissues with low RNA content, and has a strong fluorescence signal in cell regions and tissues with high RNA content. When the viscosity of the cell changes, the fluorescence intensity and lifetime also change accordingly.

[0004] However, most fluorescent nucleosides currently exhibit high fluorescence intensity when they are monomers, but after being incorporated into nucleic acids, their fluorescence will be quenched by the surrounding bases, reducing their brightness, thus limiting their application.

[0005] In summary, how to develop new types of fluorescent nucleosides with opposite characteristics, that is, weak fluorescence at the nucleoside level, obvious fluorescence enhancement after incorporation into nucleic acids, or even a switching effect, has become one of the urgent problems to be solved in the field of nucleic acid fluorescent probes. Summary of the Invention

[0006] Most fluorescent nucleoside probes reported so far exhibit strong fluorescence efficiency in aqueous solution. However, upon incorporation into nucleic acid chains, they experience severe fluorescence quenching due to the influence of the bases on either side, thus limiting their biomedical applications. To address this issue, there is an urgent need to develop new types of fluorescent nucleosides that exhibit the opposite properties: weak fluorescence at the nucleoside level, but significant fluorescence enhancement or even on / off effects upon incorporation into nucleic acids.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] In a first aspect, the present invention provides a fluorescence-on nucleoside, the structural formula of the fluorescence-on nucleoside is shown in formula (1).

[0009]

[0010] The present invention designs a novel fluorescent-on nucleoside structure, which has weak fluorescence at the nucleoside level but has obvious fluorescence enhancement after being incorporated into nucleic acid, and can be effectively applied in the biomedical field.

[0011] Preferably, the structural formula of the fluorescence-on nucleoside is as shown in formula (2) or formula (3).

[0012]

[0013]

[0014] Preferably, R in formula (1), formula (2) and formula (3) is independently selected from H, OH (S configuration) or F.

[0015] Preferably, R in formula (3) 1 and R 2 Each is independently selected from H, OH, Me, Et, Me2N, NH2, MeO, F, Cl, Br, I, CF3 or Ph, etc.

[0016] Preferably, R in formula (3) 1 and R 2 H, or R 1 MeO and R 2 H, or R 1 For H and R 2 For MeO.

[0017] In a second aspect, the present invention provides a method for preparing the fluorescent-on nucleoside described in the first aspect, the preparation method comprising:

[0018] The compound of formula (4) is prepared using 2'-deoxyuridine, the compound of formula (5) is prepared using the compound of formula (4), and the compound of formula (5) is reacted with the compound of formula (6) to obtain the fluorescent-on nucleoside.

[0019]

[0020]

[0021]

[0022] Preferably, R3 in formula (4) and formula (5) is independently selected from H, OAc (S configuration) or F, etc.

[0023] Preferably, R in formula (6) 1 and R 2 Each is independently selected from H, OH, Me, Et, Me2N, NH2, MeO, F, Cl, Br, I, CF3 or Ph, etc.

[0024] In the present invention, a preparation method of the fluorescent-on nucleoside is designed, which has a high yield and does not require silica gel column purification.

[0025] Preferably, the preparation method of the compound represented by formula (4) comprises the following steps:

[0026] (1-1) 2'-deoxyuridine is dissolved in an organic solvent, triethylamine, 4-dimethylaminopyridine, and acetic anhydride, reacted, and post-treated;

[0027] (1-2) mixing the post-treatment product of step (1-1) with an organic solvent, ammonium cerium nitrate, and elemental iodine, reacting the mixture, and performing post-treatment;

[0028] (1-3) The post-treatment product of step (1-2) is mixed with pyridine and hexamethyldisilazane, and the mixture is reacted. Cuprous cyanide is added and the mixture is reacted to obtain a compound represented by formula (4).

[0029] Preferably, the organic solvent comprises acetonitrile.

[0030] Preferably, the reaction temperature in step (1-1) is 20-30° C., and the reaction time is 20-60 min.

[0031] Preferably, the reaction temperature in step (1-2) is 70-100° C. and the reaction time is 0.5-3 h.

[0032] Preferably, the reaction temperature in step (1-3) is 25 to 120° C., and the reaction time is 20 to 30 hours.

[0033] Preferably, the post-treatment in step (1-1) comprises adding methanol and continuing stirring, evaporating the solvent and then dissolving in dichloromethane, washing the organic phase with a dilute hydrochloric acid aqueous solution, extracting with a saturated sodium chloride aqueous solution, and drying with anhydrous sodium sulfate.

[0034] Preferably, the post-treatment in step (1-2) comprises mixing the reaction product with an aqueous solution of sodium sulfite, performing extraction and drying.

[0035] Preferably, the preparation method of the compound represented by formula (5) comprises:

[0036] The compound represented by formula (4) is mixed with NaSH, diethylamine hydrochloride and pyridine, reacted, and post-treated to obtain the compound represented by formula (5).

[0037] Preferably, the reaction temperature is 70-100° C. and the reaction time is 2-6 hours.

[0038] Preferably, the post-treatment comprises mixing the reaction product with a dilute hydrochloric acid aqueous solution, performing extraction, washing and drying treatments.

[0039] Preferably, the extraction solvent comprises ethyl acetate.

[0040] Preferably, the reaction of the compound represented by formula (5) with the compound represented by formula (6) comprises:

[0041] The compound represented by formula (5) is mixed with an organic solvent and a compound represented by formula (6) to react, the reaction solution is mixed with water, the solid product is dissolved in an ethanol aqueous solution, and a base is added to react to obtain the fluorescent-on nucleoside.

[0042] Preferably, the organic solvent comprises N,N-dimethylformamide.

[0043] Preferably, the base comprises sodium hydroxide.

[0044] In a third aspect, the present invention provides a fluorescent nucleoside phosphoramidite monomer, wherein the raw materials for preparing the fluorescent nucleoside phosphoramidite monomer include the fluorescence-on nucleoside described in the first aspect.

[0045] The fluorescent-on nucleoside of the present invention can be effectively converted into nucleoside phosphoramidites. Combined with a DNA synthesizer, fluorescent modifications can be incorporated into any designated position of a nucleic acid, and the nucleoside is suitable for fluorescent labeling of nucleic acids and biomedical applications.

[0046] The molecular formula of the fluorescent nucleoside phosphoramidite monomer is shown in formula (7).

[0047]

[0048] In formula (7), R is selected from H, OH or F, and R1 and R2 are each independently selected from an alkyl group having 1 to 4 carbon atoms.

