Gene for regulating growth and development of tomato, knockout method and application thereof

By knocking out the PHO2 gene in tomatoes using CRISPR/Cas9 technology, the growth cycle was extended while maintaining the ability to flower and bear fruit, thus solving the problem of short tomato growth cycles and increasing tomato yield and economic value.

CN115851763BActive Publication Date: 2026-04-28NANJING UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NANJING UNIV
Filing Date
2022-11-23
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

In existing technologies, the short growth cycle of tomatoes leads to the need to waste land and apply more fertilizer to increase yield, which affects land resources and the ecological environment.

Method used

A PHO2 gene knockout vector was constructed using CRISPR/Cas9 technology, and a specific gRNA was designed to target the tomato PHO2 gene, extending its growth cycle and maintaining its continuous flowering and fruiting ability.

Benefits of technology

It extends the tomato growth cycle, increases fruit yield, and maintains the ability to continuously flower and bear fruit, thereby enhancing the economic value of tomatoes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115851763B_ABST
    Figure CN115851763B_ABST
Patent Text Reader

Abstract

The application discloses a gene for regulating growth and development of tomatoes, a knocking-out method and application, and the nucleotide sequence of the gene is shown in SEQ ID NO.2. The knocking-out vector is constructed by designing CRISPR / Cas9 guide RNA for the PHO2 gene in the tomatoes and utilizing a pCC carrier. The knocking-out plant of the PHO2 gene is obtained by using tissue culture and agrobacterium infection, and the PHO2 gene is identified to be knocked out by Sanger gene sequencing. The growth cycle of the tomatoes can be prolonged and the continuous flowering and fruiting capacity can be maintained by knocking out the gene of SEQ ID NO.2.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a gene that regulates the growth and development of tomatoes, a method for knocking it out, and its application, belonging to the field of genetics. Background Technology

[0002] Tomato (Solanum lycopersicum) is the world's most widely cultivated and consumed vegetable crop. Originally from South America, it is loved for its good taste, rich vitamin content, and versatility in consumption, including raw consumption, stir-frying, and tomato sauce production. It is widely grown in both northern and southern China. The tomato growing cycle typically lasts 3 to 5 months. The entire plant is covered in sticky glandular hairs, has a strong odor, and the stems are prone to lodging. The leaves are pinnately compound or deeply pinnately lobed. It usually bears 3-7 flowers, with radiate calyxes and corollas. The berry is oblate or nearly spherical, fleshy and juicy, with yellow seeds. Tomatoes occupy an important position in global vegetable production and consumption, and increasing tomato yield can bring significant economic value. However, to increase yield, farmers often waste excessive land and apply more fertilizer, which has a significant negative impact on land resources and the ecological environment. Therefore, how to more efficiently increase tomato yield has become an urgent problem to be solved.

[0003] The PHO2 gene, found in Arabidopsis thaliana, is involved in the regulation of phosphorus nutrient uptake. It inhibits the expression of the phosphorus transporter PT1 in Arabidopsis, thereby suppressing phosphorus absorption. Knocking out the PHO2 gene in Arabidopsis increases its ability to absorb phosphorus, thus affecting plant growth and development. Previous studies have also found that mutations in the PHO2 gene not only promote stomatal development in plant leaves but also increase plant resistance to pathogens. The PHO2 gene is widely present in angiosperms, including not only Arabidopsis thaliana but also maize, rice, and citrus.

[0004] This study utilized a CRISPR / Cas9-based vector constructed in our laboratory to create a PHO2 gene knockout vector in tomato, generating PHO2 gene mutant tomato plants. We found that the growth cycle of these PHO2 gene knockout tomato plants was extended from 4-5 months in the wild type to over 14 months. During this process, the plants continuously produced new branches and exhibited a multi-round flowering and fruiting phenotype. This indicates that knocking out the tomato PHO2 gene prolongs the tomato's growth cycle, thereby increasing fruit yield. Summary of the Invention

[0005] Purpose of the invention: In order to overcome the shortcomings of the existing technology, the present invention provides a gene for regulating tomato growth and development, a knockout method, and its application for extending the tomato growth cycle and maintaining continuous flowering and fruiting ability.

[0006] Technical solution: To achieve the above objectives, the technical solution adopted by this invention is as follows:

[0007] A gene that regulates the growth and development of tomatoes, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0008] The protein encoded by a gene that regulates the growth and development of tomatoes has the amino acid sequence shown in SEQ ID NO.1.

[0009] A recombinant expression vector containing genes that regulate tomato growth and development.

[0010] A transformant comprising a host cell containing a recombinant expression vector.

[0011] Preferred: Its host is a microorganism, plant or transgenic cell line.

[0012] A method for knocking out genes that regulate tomato growth and development includes the following steps:

[0013] Step 1: Design gRNA for the CDS region of the tomato PHO2 gene. Select gRNAs located within 500 bp downstream of the start codon, with high on-target scores and low off-target rates, and synthesize their forward and reverse single-stranded DNA sequences.

[0014] Step 2, synthesize spacer: Perform PCR on the two synthesized single strands to obtain the double-stranded product spacer.

[0015] Step 3: Ligate the spacer to the AtU6-26V4 vector: The AtU6-26V4 plasmid was digested with Bbs1-HF restriction enzyme, and the spacer was ligated to the digested AtU6-26V4 plasmid using T4 ligase. The ligation product was transformed into competent E. coli DH5α cells, and single clones were screened in ampicillin-resistant medium for culture. After plasmid extraction, Sanger sequencing was performed using the 'intermediate vector detection-F' primer. The plasmid that was successfully ligated to the AtU6-26V4 vector after sequencing verification was identified as the intermediate vector. The intermediate vector was used as a PCR substrate, and primers 'SOSO-F' and 'SOSO-R' with homologous arms were designed to amplify the gRNA scaffold_spacer region by PCR.

