New Ganoderma lucidum Strain M150311 with High Triterpenoid Content and Its Artificial Cultivation Method

Abstract

The present invention discloses a new Ganoderma lucidum strain M150311 with high triterpene content and its artificial cultivation method. Ganoderma lucidum HMGIM-M150311 has a preservation number of GDMCC No: 62404; the nucleotide sequence of its molecular marker is as shown in SEQ ID NO.1; its artificial cultivation method includes mycelium culture, post-ripening culture of mycelium, fruiting body management and fruiting body growth. The triterpene content of Ganoderma lucidum HMGIM-M150311 disclosed in the present invention is extremely high, and the total triterpene content of 45 reaches up to 28706.14 μg / g, far higher than that of the excellent market varieties widely used at present; the triterpene content of this strain reaches 2.8%, far higher than the 0.5% required by the pharmacopoeia. Judging from the cultivation and detection results, this strain is a strain with excellent yield, good cultivation traits, extremely high triterpene content and great development prospects.

Description

Technical Field

[0001] The present invention belongs to the technical field of agricultural microorganisms, and particularly relates to a new strain M150311 of Ganoderma lucidum with high triterpene content and an artificial cultivation method thereof. Background Art

[0002] At present, the industrial development of edible and medicinal fungi is booming. According to the statistics of the China Edible Fungi Association, edible fungi in China have now developed into the fifth largest crop after grain, vegetables, fruits, and sugar. In 2020, the total output of edible fungi in China reached 40.61 million tons (fresh products) (a 3.2% increase compared to 2019), with an output value of 346.6 billion yuan (a 10% increase compared to 2019), accounting for more than 70% of the global output. The number of practitioners is more than 30 million, making it a sunrise industry in the national economy.

[0003] Today, with the booming development of the edible and medicinal fungi industry, more and more rare edible and medicinal fungi varieties are gradually coming into people's view, and many original rare varieties have been gradually domesticated, such as Dictyophora indusiata, Agrocybe chaxingu, Lyophyllum decastes, Morchella esculenta, etc. However, there are also a large number of wild edible and medicinal fungi that have not been recognized by humans and have not been studied. According to research, there are about more than 3 million species of fungal species in the world, and only 1% of the species have been recognized. Among them, the known macrofungi are about 14,000 species. There are 1,789 species of edible fungi and 798 species of medicinal fungi confirmed in China, and among them, only less than 100 species of wild edible and medicinal fungi have been domesticated by humans, and there are only more than 30 varieties for large-scale cultivation. There is still a long way to go for humans in the research and utilization of macrofungi. With the gradual increase of people's living standards, the requirements for the quality of life are higher. Since macrofungi are rich in various components with nutritional and functional effects, including fungal polysaccharides, triterpenoids, sterols, etc., they have very good effects on human health and are increasingly attracting people's attention.

[0004] Ganoderma has a long medicinal history in China and has long been used for the adjuvant treatment of diseases such as tracheitis, hepatitis, hypertension, tumors, and immune disorders. Modern pharmacological and clinical research results also show that Ganoderma contains active ingredients that inhibit tumors and regulate immunity. Since DONK (1948) established the family Ganodermataceae, more than 200 species of macrofungi in the family Ganodermataceae have been reported worldwide. There are 103 species of Ganoderma recorded in China. With the development of molecular biology, after systematic research by taxonomists in recent years and removing species with the same name but different substances, it has now been basically confirmed that there are a total of 131 species of Ganoderma in the world, among which 23 species of Ganoderma are in China (Xing Jiahui et al., 2019).

[0005] At present, there are nearly a thousand kinds of health products based on Ganoderma lucidum in China, mainly in the form of capsules, tablets, powders, and tea bags. The main ingredients of the products are still Ganoderma lucidum polysaccharides and triterpenes, with an annual output value of more than 100 billion yuan, which plays a pivotal role in the industry. In addition, in the process of decades of research, its significant role in nutrition and health care has been demonstrated. Ganoderma lucidum (including Ganoderma lucidum and Ganoderma sinense) was included in the Chinese Pharmacopoeia in 2005 and in the United States Pharmacopoeia in 2010. As a prominent representative of Chinese medicinal fungi, the importance of its variety selection is self-evident.

[0006] At present, although there are 19 varieties of Ganoderma lucidum recognized by the state, including Shanghai Nong No. 1, one of which was introduced from abroad and three varieties were obtained through protoplast fusion. However, the strains used in the cultivation of Ganoderma lucidum in the main production areas (Shandong, Zhejiang, Jilin, Anhui, Fujian, Shaanxi, etc.) are basically Korean series varieties from South Korea. At the same time, Japanese and American Ganoderma lucidum are also widely used Ganoderma lucidum varieties. According to our 2016 strain survey, among the main strains being used in the main production areas of the country, there are 7 Korean strains, 2 American Ganoderma lucidum, 2 Longzhi, 2 Shanghai Nong, 1 Japanese Ganoderma lucidum, and 1 unclear variety. The locally selected Shanghai Nong, Longzhi and other series of varieties have been promoted to a certain extent. The natural climate and environment of the origin of the introduced varieties are very different from those of the cultivation areas, which causes the degradation of strain activity, confusion of names, low yield, poor quality, poor resistance to diseases and pests and other bacteria, and lack of excellent varieties suitable for cultivation in various production areas in my country. During the research process, we also found that the strain quality is unstable and very easy to degenerate. At the same time, the widely used Korean strains also face the characteristics of easy degeneration in production. According to the experience of Infinitus, the No. 1 health product sales company in China, Ganoderma lucidum varieties face the risk of degradation after 1-2 years of use. This is not only reflected in the decline in production, but more importantly, the main components that represent its efficacy, such as Ganoderma polysaccharides and Ganoderma triterpenes, have dropped significantly, seriously affecting product quality. There is a lack of special Ganoderma lucidum varieties independently bred in my country, such as varieties suitable for factory cultivation, varieties with high polysaccharides and high triterpenes, and varieties suitable for making ornamental trays. Therefore, the selection and breeding of Ganoderma lucidum strains is a bottleneck problem in the Ganoderma lucidum industry.