[0049] In a fourth aspect, the present invention provides a fluorescent nucleoside triphosphate, wherein the raw materials for preparing the fluorescent nucleoside triphosphate include the fluorescent on-type nucleoside described in the first aspect.

[0050] The fluorescent on-type nucleoside of the present invention can be effectively converted into nucleoside triphosphates and can be used in biomedical applications such as DNA enzymatic synthesis, polymerase activity detection, intracellular DNA fluorescent labeling and tracking.

[0051] The molecular formula of the fluorescent nucleoside triphosphate is shown in formula (8).

[0052]

[0053] In formula (8), R is independently selected from H, OH, F, etc.

[0054] In a fifth aspect, the present invention provides use of the fluorescent on-type nucleoside described in the first aspect, the fluorescent nucleoside phosphoramidite monomer described in the third aspect, or the fluorescent nucleoside triphosphate described in the fourth aspect in the preparation of nucleic acids.

[0055] In the present invention, nucleic acids with fluorescent labels can be prepared by DNA synthesizers, DNA enzymatic synthesis, and the like.

[0056] In a sixth aspect, the present invention provides use of the fluorescent on-type nucleoside described in the first aspect, the fluorescent nucleoside phosphoramidite monomer described in the third aspect, or the fluorescent nucleoside triphosphate described in the fourth aspect in preparing a fluorescent probe.

[0057] In a seventh aspect, the present invention provides use of the fluorescent on-type nucleoside described in the first aspect, the fluorescent nucleoside phosphoramidite monomer described in the third aspect, or the fluorescent nucleoside triphosphate described in the fourth aspect in biological imaging.

[0058] Compared with the prior art, the present invention has the following beneficial effects:

[0059] (1) This paper designs a novel fluorescent open-type nucleoside with weak fluorescence at the nucleoside level, which has significant fluorescence enhancement after incorporation into nucleic acids and can be effectively applied in the biomedical field;

[0060] (2) The present invention cleverly designs a synthetic route for the fluorescent-activated nucleoside, resulting in high yield and no need for silica gel column purification;

[0061] (3) The fluorescent-activated nucleosides designed in the present invention can be further converted into nucleoside phosphoramidites and nucleoside triphosphates, and can be effectively applied in biomedical applications such as nucleic acid fluorescent labeling and detection technology, polymerase activity detection, and intracellular DNA fluorescent labeling and tracking. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 The UV absorption spectra and fluorescence emission spectra of the fluorescence-activated nucleoside 1a in different solvents are shown;

[0063] Figure 2 The UV absorption spectrum and fluorescence emission spectrum of the fluorescence-activated nucleoside 1b in different solvents;

[0064] Figure 3 The UV absorption spectra and fluorescence emission spectra of the fluorescence-activated nucleoside 1c in different solvents are shown;

[0065] Figure 4 The UV absorption spectrum and fluorescence emission spectrum of the fluorescent-on nucleoside 1d in different solvents;

[0066] Figure 5 The fluorescence quantum efficiency bar graphs of the fluorescent on-type nucleoside 1a in water, incorporated into single-stranded DNA, and complementary pairing to form double-stranded DNA;

[0067] Figure 6 The fluorescence quantum efficiency bar graphs of the fluorescent on-type nucleoside 1b in water, incorporated into single-stranded DNA, and complementary paired to form double-stranded DNA;

[0068] Figure 7 The fluorescence quantum efficiency bar graphs of the fluorescent on-type nucleoside 1c in water, incorporated into single-stranded DNA, and complementary pairing to form double-stranded DNA;

[0069] Figure 8 The fluorescence quantum efficiency bar graph of the fluorescent on-type nucleoside 1d in water, incorporated into single-stranded DNA, and complementary pairing to form double-stranded DNA;

[0070] Figure 9 Figure 3 is a graph of the fluorescence enhancement of the fluorescent nucleoside triphosphate 1aTP and its incorporation into DNA (dashed line: nucleoside triphosphate 1aTP; solid line: the product of nucleoside triphosphate 1aTP at the same concentration after incorporation into DNA in a primer extension experiment);

[0071] Figure 10 The electrophoresis diagram of the PCR products using mixtures of 1aTP and TTP at different concentration ratios;

[0072] Figure 11 The graph shows the fluorescence spectrum and intensity change of the product of PCR using a mixture of 1aTP and TTP containing 50% 1aTP and the corresponding 1aTP concentration. DETAILED DESCRIPTION

[0073] To further illustrate the technical means and effects of the present invention, the present invention is further described below with reference to the embodiments and drawings. It should be understood that the specific embodiments described herein are only used to explain the present invention, rather than to limit the present invention.

[0074] If no specific techniques or conditions are specified in the examples, the experiments were carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0075] The present invention designs a novel structure of an aromatic ring-modified fluorescent turn-on nucleoside and cleverly designs a synthetic route. For example, in one embodiment of the present invention, a series of fluorescent turn-on nucleosides (named 1a to 1d) can be synthesized using the following route.

[0076]

[0077] This series of fluorescent nucleosides is synthesized by acetylation of 2'-deoxy-5-iodouridine with a sugar hydroxyl group using cuprous cyanide in pyridine as a solvent at high temperature to efficiently obtain 2'-deoxy-5-cyanouridine. 2'-deoxy-5-thiomethylamine uridine can be prepared by two novel methods: 1) reacting 2'-deoxy-5-cyanouridine with sulfur, pyridine, diethylamine, water, and DMF under carbon monoxide protection, or 2'-deoxy-5-thiomethylamine uridine with sodium hydrosulfide, pyridine, diethylamine hydrochloride, water, and DMF under nitrogen protection; 2'-deoxy-5-thiomethylamine uridine is then reacted with aromatic bromoethylketone in DMF to obtain the final fluorescent nucleoside product. The iodination and cyanation coupling of 2'-deoxyuridine, followed by thioformamide conversion and ring closure, eliminate the need for silica gel column purification, and the overall yield of the seven-step reaction can exceed 50%.

[0078] In the present invention, the prepared fluorescence-on nucleoside can be used to directly prepare fluorescent nucleoside phosphoramidite monomers or fluorescent nucleoside triphosphates. For example, in another specific embodiment of the present invention, fluorescence-on nucleosides 1a to 1d can be used for preparation. The route is shown below: nucleoside phosphoramidite monomers (6a to 6d), fluorescent nucleoside triphosphates (7a to 7d).