[0007] At the same time, Lingzhi is currently mainly cultivated on logs, which causes great damage to the environment. With the increase in environmental protection efforts, factory-based cultivation with substitute materials will replace log cultivation and become the mainstream cultivation method. However, the current Lingzhi strains are all selected and bred for log cultivation, and it is imperative to select and breed energy-saving and high-quality factory-based varieties for substitute material cultivation. Summary of the invention

[0008] The invention aims to provide a new strain M150311 of Ganoderma lucidum with high triterpene content and an artificial cultivation method thereof.

[0009] Ganoderma lucidum HMGIM-M150311 was deposited at the Guangdong Microbial Culture Collection Center (GDMCC) on April 21, 2022. Address: 5th Floor, Building 59, No. 100 Yard, Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province 510070. Deposit number: GDMCC No: 62404.

[0010] The second object of the present invention is to provide a cultivation method for the above Ganoderma lucidum HMGIM-M150311, which includes the steps of: mycelium culture, mycelium after-ripening culture, fruiting body management and fruiting body growth.

[0011] Preferably, the specific steps are as follows:

[0012] a. Mycelium culture: Inoculate the Ganoderma lucidum HMGIM-M150311 strain into the production mother culture medium, and culture it in the dark until the mycelium covers the slant surface, then transfer it to the production culture medium, and culture it in the dark until the mycelium fills the medium, then inoculate it into the artificial domestication medium, and culture it until the mycelium in the cultivation bag fills the cultivation material in the bag;

[0013] b. Mycelium after-ripening culture: After the mycelium matures, continue to culture it in the dark for after-ripening treatment;

[0014] c. Fruiting body management: Remove the lid of the mushroom bag, place the cultivation bags vertically, ventilate, provide light, maintain the temperature at 26°C - 28°C, and the relative air humidity above 90%, so that the mycelium knots and forms off-white primordia;

[0015] d. Fruiting body growth: Ventilate, provide light, maintain the temperature at 26°C - 28°C, the relative air humidity at 80% - 90%, and the CO2 concentration at 350 - 1500 ppm. Wait for the fruiting body to mature and the white edge to disappear, and then collect the fruiting body.

[0016] Preferably, the specific steps are as follows:

[0017] a. Mycelium culture: Inoculate the Ganoderma lucidum HMGIM-M150311 strain into the production mother culture medium, and culture it at a constant temperature of 25°C and in the dark for 10 - 15 days until the mycelium covers the slant surface; inoculate the mother culture mycelium into the production culture medium, and culture it at a constant temperature of 25°C in the dark until the mycelium fills the medium; inoculate the production culture mycelium into the artificial domestication medium, culture it at 25°C ± 1°C and with a relative air humidity of 60 - 70%, and in the dark for 20 - 30 days until the mycelium fills the medium and then enter the after-ripening management. Pay attention to ventilation during the mycelium growth process to keep the carbon dioxide concentration below 4000 ppm;

[0018] b. Mycelium after-ripening culture: After the mycelium matures, continue to place it in a dark place at 25°C for after-ripening treatment. After the after-ripening culture, it can enter the fruiting body stimulation stage;

[0019] c. Mushroom fruiting management: Control the temperature between 26°C and 28°C, increase the ventilation volume, remove the lid of the mushroom bag, adjust the relative air humidity to over 90%, provide 10 hours of light per day. When the mycelium knots and forms off-white primordia, maintain the relative humidity and do not directly spray water on the primordia;

[0020] d. Fruiting body growth: After the primordia grow to 0.5 cm, continue to control the temperature between 26 - 28°C, the relative air humidity between 85 - 90%, provide 10 hours of light per day, with a light intensity of 300 - 500 lx, and maintain the carbon dioxide concentration in the air at 350 - 1500 ppm, keep the air moist; until the Ganoderma lucidum is fully mature and spore powder spraying ends. During this period, spray water mist on the young Ganoderma lucidum 1 - 2 times a day until the size of the fruiting body is basically unchanged, indicating that the fruiting body has matured. At this time, it should be harvested. After harvesting, re-perform the mushroom fruiting treatment until the second flush of mushrooms is harvested.

[0021] Preferably, the production mother culture medium is: by mass fraction, including 20% potato + 2% glucose + 1% peptone + 2% agar + 0.3% potassium dihydrogen phosphate + 0.15% magnesium sulfate + trace vitamin B1; the production spawn culture medium is: by mass fraction, including 98 - 99% sorghum + 1 - 2% calcium carbonate; the artificial domestication culture medium is: by mass fraction, including 38% cottonseed hull + 50% wood chips + 10% bran + 2% CaCO3, with a moisture content of 60% - 65% and a natural pH.

[0022] The present invention obtained the genomic sequence information of Ganoderma lucidum HMGIM-M150311 by using whole-genome resequencing technology, obtained an InDel variant site set through bioinformatics analysis, designed specific primers accordingly, and obtained a specific DNA fragment of wild Ganoderma lucidum HMGIM-M150311 through PCR amplification, which is the molecular marker of Ganoderma lucidum strain HMGIM-M150311.

[0023] The nucleotide sequence of the molecular marker of Ganoderma lucidum HMGIM-M150311 is as shown in SEQ ID NO.1.

[0024] The present invention also provides a primer set for identifying Ganoderma lucidum HMGIM-M150311, including:

[0025] M311-8 primer pair: M311-8-F: TCCTGATCCCGTTTATTGCCC and M311-8-R: GCTTCACCCGTCCTTTCGAT;

[0026] Or

[0027] M311-Y primer pair: M311-YF2: AGGCCGTGCCTCATGGTAG and M311-YR2: GAACGAACCGTTGTCTTGTCG.

[0028] The present invention also provides the application of the molecular marker or identification primer set of Ganoderma lucidum HMGIM-M150311 in identifying Ganoderma lucidum HMGIM-M150311.

[0029] The present invention also provides a method for identifying Ganoderma lucidum HMGIM-M150311. The specific steps include: extracting the genomic DNA of the Ganoderma lucidum to be tested, performing PCR amplification with the above-mentioned M311-8 primer pair. If a characteristic band can be amplified, it is Ganoderma lucidum HMGIM-M150311, otherwise it is not; or performing a fluorescence PCR reaction with the above-mentioned M311-Y primer pair or the identification primer set. If the melting curve shows that a characteristic peak can be generated, it is Ganoderma lucidum HMGIM-M150311. If a characteristic peak cannot be generated, it is not Ganoderma lucidum HMGIM-M150311.

[0030] Preferably, the size of the characteristic band amplified by PCR is 600-700bp.

[0031] In the present invention, the method based on the differential sites of the genome has the advantages of high efficiency and rich specific sites compared with the traditional method of random primer amplification, and can protect the bacterial strains more effectively. Compared with the conventional observation of the fruiting body morphology and mycelial antagonistic line, it has the advantages of short detection time, objective and true detection results, and high accuracy.

[0032] Judging from the cultivation and detection results, the Ganoderma lucidum strain in the present invention is a new strain with excellent yield, good cultivation traits, and the content of the main active ingredient triterpenoids much higher than that of the commonly used varieties in the market, and is a bacterial strain with development prospects.

[0033] Ganoderma lucidum HMGIM-M150311 was deposited at the Guangdong Provincial Culture Collection Center of Microorganisms (GDMCC) on April 21, 2022. Address: 5th Floor, Building 59, No. 100 Yard, Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postcode: 510070, Deposit Number: GDMCC No: 62404. Description of the Drawings

[0034] Figure 1 is the wild fruiting body of Ganoderma lucidum HMGIM-M150311.

[0035] Figure 2 is the phylogenetic tree of Ganoderma lucidum constructed based on the NJ method.

[0036] Figure 3It is the fruiting body of the artificially domesticated Ganoderma lucidum HMGIM-M150311.

[0037] Figure 4 It is the amplification result diagram of the M311-8-F / R primer pair in Ganoderma lucidum HMGIM-M150311 (M311) and market varieties.

[0038] Figure 5 It is the amplification result diagram of the specific primer pair in Ganoderma lucidum HMGIM-M150311 and market varieties. Detailed implementation mode

[0039] The following examples are further explanations of the present invention, rather than limitations of the present invention.

[0040] Example 1: Obtaining and identification of Ganoderma lucidum HMGIM-M150311

[0041] In April 2015, Tan Wuping, Zhong Yuanmao, etc. collected a Ganoderma lucidum specimen in Yuanbao Mountain, Guangxi Figure 1 ). The scientific research personnel of the Edible Fungi Research and Development Center of the Guangdong Institute of Microbiology obtained its PDA pure culture by tissue isolation method, numbered HMGIM-M150311.

[0042] Take fresh mycelium and grind it with liquid nitrogen. Use the Ezup column fungal genomic DNA extraction kit [product number SK8259, produced by Sangon Biotech (Shanghai) Co., Ltd.] to extract the DNA genome. The obtained DNA solution is stored at -20°C for later use. Through the ITS-PCR experiment of the material with the universal primers ITS1 / ITS4 of the fungal ribosomal gene spacer region (ITS1: TCCGTAGGTGAACCTGCGG; ITS4: TCCTCCGCTTATTGATATGC, synthesized by Sangon Biotech (Shanghai) Co., Ltd.), the amplification is carried out on a Biometra PCR instrument. The composition of the PCR reaction solution (a total of 50 μl) is: TaKaRa Taq (5 units / μl), 0.25 μL; 10×PCR Buffer, 5 μL; dNTP Mixture (each 2.5 mM), 4 μL; DNA template 2 μL; primer 1 (10 μmol·L-1), 5 μL; primer 2 (10 μmol·L-1), 5 μL; sterilized distilled water 28.75 μL. The relevant reagent (product number R001A) is produced by Takara Bio Inc. (Dalian). The reaction conditions are: react at 94°C for 5 min; react at 94°C for 1 min, 55°C for 1 min, 72°C for 1 min, for 30 cycles; react at 72°C for 10 min. The PCR product is directly sent for bidirectional sequencing and completed by BGI.