[0079]

[0080] In the specific embodiments of the present invention, the fluorescence-on nucleoside series 1a to 1d are used as examples for relevant verification and discussion.

[0081] Example 1

[0082] 1. Synthesis of Compound 2

[0083] 2'-Deoxyuridine (10 g) was dissolved in acetonitrile (100 mL), and triethylamine (6 mL), DMAP (530 mg) and acetic anhydride (11 g) were added. After reacting at 25°C for 20 min, methanol (10 mL) was added and stirring was continued for 5 min. The solvent was evaporated and dissolved in dichloromethane. The organic phase was washed with a dilute aqueous hydrochloric acid solution, extracted with a saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, evaporated to dryness, and redissolved in anhydrous acetonitrile. Cerium ammonium nitrate and elemental iodine were added, and the reaction was carried out at 80°C for 1 h. After cooling, the mixture was poured into an aqueous sodium sulfite solution, extracted with ethyl acetate, dried over anhydrous sodium sulfate, and evaporated to dryness to obtain a white foamy solid (iodide).

[0084] The iodide was dissolved in anhydrous pyridine, hexamethyldisilazane was added, nitrogen was protected, and the mixture was stirred at 25°C overnight. After evaporation, the mixture was dissolved in anhydrous pyridine again, cuprous cyanide was added, and the mixture was reacted at 120°C under nitrogen for 6 hours. After cooling to 25°C, the excess pyridine was evaporated and the mixture was dissolved in ethyl acetate. The solid was removed by filtration. The filtrate was washed with dilute hydrochloric acid to remove the excess pyridine, and then washed with saturated sodium chloride aqueous solution, dried over anhydrous sodium sulfate, and evaporated to obtain an off-white foamy compound, which can be directly used in the next reaction.1 The HNMR and HR-ESI MS structures are shown below. The reaction yield was 85%.

[0085] 1 H NMR (400MHz, DMSO-d6): δ12.11(s,1H),8.59(s,1H),6.08(t,J=6.7Hz,1H),5.20(dt,J=6.9,3.3Hz,1 H),4.32–4.19(m,3H),2.58–2.51(m,1H),2.40(ddd,J=14.5,6.4,3.3Hz,1H),2.06(d,J=1.6Hz,6H); 13 C NMR (100MHz, DMSO) δ170.1,170.0,160.0,149.8,148.9,114.2,88.7,86.0,81.8,73.3,63.4,36.5,20.7,20.5.

[0086] HR-ESI MS (m / z): [MH] - calcd for C 14 H 14 N3O7 - 336.0837,found 336.0837.

[0087] 2. Synthesis of compound 3

[0088] Compound 2 (4 g) was dissolved in N,N-dimethylformamide (DMF, 20 mL), and NaSH (2 g), diethylamine hydrochloride (2.6 g) and pyridine (3 mL) were added. H2O (5 mL) was added under nitrogen protection, and the mixture was reacted at 80°C for 4 h. After cooling, the mixture was poured into a dilute hydrochloric acid aqueous solution, extracted with ethyl acetate three times, washed with saturated sodium chloride, dried over anhydrous sodium sulfate, evaporated to dryness, ground in ethyl acetate, and filtered to obtain a yellow solid. 1 HNMR and 13 The C NMR results are shown below.

[0089] 1H NMR (400MHz, DMSO-d6): δ12.05(s,1H),10.21(d,J=4.4Hz,1H),9.91(d,J=4.4Hz,1H),9.15(s,1H),6.11(t,J=6.8Hz,1H),5.22(dt,J= 6.6, 2.4Hz, 1H), 4.43–4.35 (m, 1H), 4.21 (d, J = 3.9Hz, 2H), 2.53 (d, J = 2.2Hz, 1H), 2.41 (dt, J = 14.3, 6.8Hz, 1H), 2.07 (d, J = 8.9Hz, 6H).

[0090] 13 C NMR (100MHz, DMSO): δ191.43,170.16,170.00,162.56,149.61,148.97,109.16,86.62,82.36,74.20,63.72,37.65,20.80,20.74.

[0091] 3. Synthesis of Fluorescence-activated Nucleosides 1a-1d

[0092] Compound 3 (3 mmol) was dissolved in DMF, and compound 4 (aromatic bromoethyl ketone, 1.2 eq.) was added. The mixture was stirred at 105°C for 0.5 h. After cooling, the mixture was poured into cold water to precipitate a solid. The filtered solid was dissolved in ethanol and water (ethanol:water volume ratio 4:1). Sodium hydroxide (2.0 eq.) was added and the mixture was reacted at 25°C for 0.5 h. The mixture was neutralized with acetic acid until neutral. The ethanol was evaporated, and the mixture was triturated with water and filtered. After drying, the solid was triturated in ethyl acetate and filtered to obtain fluorescent nucleoside 1a. Other modified nucleosides can be prepared using this method.

[0093] Fluorescent on-type nucleoside 1a

[0094] Yellow solid, yield 78%, identification results are shown below.

[0095] 1 H NMR (500MHz, DMSO-d6): δ8.89(s,1H),7.63(d,J=5.0Hz,1H),7.33(d,J=4.9Hz,1H),6.23(t,J=6.6Hz,1H),5.33(s,1H), 5.10(s,1H),4.31(q,J=4.3Hz,1H),3.98(s,2H),3.89(q,J=3.7Hz,1H),3.66(qd,J=11.6,3.8Hz,2H),2.29–2.21(m,2H).

[0096] 13C NMR (150MHz, DMSO-d6): δ161.19,160.63,156.46,149.08,144.92,141.20,137. 67,136.35,128.52,117.16,107.59,87.20,84.90,69.82,60.65,39.75,30.54.

[0097] HR-ESI MS (m / z): [M+H] + calcd for C 17 H 16 N3O5S2 + 406.0526,found 406.0521.

[0098] Fluorescence-on nucleoside 1b

[0099] White solid, yield 82%, identification results are shown below.

[0100] 1 H NMR (400MHz, DMSO-d6) δ11.95 (s, 1H), 9.01 (s, 1H), 7.73 (d, J = 7.4Hz, 1H), 7. 56(d,J=7.5Hz,1H),7.39(t,J=7.4Hz,1H),7.26(t,J=7.5Hz,1H),6.23(t,J= 6.5Hz,1H),5.35(d,J=4.3Hz,1H),5.15(t,J=4.7Hz,1H),4.33(t,J=3.8Hz,1 H),3.94(s,2H),3.92–3.89(m,1H),3.74–3.64(m,2H),2.27(t,J=5.7Hz,2H).