[0043] Its ITS sequence is: CTTCCGAGGCATGTGCACGCCCTGTTCATCCACTCTACACCTGTGCA CTTACTGTGGGCTTCAGATTGCGAGGCACGCTCTTTACCGGGCTTGCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTTGTAGGCTTGGACTTGGAGGCTTGTCGGCCGTTATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAATGTCTACGCCGTGACCGTGAAGCATTTGGCGAGCTTCTAAC。

[0044] The sequencing results were subjected to sequence Blast in GenBank and found to have a similarity of up to 99.8% with Ganoderma lingzhi. At the same time, we combined the standard bands of the genus Ganoderma and constructed a phylogenetic tree using the neighbor-joining method (NJ) with Amauroderma rude as the outgroup ( Figure 2 ). The phylogenetic tree also showed that Ganoderma HMGIM-M150311, the commonly used market varieties Hanzhi No. 2 and Hunong No. 1, are all Ganoderma lingzhi.

[0045] Combined with morphological identification, the macroscopic and microscopic characteristics of this fungal specimen are consistent with the description of G. lingzhi, and the identification result is G. lingzhi. Since the original Latin name of Ganoderma in China was Ganoderma lucidum, named by European taxonomists, in 2012, the team led by Dai Yucheng found that the Ganoderma that had been used in China was actually another species, G. lingzhi. There are subtle differences in microscopic and macroscopic morphology between the two. To distinguish them, the original Ganoderma lucidum species was named Ganoderma applanatum. G. lingzhi is widely distributed in the warm temperate and subtropical regions of eastern China. Its main morphological characteristics are that the pore surface is white to sulfur-yellow, there is a dark brown zone in the flesh when mature, and the thickness of the pore wall is 80-120 μm. Ganoderma lucidum is mainly distributed in Europe and Asia, and in China it is distributed in the higher altitude areas of Central China. Its pore surface is white to cream-colored when fresh, there is no dark brown zone in the flesh when mature, and the thickness of the pore wall is 40-80 μm. From the classification results, HMGIM-M150311 should be G. lingzhi. However, since the Latin name of Ganoderma in the pharmacopoeia has always been Ganoderma lucidum, in order for the strain to be used normally, in this article, HMGIM-M150311 is still labeled as Ganoderma lucidum and named: Ganoderma lucidum (HMGIM-M150311), which was deposited in the Guangdong Microbial Culture Collection Center (GDMCC) on April 21, 2022. Address: 5th Floor, Building 59, No. 100 Yard, Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province, Zip Code: 510070, Deposit Number: GDMCC No: 62404.

[0046] Example 2: Domestication and Cultivation of Ganoderma lucidum HMGIM-M150311

[0047] I. Strains and Culture Media

[0048] Source of the strain: Yuanbaoshan, Guangxi.

[0049] 1. Mother culture medium

[0050] Isolation mother culture medium (comprehensive PDA): By mass fraction, it includes 20% potato + 2% glucose + 2% agar + 0.3% potassium dihydrogen phosphate + 0.15% magnesium sulfate + trace vitamin B1.

[0051] Purification mother culture medium (Rose Bengal medium): By mass fraction, it includes 0.5% peptone + 1% glucose + 0.1% potassium dihydrogen phosphate + 0.05% magnesium sulfate (MgSO4·7H2O) + 2% agar + 10% 1 / 3000 Rose Bengal solution + 0.01% chloramphenicol + distilled water.

[0052] Production of mother culture medium (enriched comprehensive PDA): By mass fraction, it includes 20% potato + 2% glucose + 1% peptone + 2% agar + 0.3% potassium dihydrogen phosphate + 0.15% magnesium sulfate + trace vitamin B1

[0053] 2. Production of spawn culture medium

[0054] By mass fraction, it includes 99% sorghum + 1% calcium carbonate.

[0055] 3. Artificial domestication medium

[0056] By mass fraction, it includes 38% cottonseed hulls + 50% sawdust + 10% bran + 2% CaCO3, with a moisture content of 60%-65% and a natural pH.

[0057] II. Technical parameters during cultivation process

[0058] 1. Mycelium culture

[0059] Cultivate at a constant temperature of 25°C in the dark, with a humidity of 50%-60%. Pay attention to ventilation during the mycelium growth process to keep the carbon dioxide concentration below 4000 ppm.

[0060] 2. Mycelium after-ripening culture

[0061] After the mycelium matures, continue to place it in a dark place at 25°C for after-ripening treatment. After after-ripening culture, it can enter the fruiting stimulation stage.

[0062] 3. Fruiting management

[0063] Control the temperature between 26°C and 28°C, increase the ventilation volume, remove the lid of the mushroom bag, adjust the relative air humidity to over 90%, provide 10 hours of light per day. After 5-7 days, the mycelium begins to knot and form off-white primordia. At this time, keep the relative humidity and do not spray water directly on the primordia.

[0064] 4. Fruiting body growth

[0065] Control the space temperature between 26°C and 28°C, the relative air humidity between 80% and 90%, increase the ventilation volume to keep the CO2 concentration between 350 and 1500 ppm, and keep the diffused light duration at 10 hours per day. The fruiting body matures in about 48 days, the white edge disappears, and the fruiting body is collected.

[0066] After picking, re-perform fruiting treatment. The second flush of mushrooms appears about 10 days later and matures in about 25 days.

[0067] III. Fruiting situation

[0068] 1. Fruiting period: The fruiting cycle of the first flush of mushrooms of this variety is 99 days, and the fruiting cycle of the second flush of mushrooms is 137 days.

[0069] 2. Yield: The average yield of Ganoderma lucidum per bag for the first flush is 59 grams, and the total yield for two flushes is 78 grams. The biological conversion rate for two flushes is 19.5%, and the yield of bag cultivation is higher than that of common market varieties.

[0070] 3. Fruit body characteristics: The fruit body is in the shape of a wishful object, with a lacquer-like luster on the surface, reddish-brown in color, complete in Ganoderma lucidum shape, and good in appearance ([ Figure 3 ). Compared with the wild state, the fruit bodies of this variety are uniform in size, round in shape, and have a higher yield after artificial domestication. This variety is a low-spore variety, and the yield of Ganoderma lucidum spores is also very small after the fruit body is fully mature, which is conducive to industrial cultivation.

[0071] IV. Specific operations

[0072] 1. Mother culture preparation

[0073] 1.1 Strain isolation

[0074] Dispense the mother culture medium for isolation into test tubes, sterilize it under high-temperature and high-pressure wet heat at 0.11 MPa atmospheric pressure and 121 °C for 30 min, take it out and cool it to form a slant. After wiping the surface of the wild fruit body collected back with 75% alcohol under sterile conditions, tear it open with sterilized pliers, and inoculate the internal flesh tissue of 0.2 - 0.5 mm × 0.2 - 0.5 mm into the slant containing the mother culture medium for isolation in a sterile operation manner. Place it in an incubator at 25 °C for constant-temperature dark culture. After the mycelium fills the slant, it can be transferred. The time for the mother culture to grow full is approximately between 15 - 20 days.

[0075] 1.2 Strain purification

[0076] Prepare the purification mother culture medium according to the formula, dispense it into test tubes, sterilize it under high-temperature and high-pressure wet heat at 0.11 MPa atmospheric pressure and 121 °C for 30 min, and transfer the strains infected with bacteria after isolation. Place it in an incubator at 25 °C for constant-temperature dark culture. When the mycelium grows and the bacteria have not grown, pick and transfer the tip mycelium to obtain the successfully isolated strain, which is Ganoderma lucidum HMGIM-M150311.

[0077] 1.3 Production mother culture preparation

[0078] Conventionally prepare the production mother culture medium, dispense it into test tubes, sterilize it under high-temperature and high-pressure wet heat at 0.11 MPa atmospheric pressure and 121 °C for 30 min, take it out and cool it, and inoculate the successfully isolated Ganoderma lucidum HMGIM-M150311 strain in a sterile operation manner. Place it in an incubator at 25 °C for constant-temperature dark culture. After the mycelium fills the slant, the production mother culture can be obtained for transfer. The time for the mother culture to grow full is approximately between 10 - 15 days.

[0079] 2 Production medium preparation

[0080] Weigh the sorghum in the required proportion, soak it in water overnight, mix in calcium carbonate in proportion, and put it into a 250 mL conical flask, with 100 - 150 g of dry material in each flask. Seal it with a silica gel plug. Sterilize it at a high temperature and humidity of 128 °C and an atmospheric pressure of 0.147 MPa for 90 min. After taking it out and cooling, loosen the culture medium and inoculate the production mother strain under sterile conditions. Ensure that the mother strain material block is buried in the original strain material during inoculation. Place the inoculated original strain in an incubator at 25 °C for constant temperature and dark culture. It can be used as a production strain to inoculate the cultivation bag after the mycelium fills the material (about 20 days).

[0081] 3 Cultivation bag production

[0082] Weigh the required proportion of the culture material for the artificially domesticated culture medium, mix it thoroughly and add water (water content is 60 - 65%), and put it into a heat-resistant transparent polypropylene strain bag of 17 cm × 35 cm. Each bag contains 400 - 420 g of dry material. After filling the material, make holes in the bag material with a small wooden stick, with the hole depth reaching the bottom of the bag. Then put a plastic ring on the bag mouth and fasten the matching lid to obtain a prepared bag material. Sterilize it at a high temperature and humidity of 128 °C and an atmospheric pressure of 0.147 MPa for 90 min. After taking it out and cooling, inoculate the production strain under sterile conditions. After inoculation, culture it in the dark in an incubator at 25 °C ± 1 °C and an air relative humidity of 60 - 70%. After the mycelium fills the material (about 20 - 30 days), it can enter the after-ripening management process.

[0083] 4. Cultivation management

[0084] 4.1 After-ripening management

[0085] After the mycelium in the cultivation bag fills the cultivation material in the bag, continue the shading after-ripening culture for 20 - 25 days, and then it can enter the fruiting stage.

[0086] 4.2 Primordium formation

[0087] Control the temperature at 26 - 28 °C, increase the ventilation volume, keep the carbon dioxide content in the space below 1%, adjust the air relative humidity to more than 90%, and have 10 hours of light per day. After 5 - 7 days, remove the mushroom cap, place the cultivation bags vertically (leave gaps between the bags), and at this time the mycelium begins to knot and form off-white granular primordia.

[0088] 4.3 Fruit body growth

[0089] After the primordium grows to 0.5 cm, continue to control the temperature at 26 - 28 °C, the relative air humidity between 85 - 90%, with 10 hours of light per day, the light intensity of 300 - 500 lx, and maintain the carbon dioxide concentration in the air at 350 - 1500 ppm, keeping the air moist. After about 48 days, the Ganoderma lucidum is completely mature and the spore powder spraying ends. During this period, spray water mist on the young Ganoderma lucidum 1 - 2 times a day until the size of the fruiting body is basically unchanged, indicating that the fruiting body has become mature, and it should be harvested at this time. It takes about 48 days from the emergence of the primordium to the maturity of the fruiting body.