[0101] 13 C NMR(100MHz,DMSO-d6)δ162.3,161.2,159.9,149.2,146.4,138.8,137.1,13 6.5,126.8,125.3,125.3,118.6,107.9,87.8,85.5,70.3,61.1,40.4,32.2.

[0102] HR-ESI MS (m / z): [M+H] + calcd for C 19 H 18 N3O5S + 400.0962,found 400.0962.

[0103] Fluorescent on-type nucleoside 1c

[0104] Yellow solid, yield 80%, identification results are shown below.

[0105] 1 H NMR (600MHz, DMSO-d6): δ11.91(s,1H),8.95(s,1H),7.59(d,J=8.3Hz,1H),7.18(s,1H),6.93(d,J=7.9Hz,1H),6.21(t,J=6.5Hz,1H),5.29(d, J=4.3Hz,1H),5.09(t,J=4.7Hz,1H),4.30(t,J=4.3Hz,1H),3.88(s,3H),3.78(s,3H),3.66(tq,J=11.7,7.6,5.8Hz,2H),2.24(t,J=5.3Hz,2H).

[0106] 13 C NMR (15MHz, DMSO-d6): δ161.43,160.70,159.33,157.39,148.71,147.86,138.05,134.29, 129.11,118.52,111.85,111.24,107.54,87.29,84.95,69.80,60.61,54.83,39.87,31.72.

[0107] HR-ESI MS (m / z): [M+H] + calcd for C 20 H 20 N3O6S + 430.1067,found 430.1065.

[0108] Fluorescent on-nucleoside 1d

[0109] Off-white solid, yield 90%, identification results are shown below.

[0110] 1H NMR (500MHz, DMSO-d6): δ11.98(s,1H),9.03(s,1H),7.45(d,J=8.2Hz,1H),7.29(d,J=2.5Hz,1H),6.84(dd,J=8.2,2.5Hz,1H), 6.24(t,J=6.5Hz,1H), 5.34(d,J=4.2Hz,1H),5.18(t,J=4.6Hz,1H),4.33(p,J=4.0Hz,1H),3.91( q,J=3.6Hz,1H),3.86(s,2H),3.84(s,3H),3.69(m,2H),2.31–2.24(m,2H).

[0111] 13 C NMR (101MHz, DMSO): δ162.47,161.82,160.32,159.11,158.46,158.40,149.59,145.29,138.86,138.57,138.37,138.21,136.03,135.84,130. 23,130.04,128.26,128.12,127.09,126.09,113.61,111.81,108.36,1 04.64,86.81,86.69,86.43,70.96,64.01,55.49,55.22,41.04,31.85.

[0112] HR-ESI MS (m / z): [M+Na] + calcd for C 20 H 19 N3NaO6S + 452.0887,found 452.0879.

[0113] Example 2

[0114] In this example, the fluorescent nucleosides 1a to 1d prepared in the example are used to further prepare nucleoside phosphoramidite monomers (6a to 6d) and fluorescent nucleoside triphosphates (7a to 7d).

[0115] 1. Synthesis of Compounds 5a-5d

[0116] Compounds 1a-1d (1 mmol) were co-evaporated twice with anhydrous pyridine, DMT-Cl (1.3 eq.) and DMAP (0.1 eq.) were added, and anhydrous pyridine was added under nitrogen. The mixture was stirred at 25°C overnight, and the pyridine was evaporated to dryness. The mixture was separated and purified by column chromatography (dichloromethane / methanol = 50 / 1).

[0117] Compound 5a

[0118] Yellow solid, yield 69%.

[0119] 1 H NMR (600MHz, DMSO-d6): δ11.99(s,1H),8.66(s,1H),7.46(d,J=5.0Hz,1H),7.39(d,J=7.3Hz,2H) ,7.27(t,J=9.3Hz,4H),7.18(t,J=7.6Hz,2H),7.09(t,J=7.3Hz,1H),6.71(dd,J=11.5,8.9Hz,4H) ,6.66(d,J=5.0Hz,1H),6.14(t,J=6.4Hz,1H),5.33(d,J=4.4Hz,1H),4.15(dd,J=6.4,3.6Hz,1H) ,3.99(q,J=3.8Hz,1H),3.91(s,2H),3.57(d,J=8.3Hz,6H),3.29–3.19(m,2H),2.34–2.22(m,2H).

[0120] 13 C NMR (126MHz, DMSO-d6): δ161.24,160.53,157.94,157.88,157.01,149.07,145.23,144.69,141.60,137.42,136.91,135.53,135 .38,129.76,129.55,128.53,127.69,126.56,117.62,113.03,108.01,86.20,85.91,70.48,63.41,54.78,54.76,40.50,30.91.

[0121] HR-ESI MS (m / z): [M+H] + calcd for C 38 H 34 N3O7S2 + 708.1833, found 708.1826.

[0122] Compound 5b

[0123] White solid, yield 66%.

[0124] 1H NMR (500MHz, DMSO-d6): δ12.05(s,1H),8.73(s,1H),7.52(d,J=6.4Hz,1H),7.42(d,J=7.5Hz,2H),7.33– 7.26(m,4H),7.21(dd,J=9.4,6.4Hz,4H),7.12(t,J=7.4Hz,1H),7.05–6.96(m,1H),6.82–6.66(m,4H),6 .17(t,J=6.4Hz,1H),5.37(d,J=4.3Hz,1H),4.18–4.12(m,1H),4.05(q,J=3.9Hz,1H),3.92(s,2H),3.58 (d,J=7.3Hz,6H),3.35–3.32(m,1H),3.24(dd,J=10.6,4.9Hz,1H),2.38–2.32(m,1H),2.29–2.21(m,1H).

[0125] 13 C NMR (125MHz, DMSO-d6): δ162.53,161.77,160.47,158.44,158.39,149.57,146.74,145.18,138.34,137.55,136.84,135.92,135.86, 130.21,130.08,128.19,128.16,127.06,125.62,125.53,119.05,113.52,108.30,86.76,86.39,71.01,63.97,55.27,40.99,32.59.

[0126] HR-ESI MS (m / z): [M+H] + calcd for C 40 H 36 N3O7S + 702.2268, found 702.2267.

[0127] Compound 5c

[0128] Yellow solid, yield 65%.

[0129] 1H NMR (500MHz, DMSO-d6): δ12.04(s,1H),8.69(s,1H),7.42(d,J=7.5Hz,2H),7.29(dd,J=8.8,4.1Hz,4H),7.21 (t,J=7.6Hz,2H),7.16(d,J=2.2Hz,1H),7.13(t,J=7.3Hz,1H),6.91(d,J=8.3Hz,1H),6.80–6.69(m,5H),6.16 (t,J=6.4Hz,1H),5.38(d,J=4.2Hz,1H),4.19–4.12(m,1H),4.05(q,J=4.0Hz,1H),3.88(s,2H),3.79(s,3H), 3.59(d,J=7.3Hz,6H),3.35–3.32(m,1H),3.23(dd,J=10.5,4.9Hz,1H),2.38–2.31(m,1H),2.28–2.22(m,1H).

[0130] 13 C NMR(125MHz,DMSO d6): δ162.2,161.8,160.4,158.5,158.4,158.2,149.6,148.7,145.2,138.1,136.0,135.9,135.3,130.2,130.1,130. 0128.2,128.2,127.1,119.5,113.6,112.58,112.00,108.43,86.76,86.41,71.06,64.01,55.77,55.29,40.95,32.65.

[0131] HR-ESI MS (m / z): [M+H] + calcd for C 41 H 38 N3O8S + 732.2374found 732.2372.

[0132] Compound 5d

[0133] White solid, yield 60%.

[0134] 1HNMR (500MHz, DMSO-d6): δ12.07(s,1H),8.73(s,1H),7.44–7.39(m,3H),7.30(t,J=9.0Hz, 4H),7.20(t,J=7.7Hz,2H),7.11(t,J=7.3Hz,1H),6.83(d,J=2.5Hz,1H),6.79–6.73(m,5H), 6.16(t,J=6.4Hz,1H),5.35(d,J=4.4Hz,1H),4.11(dq,J=8.1,4.0Hz,1H),3.98(q,J=3.9Hz, 1H), 3.85 (s, 2H), 3.56 (d, J = 4.4Hz, 6H), 3.51 (s, 3H), 3.35–3.26 (m, 3H), 2.37–2.26 (m, 2H).

[0135] 13 C NMR (100MHz, DMSO-d6): δ162.47,161.82,160.32,159.11,158.46,158.40,149.59,145.29,138.86,138.57,138.37,138.21,136.03,135.84,13 0.23,130.04,128.26,128.12,127.09,126.09,113.61,111.81,108.36, 104.64,86.81,86.69,86.43,70.96,64.01,55.49,55.22,41.04,31.85.

[0136] HR-ESI MS (m / z): [M+Na] + calcd for C 41 H 37 N3NaO8S + 754.2194, found 754.2191.

[0137] 2. Synthesis of Nucleoside Phosphoramidite Monomers 6a to 6d

[0138] Compounds 5a-5d (1 mmol) were co-evaporated twice in toluene and then dissolved in dry dichloromethane under nitrogen. Dry DIPEA (3.0 eq.) and 2-cyanoethyl N,N-diisopropylchlorophosphoramidite (1.3 eq.) were added sequentially. The mixture was reacted at 25°C for 15 min, and then extracted with saturated sodium bicarbonate solution. The organic phase was dried over anhydrous sodium sulfate and purified by column chromatography (petroleum ether / ethyl acetate = 1 / 1).

[0139] Nucleoside phosphoramidite monomer 6a

[0140] Yellow foamy substance, yield 88%.

[0141] 1 H NMR (400MHz, DMSO-d6): δ12.04(s,1H),8.71(d,J=10.4Hz,1H),7.48(t,J=5.7Hz,1H),7.41(dd,J=7.7,4.5Hz,2H),7.33–7.2 5(m,4H),7.19(t,J=7.6Hz,2H),7.12(t,J=7.3Hz,1H),6.78–6.63(m,5H),6.17(dt,J=12.0,6.3Hz,1H),4.40(s,1H),4.20–4 .10(m,1H),3.97–3.90(m,2H),3.72(t,J=8.8Hz,1H),3.64–3.54(m,8H),3.51(ddd,J=9.9,6.7,3.4Hz,1H),3.33(s,1H),3.2 8–3.23(m,1H),2.76(t,J=5.9Hz,1H),2.66(d,J=6.0Hz,1H),2.45(t,J=5.6Hz,2H),1.16–1.07(m,9H),1.00(d,J=6.7Hz,3H).

[0142] 31 P NMR (200MHz, DMSO): δ147.42, 147.30.

[0143] HR-ESI MS (m / z): [M+H] + calcd for C 47 H 51 N5O8PS2 + 908.2911,found 908.2910.

[0144] Nucleoside phosphoramidite monomer 6b

[0145] White foamy substance, yield 85%.

[0146] 1H NMR (500MHz, DMSO-d6): δ12.05(s,1H),8.76(d,J=15.3Hz,1H),7.57–7.49(m,1H),7.46–7.38(m,2H),7.33–7.26(m,4H), 7.24–7.11(m,5H),7.04–6.99(m,1H),6.80–6.68(m,4H),6.19(dt,J=13.0,6.4Hz,1H),4.46–4.36(m,1H),4.18(dq,J=21. 0,3.9Hz,1H),3.92(d,J=3.1Hz,2H),3.79–3.68(m,1H),3.64–3.47(m,9H),3.42(ddd,J=29.8,10.7,3.4Hz,1H),3.30–3.2 4(m,1H),2.77(t,J=5.9Hz,1H),2.66(td,J=5.8,1.8Hz,1H),2.50–2.38(m,2H),1.18–1.07(m,9H),1.01(d,J=6.7Hz,3H).

[0147] 31 P NMR (202MHz, DMSO-d6): δ147.56, 147.41.

[0148] HR-ESI MS (m / z): [M+H] + calcd for C 49 H 53 N5O8PS + 902.3347, found 902.3346.

[0149] Nucleoside phosphoramidite monomer 6c

[0150] Yellow foamy product, yield 84%.