[0090] Example 3: Determination of the main active ingredients of Ganoderma lucidum HMGIM - M150311

[0091] I. Content of Ganoderma lucidum polysaccharide

[0092] The extraction of crude polysaccharide is carried out according to the method for the determination of the content of Ganoderma lucidum crude polysaccharide in the pharmacopoeia. The method is as follows:

[0093] 1. Preparation of the reference solution: Take an appropriate amount of anhydrous glucose reference substance, accurately weigh it, and dissolve it in water to make a solution containing 0.12 mg per 1 mL, that is, obtain.

[0094] 2. Preparation of the standard curve: Accurately measure 0.2, 0.4, 0.6, 0.8, 1.0, 1.2 mL of the reference solution respectively, place them in 10 - mL stoppered test tubes, add water to each to 2.0 mL, quickly and accurately add 6 mL of sulfuric acid anthrone solution (accurately weigh 0.1 g of anthrone, dissolve it in 100 mL of sulfuric acid, shake well), shake immediately, let stand for 15 minutes, then immediately place it in an ice bath and cool for 15 minutes, take it out, use the corresponding reagent as the blank, according to the ultraviolet - visible spectrophotometry (General Rule 0401), measure the absorbance at the wavelength of 625 nm, take the absorbance as the ordinate and the concentration as the abscissa, and draw the standard curve.

[0095] 3. Preparation of the test solution: Take about 2 g of the powder of this product, accurately weigh it, place it in a round - bottom flask, add 60 mL of water, let it stand for 1 hour, heat under reflux for 4 hours, filter while it is hot, wash the filter and the residue with a small amount of hot water, place the residue and the filter paper in the flask, add 60 mL of water, heat under reflux for 3 hours, filter while it is hot, combine the filtrates, evaporate to dryness on a water bath, dissolve the residue in 5 mL of water, slowly add 75 mL of ethanol dropwise while stirring, shake well, place it at 4 °C for 12 hours, centrifuge, discard the supernatant, dissolve the precipitate in hot water and transfer it to a 50 - mL volumetric flask, let it cool, add water to the scale, shake well, take an appropriate amount of the solution, centrifuge, accurately measure 3 mL of the supernatant, place it in a 25 - mL volumetric flask, add water to the scale, shake well, that is, obtain.

[0096] 4. Determination method: Precisely measure 2 mL of the test solution, place it in a 10 mL stoppered test tube, and follow the method under the preparation of the standard curve. Starting from "Quickly and precisely add 6 mL of sulfuric acid anthrone solution", perform the same operation, measure the absorbance, read the content of anhydrous glucose in the test solution from the standard curve, and calculate to obtain the result.

[0097] Calculated on the dried basis, this product contains Ganoderma lucidum polysaccharide calculated as anhydrous glucose (C6H 12 O6), and the polysaccharide content is 0.95%, exceeding the pharmacopoeia requirement of 0.9%.

[0098] II. Triterpenoid content

[0099] Adopt the invention patent methods of the team of Professor Feng Na and Zhang Jinsong from the Shanghai Academy of Agricultural Sciences (CN202011236775.0 A method for simultaneously detecting 25 triterpenoid compounds in Ganoderma lucidum fruiting bodies) and (CN202111210687.8 A method for detecting neutral triterpenoids in Ganoderma fungi), and use ultra-high performance liquid chromatography-triple quadrupole mass spectrometry combined analysis method to determine 25 acidic triterpenoids (mainly including ganoderic acid, ganoderenic acid, ganodermanontic acid, etc.), 14 and 6 total triterpenoids (mainly including neutral triterpenoids such as ganodermal aldehyde, ketone, alcohol, ester compounds, etc., and also including some ganoderic acids) in Ganoderma lucidum fruiting bodies (Table 1).

[0100] Table 1 Details of triterpenoids determined in this experiment

[0101]

[0102]

[0103] The detection results show that the content of 45 total triterpenoids in Ganoderma HMGIM-M150311 is as high as 28706.14 μg / g, far higher than the commonly used varieties Hanzhi No. 2 and Hunong No. 1 in the current domestic market, and is 1 and 1.2 times higher than the latter two respectively (Table 2). Among them, ganoderic acid A, which has clear important functions such as protecting the liver and antioxidation (also the component with the largest content among all Ganoderma triterpenoids), has a content comparable to that of Hunong No. 1 and Hanzhi No. 2 in the market. Ganoderic acid B, which has functions such as anti-HIV, analgesia, and antioxidation, has a content 4 times higher than that of Hunong No. 1 and 12 times higher than that of Hanzhi No. 2. In addition, the contents of ganoderic acid K, G (analgesia), H (analgesia), D (antioxidation, inhibiting histamine), C2 and C6 (antioxidation, inhibiting histamine), etc. are also much higher than those of market varieties (Table 3). Normally, the triterpenoids in Ganoderma are measured by the oleanolic acid method using chemical methods. However, due to sterols and fatty acids seriously interfering with the triterpenoid content, there is a serious deviation between the measured value and the actual value of the triterpenoids in the fruiting bodies, even up to 75%. According to the Chinese Pharmacopoeia regulations: Calculated on the dried basis, Ganoderma contains triterpenoids and sterols calculated as oleanolic acid (C 30 H 48Calculated by O3, it shall not be less than 0.50%. The determination method in the present invention minimizes the influence of sterols and fatty acids. On this basis, the triterpene content of this strain reaches 2.8%. Compared with the excellent market varieties widely used at present, it is concluded that the triterpene content of this strain is extremely high.