[0151] 1HNMR (500MHz, DMSO-d6): δ12.04(s,1H),8.72(d,J=14.9Hz,1H),7.42(s,2H),7.29(s,4H),7.21(t,J=7.6Hz,2H), 7.14(dd,J=14.5,7.1Hz,2H),6.93(t,J=8.0Hz,1H),6.74(d,J=8.6Hz,5H),6.18(dt,J=12.3,5.6Hz,1H),4.42(s, 1H),4.17(d,J=20.8Hz,1H),3.88(s,2H),3.79(s,4H),3.59(d,J=4.8Hz,9H),3.43(d,J=10.4Hz,1H),3.29–3.22( m,1H),2.77(t,J=5.9Hz,1H),2.67(d,J=6.1Hz,1H),2.50–2.37(m,2H),1.17–1.08(m,9H),1.01(d,J=6.7Hz,3H).

[0152] 31 P NMR (202MHz, DMSO-d6): δ147.53, 147.38.

[0153] HR-ESI MS (m / z): [M+H] + calcd for C 50 H 55 N5O9PS + 932.3453,found 932.3452.

[0154] Nucleoside phosphoramidite monomer 6d

[0155] White foamy substance, yield 87%.

[0156] 1H NMR (500MHz, DMSO-d6): δ12.04(s,1H),8.76(d,J=14.2Hz,1H),7.45–7.38(m,3H),7.34–7.26(m,4H),7.20(t,J=7.7Hz,2H),7.1 1(t,J=7.2Hz,1H),6.84(dd,J=5.1,2.4Hz,1H),6.81–6.71(m,5H),6.26–6.13(m,1H),4.37(dq,J=10.9,5.7Hz,1H),4.11(dq,J= 12.7,4.0Hz,1H),3.85(d,J=2.6Hz,2H),3.78–3.67(m,1H),3.61–3.47(m,12H),3.43(dd,J=10.9,3.2Hz,1H),3.30(dd,J=11.1, 6.0Hz,1H),2.77(t,J=5.9Hz,1H),2.70–2.64(m,1H),2.45(t,J=6.0Hz,1H),1.12(dd,J=10.4,6.7Hz,9H),0.99(d,J=6.7Hz,3H).

[0157] 31 P NMR (202MHz, DMSO-d6): δ147.62, 147.44.

[0158] HR-ESI MS (m / z): [M+H] + calcd for C 50 H 55 N5O9PS + 932.3453, found 932.3445.

[0159] 3. Synthesis of fluorescent nucleoside triphosphates 7a to 7d

[0160] Compounds 1a to 1d (0.8 mmol) were co-evaporated twice with anhydrous pyridine and dissolved in dry trimethyl phosphate (0.5 mL) under nitrogen. Phosphorus oxychloride (1.5 eq.) was added under ice-bath and stirred for 2 h. Dry tributylamine (2.0 eq.) and 0.5 M tributylamine pyrophosphate (1.5 mL) were then added. The mixture was reacted at 25°C for 0.5 h, and then a 2 M aqueous solution of triethylamine ammonium carbonate (5 mL) was added. The aqueous phase was washed four times with dichloromethane, separated and purified on a C18 column (triethylamine carbonate (50 mM) containing 20% ​​acetonitrile) and lyophilized.

[0161] Fluorescent nucleoside triphosphate 7a

[0162] Yellow solid (32 mg), yield 44%.

[0163] 1 H NMR (500MHz, DMSO-d6): δ8.58(s,1H),7.58(d,J=4.9Hz,1H),7.49(d,J=5.0Hz,1H),6.15(t,J= 6.5Hz, 1H), 4.34 (dt, J = 6.6, 3.8Hz, 1H), 4.04 (d, J = 7.1Hz, 3H), 3.98 (s, 2H), 2.39–2.14 (m, 2H).

[0164] 31 P NMR (202MHz, DMSO-d6): δ-11.29,-11.40,-12.21,-12.33,-23.93,-24.05,-24.17.

[0165] HR-ESI MS (m / z): [MH] - calcd for C 17 H 17 N3O 14 P3S2 - 643.9370,found 643.9378.

[0166] Fluorescent nucleoside triphosphate 7b

[0167] White solid (30 mg), yield 40%.

[0168] 1 H NMR (500MHz, DMSO-d6): δ8.63(s,1H),7.87(d,J=7.5Hz,1H),7.56(d,J=7.4Hz,1H),7.38(t,J=7.5Hz,1H),7.26(t,J= 7.5Hz, 1H), 6.16 (t, J = 6.5Hz, 1H), 4.35 (dt, J = 6.6, 3.7Hz, 1H), 4.06 (d, J = 7.2Hz, 3H), 3.95 (s, 2H), 2.37–2.15 (m, 2H).

[0169] 31 P NMR (202MHz, DMSO-d6): δ-11.27,-11.38,-12.17,-12.29,-23.90,-24.01,-24.13.

[0170] HR-ESI MS (m / z): [MH] - calcd for C 19 H 19 N3O 14 P3S- 637.9806,found 637.9800.

[0171] Fluorescent nucleoside triphosphate 7c

[0172] Yellow solid (30 mg), yield 44%.

[0173] 1 H NMR (500MHz, DMSO-d6): δ8.60(s,1H),7.77(d,J=8.3Hz,1H),7.19(d,J=2.2Hz,1H),6.94(dd,J=8.3,2.4Hz,1H) ,6.16(t,J=6.5Hz,1H),4.36–4.32(m,1H),4.05(d,J=6.4Hz,3H),3.90(s,2H),3.80(s,3H),2.36–2.15(m,2H).

[0174] 31 P NMR (202MHz, DMSO-d6): δ-11.22,-11.33,-12.20,-12.32,-23.85,-23.96,-24.08.

[0175] HR-ESI MS (m / z): [MH] - calcd for C 20 H 21 N3O 15 P3S - 667.9912,found 667.9920.

[0176] Fluorescent nucleoside triphosphate 7d

[0177] White solid (30 mg), yield 44%.

[0178] 1 H NMR (500MHz, DMSO-d6): δ8.66(s,1H),7.48(d,J=2.4Hz,1H),7.42(d,J=8.2Hz,1H),6.80(dd,J=8.3,2.5Hz,1H), 6.16(t,J=6.5Hz,1H), 4.37(dd,J=9.6,4.5Hz,1H), 4.09–4.02(m,3H), 3.86(d,J=8.5Hz,5H), 2.35–2.19(m,2H).

[0179] 31P NMR (162MHz, DMSO): δ-8.84,-8.98,-10.16,-10.32,-21.52,-21.66,-21.80.

[0180] HR-ESI MS (m / z): [MH] - calcd for C 20 H 21 N3O 15 P3S - 667.9912,found 667.9918.

[0181] Example 3

[0182] This example measures the fluorescence properties of fluorescence-on nucleosides 1a to 1d.

[0183] Dissolve the fluorescent open nucleosides 1a to 1d in DMSO to prepare 1×10 -4 mol / L mother solution, 300 μL of the mother solution was taken and diluted in a 10.0 mL volumetric flask with five solvents (1,4-dioxane, DMSO, anhydrous ethanol, methanol, ultrapure water) to make a concentration of 3×10 -5 mol / L solution (DMSO not exceeding 0.2%), and measure the UV absorption spectrum of the compound at 200-450 nm using a UV spectrophotometer.

[0184] Dissolve the fluorescent open nucleosides 1a to 1d in DMSO to prepare 1×10 -4 mol / L mother solution, and then take 50 μL of the mother solution into a 10.0 mL volumetric flask and add the corresponding five solvents (1,4-dioxane, DMSO, anhydrous ethanol, methanol and ultrapure water) to dilute it to a concentration of 5×10 -6 The fluorescence emission spectra of the compounds were measured at 300 nm to 650 nm using a Hitachi F-4500 fluorescence spectrophotometer in a 1.5 mol / L solution (DMSO not exceeding 0.2%). To avoid the influence of internal scattered light, the A value of the compound at the wavelength of maximum UV absorption did not exceed 0.5 when using a standard cuvette with a path length of 1 cm.

[0185] The results are as follows Figures 1 to 4 As shown, the fluorescence quantum efficiency of fluorescence-on nucleosides 1a, 1c, and 1d is very low in aqueous solution, but is enhanced by more than 20 times in organic solvents such as methanol, showing a significant fluorescence-on effect.

[0186] Example 4

[0187] This example tests the incorporation of fluorescent nucleosides into oligonucleotides and the corresponding fluorescence properties and Tm.

[0188] The phosphoramidite monomers 6a to 6d prepared in Example 2 were incorporated into the oligonucleotide ODN-1 using a DNA synthesizer, which can also be regarded as introducing the corresponding fluorescence-on nucleosides 1a to 1d into the oligonucleotide. The sequence after insertion is ACTCAX1XGCCGT, where X can be A, T, C, or G, and "X1X" represents the insertion position of the phosphoramidite monomer (that is, the insertion position of the corresponding fluorescence-on nucleosides 1a-1d). The bases on both sides can be A, T, C, or G. There are four forms, namely, the bases on both sides of the insertion are A, the bases on both sides of the insertion are T, the bases on both sides of the insertion are C, and the bases on both sides of the insertion are G. Single-stranded oligonucleotides and corresponding double-stranded oligonucleotides were prepared respectively, and their correctness was verified by Maldi.

[0189] Tm test: Oligonucleotides were dissolved in 0.1M NaCl, 10mM MgCl2, 10mM Na-cacodylate solution, and 3×10 -6 M, the fluorescence emission spectrum of the compound was measured at 380 nm to 700 nm using a Hitachi F-4500 fluorescence spectrophotometer, and the UV absorption spectrum of the oligonucleotide was measured at 200 to 450 nm using a UV spectrophotometer. The corresponding fluorescence-activated nucleosides 1a-1d were treated in the same manner as controls.

[0190] Fluorescence property test: Oligonucleic acid was dissolved in 0.1M NaCl, 10mM MgCl2, 10mM Na-cacodylate solution to prepare 1.5×10 -6 M, the absorbance at 260 nm was measured using a UV spectrophotometer at 0.6°C intervals from 20°C to 80°C or from 80°C to 20°C, and the Tm value was determined by data fitting. The corresponding fluorescence-activated nucleosides 1a-1d were treated in the same manner as controls.

[0191] The results are as follows Figure 5-Figure 8 As shown in Table 1, AA-1a is used as an example, indicating that the bases inserted on both sides of 1a are A, and the rest are similar. Tm experiments demonstrate that the designed and synthesized fluorescent nucleosides have similar properties and do not affect the stability of the double helix after incorporation into DNA. Compounds 1a, 1c, and 1d exhibit significant fluorescence enhancement when incorporated into single-stranded DNA (over 10-fold compared to the nucleoside monomers), and the fluorescence is further enhanced after forming a double-stranded structure. In addition, after incorporation into double-stranded DNA, the fluorescence brightness of fluorescent nucleoside 1b reaches over 4000, excluding adjacent G base sequences, making it one of the brightest fluorescent nucleosides in double-stranded DNA.

[0192] Table 1

[0193]

[0194] Example 5

[0195] This example performs a fluorescent nucleoside triphosphate primer extension experiment and a fluorescence test.

[0196] Primer (final concentration 5'-GGAGCTCAGCCTTCACTGA-3', 9 μM) and template (3'-CCT CGAGTCGGAAGTGACAATGCTATGCTATCGTATCGTATCG-5', 9 μM) were dissolved in reaction buffer (final volume 20 μL, 50 mM Tris-HCl, 16 mM (NH4)2SO4, 2.5 mM MgCl2, 0.1% Tween 20, pH 8.0), heated at 95°C for 3 min, cooled to 25°C and allowed to stand on ice for 30 min. Fluorescent nucleoside triphosphate 7a (nucleoside triphosphate prepared from 1a, which can be written as 1aTP, final concentration 45 μM) was first added to the reaction system. Then, dNTPs were added to the system (excluding TTP). Deep Vent polymerase (1 μL) was reacted at 55°C for 60 min to allow the fluorescent nucleoside triphosphate 7a to be incorporated into the nucleic acid. 340 μL of Tris-HCl buffer (pH=7.0) was added to the system to dilute it to a final concentration of 2.5 μM. The fluorescence spectra before and after the reaction were measured, respectively. Single fluorescent nucleoside triphosphate 7a was tested as a control.

[0197] Result graph Figure 9 As shown, the fluorescent nucleoside triphosphate 7a has almost no fluorescence in aqueous solution. At the same concentration, after being incorporated into DNA through enzymatic primer extension, the fluorescence is significantly enhanced, showing a switching characteristic.

[0198] Example 6

[0199] In this example, the fluorescent nucleoside triphosphate 1aTP was used to perform DNA PCR experiments and fluorescence analysis.