[0104] Triterpene content measured in Table 2

[0105]

[0106] Content of 8 triterpene compounds in Table 3

[0107]

[0108]

[0109] Example 4: Molecular marker of Ganoderma lucidum HMGIM-M150311

[0110] I. Whole-genome resequencing

[0111] Inoculate the Ganoderma lucidum HMGIM-M150311 strain on a plate medium (enriched comprehensive PDA), collect the mycelium and extract genomic DNA. After the genomic DNA is qualified for detection, fragment the DNA with ultrasonic waves, then purify the fragmented DNA, repair the ends, add A to the 3′ end, ligate the sequencing adapter, and then select the fragment size by agarose gel electrophoresis, and perform PCR amplification to form a sequencing library. The constructed library is first subjected to library quality inspection, and the library with qualified quality inspection is sequenced by Illumina with paired-end sequencing, and the read length of the sequencing sequence is 150bp, generating more than 5G of data.

[0112] II. Obtaining and screening of Indel variant sites

[0113] The raw sequencing sequences obtained by sequencing (Raw Reads) contain reads with adapters and low quality. To ensure the quality of information analysis, the Raw Reads are filtered to obtain Clean Reads for subsequent information analysis. The main steps of data filtering are as follows: (1) Remove reads with adapters; (2) Filter reads with an N content exceeding 10%; (3) Remove reads with more than 50% of bases with a quality value lower than 10. The obtained clean reads are mapped to the Ganoderma lucidum genome self-tested by our team using the BWA software, and the InDel variant detection is performed using the HaplotypeCaller (local haplotype assembly) algorithm of GATK to obtain a set of variant sites. Selecting the commercially available varieties Hunong No. 1, Hanzhi No. 2, Longzhi (used in the Zhejiang market), and Quanzhi (used in the Fujian market) as controls, there are variant sites with insertions of fragments longer than 20 bp in HMGIM-M150311, and the final set of Indel variant sites is obtained.

[0114] III. Design and verification of specific primer pairs

[0115] Select sites with high coverage and genotype quality value of the variant sites from the set of Indel variant sites for primer design. The primer information is as follows:

[0116] M311-8-F: TCCTGATCCCGTTTATTGCCC;

[0117] M311-8-R: GCTTCACCCGTCCTTTCGAT.

[0118] The PCR reaction system is: 2x Taq Master Mix, 15 μL; DNA template (50 ng / μL), 2 μL; forward primer (10 μmol / L), 1.5 μL; reverse primer (10 μmol / L), 1.5 μL; ddH2O, 10 μL. The PCR reaction conditions are: pre-denaturation at 95°C for 5 min; 95°C for 30 sec, 58°C for 30 sec, 72°C for 30 sec, for 35 cycles; extension at 72°C for 5 min, and the program ends with storage at 12°C. The PCR products are electrophoresed on a 1-1.5% agarose gel (5 v / cm) for 25 min, placed in a gel imaging system for photography, and the M311-8-F / R primers only show a single amplified band in M311 in HMGIM-M150311 ( Figure 4 ), and no bands appear in other market strains ( Figure 4 ).

[0119] The PCR products are sent to BGI for paired-end sequencing to obtain specific sequence information, and the specific sequence is shown in SEQ ID NO.1).

[0120] IV. Obtaining and Application of Molecular Markers

[0121] Specific molecular markers of Ganoderma lucidum HMGIM-M150311 were obtained by sequencing. These markers can be used for the rapid identification and detection of the high-triterpenoid Ganoderma lucidum strain HMGIM-M150311. Specifically, the Ganoderma lucidum strain was subjected to PCR amplification using M311-8-F / R. If a DNA fragment of 600-700bp can be produced, it indicates that the tested Ganoderma lucidum strain is HMGIM-M150311. The specific nucleotide fragment with a size of 600-700bp is the InDel molecular marker of the new Ganoderma lucidum strain HMGIM-M150311 of the present invention.

[0122] V. qRT-PCR Verification

[0123] According to the sequence information obtained by sequencing, specific primer pairs for quantitative detection of HMGIM-M150311 were designed using the online primer design website (https: / / primer3.ut.ee / ). The information is as follows:

[0124] M311-YF2: AGGCCGTGCCTCATGGTAG

[0125] M311-YR2: GAACGAACCGTTGTCTTGTCG

[0126] The primer pairs were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Using the qPCR SYBR Green MasterMix kit (Nanjing Novozymes Biotech Co., Ltd., product number: Q111), fluorescence quantitative PCR reactions were carried out. Using the genomic DNA of HMGIM-M150311, Hunong No. 1, Longzhi, Hanzhi, and Quanzhi as templates, PCR amplifications were performed using the primer pairs M311-YF2 and M311-YR2 respectively, with 3 technical replicates for each reaction. The reaction system had a total volume of 20μL: 10μL of qPCR SYBRGreen Master Mix, 1μL of PCR primer 1 (10μmol / L), 1μL of PCR primer 2 (10μmol / L), 1μL of template DNA, and ddH2O was added to 20μL. The reaction program was pre-denaturation at 95°C for 2min, 95°C for 15s, 58°C for 15s, 72°C for 20s, for 40 cycles. The reaction was carried out using a fluorescence quantitative PCR instrument (Applied Biosystems QuantStudio 6&7 Real Time PCR System, Thermo Fisher). The results are as Figure 5As shown, the melting curve results indicate that M311-YF2 / YR2 generates a characteristic peak through PCR reaction, and the peak patterns are similar among replicates, suggesting that M311-YF2 / YR2 can produce specific products. The amplification curve shows that M311-YF2 / YR2 only emits fluorescence signals in the presence of HMGIM-M150311 DNA, and no effective amplification occurs for other Ganoderma lucidum strains throughout the PCR cycle.