[0200] Reaction system (20 μL): primers 5′-caaggacaaaatacctgtattcctt-3′ and 5′-gacatcatgagagacatcgc-3′ (10 μM, 1 μL each), template (5′-gacatcatgagagacatcgcctctgggctaataggactacttctaatctgtaagagcagatccctggacaggcaaggaatacaggtattt tgtccttg-3′) (98 bp, 1 μM, 0.2 μL) or 5′-taatacgactcactatagggacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtgtaca tattaagaggaggagcatatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaat tttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaac acttgtcactactttcggttatggtgttc-3' (323 bp), natural dNTPs (dATP, dGTP, dCTP, 4 mM each in 1 μL), dTTP (4 mM, 1 μL), 1aTP (4 mM, 1 μL) (or 1aTP containing dTTP (content 0-95%)), KOD XL DNA polymerase (2.5 U / μL, 0.2 μL) and reaction buffer (10×, 2 μL). After an initial denaturation at 94°C for 3 min, 30 PCR cycles were run under the following conditions: denaturation at 94°C for 30 s, annealing at 55°C for 5 s, and extension at 72°C for 30 s. The PCR process ended with a final extension at 72°C for 5 min. The reaction was stopped when the reaction cooled to 4°C. The PCR products were analyzed by 2% agarose gel electrophoresis (stained with GelRed). The results are shown in Figure 2. Figure 10 As shown, where "+" indicates 100% dTTP and "--" indicates no dTTP. 15 The 1aTP content in 1aTP containing dTTP is 15%, and so on. The PCR product was diluted to a final concentration of 2.5 μM, and the fluorescence spectra before and after the reaction were measured. The results are shown in Figure 2. Figure 11 shown.

[0201] like Figure 10As shown in the figure, it is difficult to perform amplification using 1aTP alone in a PCR reaction; it needs to be mixed with dTTP, and when the 1aTP concentration is ≤75%, PCR amplification can be performed effectively. Figure 11 As shown, the fluorescence of DNA obtained by PCR amplification was significantly enhanced compared with 1aTP.

[0202] In summary, the present invention designs a novel fluorescent-on nucleoside structure and a method for synthesizing the nucleoside, which can obtain a series of aromatic ring-modified fluorescent-on nucleosides with high yield (the total yield of the seven-step reaction can reach over 50%) and without the need for silica gel column purification; the fluorescent-on nucleosides can be effectively converted into nucleoside phosphoramidites, and combined with a DNA synthesizer, fluorescent modifications can be incorporated at any specified position in the nucleic acid, making them suitable for fluorescent labeling and biomedical applications of nucleic acids; the fluorescent-on nucleosides can be effectively converted into nucleoside triphosphates, which can be used in biomedical applications such as enzymatic DNA synthesis, polymerase activity detection, and intracellular DNA fluorescent labeling and tracking.

[0203] The applicant states that the present invention is intended to illustrate the detailed methods of the present invention through the above-described embodiments, but the present invention is not limited to the above-described detailed methods, that is, it does not mean that the present invention must rely on the above-described detailed methods in order to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions for various raw materials in the products of the present invention, addition of auxiliary ingredients, and selection of specific methods, etc., are all within the scope of protection and disclosure of the present invention.

Claims

1. A fluorescence-turn-on nucleoside, characterized in that, the structural formula of the fluorescence-turn-on nucleoside is shown in Formula (2) or Formula (3); in Formula (2) and Formula (3), R is independently H; R in formula (3) 1 and R 2 is H, or R 1 is MeO and R 2 is H, or R 1 is H and R 2 is MeO; the preparation method of the fluorescence-turn-on nucleoside includes: using 2'-deoxyuridine to prepare the compound shown in Formula (4), using the compound shown in Formula (4) to prepare the compound shown in Formula (5), and reacting the compound shown in Formula (5) with the compound shown in Formula (6) to obtain the fluorescence-turn-on nucleoside; In formulas (4) and (5), R 3 is independently H for each; R in formula (6) 1 and R 2 is H, or R 1 is MeO and R 2 is H, or R 1 is H and R 2 is MeO; the preparation method of the compound shown in Formula (4) includes the following steps: (1-1) Dissolve 2'-deoxyuridine in an organic solvent, triethylamine, 4-dimethylaminopyridine and acetic anhydride, react, and perform post-treatment; (1-2) Mix the post-treatment product of step (1-1) with an organic solvent, ammonium cerium nitrate and iodine, react, and perform post-treatment; (1-3) Mix the post-treatment product of step (1-2) with pyridine and hexamethyldisilazane, react, add cuprous cyanide, and react to obtain the compound shown in Formula (4); the temperature of the reaction in step (1-1) is 20-30 °C, and the time is 20-60 min; the temperature of the reaction in step (1-2) is 70-100 °C, and the time is 0.5-3 h; the temperature of the reaction in step (1-3) is 25-120 °C, and the time is 20-30 h; the preparation method of the compound shown in Formula (5) includes: mix the compound shown in Formula (4) with NaSH, diethylamine hydrochloride and pyridine, react to obtain the compound shown in Formula (5); the temperature of the reaction is 70-100 °C, and the time is 2-6 h.

2. The fluorescence-turn-on nucleoside according to claim 1, characterized in that, the reaction of the compound shown in Formula (5) with the compound shown in Formula (6) includes: mix the compound shown in Formula (5) with an organic solvent and the compound shown in Formula (6), react, mix the reaction solution with water, dissolve the solid product in an ethanol aqueous solution, add a base to react to obtain the fluorescence-turn-on nucleoside.

3. A fluorescent nucleoside phosphoramidite monomer, characterized in that, the preparation raw materials of the fluorescent nucleoside phosphoramidite monomer include the fluorescence-turn-on nucleoside according to claim 1 or 2.

4. A fluorescent nucleoside triphosphate, characterized in that, the preparation raw materials of the fluorescent nucleoside triphosphate include the fluorescence-turn-on nucleoside according to claim 1 or 2.

5. Use of the fluorescence-turn-on nucleoside according to claim 1 or 2, the fluorescent nucleoside phosphoramidite monomer according to claim 3 or the fluorescent nucleoside triphosphate according to claim 4 in the preparation of nucleic acids.

6. Use of the fluorescence-turn-on nucleoside, fluorescent nucleoside phosphoramidite monomer or fluorescent nucleoside triphosphate according to claim 5 in the preparation of nucleic acids, characterized in that, the nucleic acid includes a fluorescent probe.

7. Use of the fluorescence-turn-on nucleoside according to claim 1 or 2, the fluorescent nucleoside phosphoramidite monomer according to claim 3 or the fluorescent nucleoside triphosphate according to claim 4 in the preparation of bioimaging reagents.

Images