[0127] In summary, M311-8-F / R and M311-YF2 / YR2 can respectively achieve the specific detection of HMGIM-M150311 through agarose gel electrophoresis and fluorescence PCR.

[0128] SEQ ID NO.1

[0129] TCCTGATCCCGTTTATTGCCCTGCGAGGCCGTGCCTCATGGTAGGCATTAGATACATGTTG

[0130] TAGCTACGTGGAATGAATATGTGTCGGCTGTACAGAGGGACGTCTACCTTTCAAGTCATC

[0131] ATAGATATCTCCGCCGACAAGACAACGGTTCGTTCTAGCCCGAAGTGTTCCAACTCGCAT

[0132] AGCACGCTGCTAAAACCTTGATCAGCAAGGGATGACGCAGCCATAGATTTACTCTGCCT

[0133] TGTACTGTATGCGCGCATCTTCATCGATACCATGAATGGACGACAGTATATATTGTGAGCA

[0134] CAACAGAATTTATTACTTTGCCACGAGTATGAGTATGCGAACATTCTGAGCCGTTGGTTC

[0135] TCGGATCCGGAGTAAGAGCAGGACTAGTACTGCGAGCGCCTGATTTAAGGCGTCAATCT

[0136] CACCTTGCTCGTCGACCACGATGACTTGGACTGTGCCTGTGCTCAACCTGCTCTCCTTAT

[0137] CGTTGACCCCGGGACGTATAGACCCTCTGGAGACCTACTGTGTGCTCTTGTCTAGCCTGT

[0138] TGCACGTATGACCTGAAGGAATAGAATTCGGATTAAAACTATAGCTTTAACCGGAGTGGA

[0139] GGCTCGAAGTTTCACTGGCAGCTTCAGGCCCCGGGAGACGGTACATCGAAAGGACGGG

[0140] TGAAGC

Claims

1. Ganoderma lucidum HMGIM-M150311, with the preservation number of GDMCC No: 62404.

2. The artificial cultivation method of Ganoderma lucidum HMGIM-M150311 described in claim 1, characterized in that, Specifically: a. Mycelium culture: Inoculate the Ganoderma lucidum HMGIM-M150311 strain onto the production mother culture medium, and culture it at a constant temperature of 25 °C in the dark for 10 - 15 days until the mycelium covers the slant surface; inoculate the mother culture mycelium onto the production culture medium, and culture it at a constant temperature of 25 °C in the dark until the mycelium fills the medium; inoculate the production culture mycelium into the artificial domestication medium, culture it at 25 °C ± 1 °C with an air relative humidity of 60 - 70% in the dark for 20 - 30 days until the mycelium fills the medium and then enter the after-ripening management. Pay attention to ventilation during the mycelium growth process to keep the carbon dioxide concentration below 4000 ppm; b. Mycelium after-ripening culture: After the mycelium matures, continue to place it in a dark place at 25 °C for after-ripening treatment. After after-ripening culture, it can enter the fruiting body stimulation stage; c. Fruiting body management: Control the temperature between 26 °C - 28 °C, increase the ventilation volume, remove the lid of the mushroom bag, adjust the air relative humidity to more than 90%, provide 10 hours of light per day, and the mycelium knots and forms off-white primordia. At this time, keep the relative humidity and do not directly spray water on the primordia; d. Fruiting body growth: After the primordia grow to 0.5 cm, continue to control the temperature between 26 - 28 °C and the air relative humidity between 85 - 90%, provide 10 hours of light per day with a light intensity of 300 - 500 lx, and keep the carbon dioxide concentration in the air at 350 - 1500 ppm to keep the air moist; until the Ganoderma lucidum is completely mature and the spore spraying ends. During this period, spray water mist on the young Ganoderma lucidum 1 - 2 times a day until the size of the fruiting body is basically unchanged, indicating that the fruiting body has matured. At this time, it should be harvested. After harvesting, re-perform the fruiting body treatment until the second flush of mushrooms is harvested; The production mother culture medium described is: by mass fraction, including 20% potato + 2% glucose + 1% peptone + 2% agar + 0.3% potassium dihydrogen phosphate + 0.15% magnesium sulfate + trace vitamin B1; The production culture medium described is: by mass fraction, including 98 - 99% sorghum + 1 - 2% calcium carbonate; The artificial domestication medium described is: by mass fraction, including 38% cottonseed hull + 50% sawdust + 10% bran + 2% CaCO3, with a moisture content of 60% - 65% and a natural pH.

3. The molecular marker of Ganoderma lucidum HMGIM-M150311 according to claim 1, characterized in that The nucleotide sequence of the molecular marker of Ganoderma lucidum HMGIM-M150311 is as shown in SEQ ID NO.

1.

4. Application of the reagent for detecting the molecular marker of Ganoderma lucidum HMGIM-M150311 described in claim 3 in identifying Ganoderma lucidum HMGIM-M150311 described in claim 1.

Images