[0016] Step 4: Ligate the gRNA scaffold_spacer sequence with the pCC vector: Digest the pCC plasmid with EcoR1 restriction enzyme, and ligate the gRNA scaffold_spacer sequence with the PCC vector using the In-Fusion HD Cloning Kit. Transform the ligation product into competent E. coli DH5α cells, and select single clones in spectinomycin hydrochloride resistant medium for culture. After plasmid extraction, perform Sanger sequencing using the 'final vector detection-F' primer. The plasmid that has been successfully ligated with the pCC vector and verified by sequencing is the final CRISPR / Cas9 vector.

[0017] Preferred: One of the two single-stranded DNA sequences in step 2 is as follows: gRNA1-F: CACCGGGGTCTTCGACTAAATCAG, gRNA1-R: AAACCTGATTTAGTCGAAGACCCC.

[0018] The other single-stranded DNA sequence in step 2 is as follows: gRNA2-F: GATTGTTGGGGATTATGTAGTGAT, and gRNA2-R: AAACATCACTACATAATCCCCAAC.

[0019] Preferred: The intermediate vector detection-F primer in step 3 is as follows: GAGCTCGGATCCACTAGTAA.

[0020] The SOSO-F primers are as follows: TATGACATGATTACGAATTCGAGCTCGGATCCACTAGTAA.

[0021] The SOSO-R primers are as follows: CTAATCTGGGGACCGAATTCGTGTGATGGATATCTGCAGA.

[0022] Preferred primers for the final vector detection in step 4 are as follows: ATGCTTCCGGCTCGTATGTT.

[0023] The application of a gene that regulates tomato growth and development to regulate the tomato growth cycle.

[0024] Compared with the prior art, the present invention has the following advantages:

[0025] This invention, using the tomato variety "microTom" as the research object, constructed a tomato PHO2 gene knockout vector based on CRISPR / Cas9 technology. Through phenotypic identification of two mutant lines, it was found that the knockout of this gene leads to enhanced meristematic ability in tomatoes, prolongs the tomato growth cycle, and maintains continuous flowering and fruiting ability. The CDS sequence of this gene is shown in SEQ ID NO.1. This invention can provide great help in promoting tomato growth and development and increasing fruit yield. Attached Figure Description

[0026] Appendix Figure 1 Construction process of tomato PHO2 gene knockout vector based on CRISPR / Cas9 technology.

[0027] Appendix Figure 2 CRISPR intermediate vector AtU6-26V4.

[0028] Appendix Figure 3 pCC vector spectrum.

[0029] Appendix Figure 4 Tomato PHO2 mutant plants retained the flowering and fruiting phenotype even after 14 months of growth. Figure 4 Image a: Wild-type tomatoes enter the late growth stage at 5 months; Figure 4 Figure b: The pho2 gene mutant tomato still showed vigorous growth and maintained its ability to flower and bear fruit after 14 months. Detailed Implementation

[0030] The present invention will be further illustrated below with reference to the accompanying drawings and specific embodiments. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention. After reading this invention, any modifications of the invention in various equivalent forms by those skilled in the art will fall within the scope defined by the appended claims.

[0031] Example 1: Construction of PHO2 gene knockout vector based on CRISPR / Cas9 technology

[0032] gRNA (guide RNA) was designed targeting the CDS region of the tomato PHO2 gene using the Benchling online service tool (https: / / www.benchling.com / crispr). gRNAs located within 500 bp downstream of the start codon, with high on-target scores and low off-target rates were selected, and their forward and reverse single-stranded DNA sequences were synthesized (see Appendix Table 1).

[0033] Table 1 Primers required for CRISPR / Cas9 vector construction

[0034]

[0035] The PHO2 gene knockout vector was constructed using CRISPR / Cas9 technology according to the following steps (e.g.) Figure 1 As shown):

[0036] 1) Synthesize the spacer: Combine the two synthesized single strands (e.g., gRNA1-F and gRNA1-R, primer sequences are shown in the table)

[0037] 1) Take 12.5 μl of each and mix them. Place them in a PCR instrument and heat at 95 °C for 3 min and anneal at 16 °C for 5 min to obtain the double-stranded product spacer;

[0038] 2) Ligation of the spacer with the AtU6-26V4 vector: The AtU6-26V4 plasmid was digested with Bbs1-HF restriction enzyme, and the spacer was ligated with T4 ligase. The ligation product was transformed into competent E. coli DH5α cells, and single clones were screened in ampicillin-resistant medium for culture. After plasmid extraction, Sanger sequencing was performed using 'intermediate vector detection-F' primers (Appendix 1). Sequencing confirmed the ligation of the spacer with the AtU6-26V4 vector (e.g., ...). Figure 2 The plasmid successfully ligated (as shown) is the intermediate vector. Using the intermediate vector as a PCR substrate, primers with homologous arms ('SOSO-F' and 'SOSO-R', primer sequences are shown in Appendix 1) were designed to amplify the gRNA scaffold_spacer region by PCR.

[0039] 3) Ligation of the gRNA scaffold_spacer sequence with the pCC vector (which already contains the Cas9 expression element PCHF1 vector): The pCC plasmid was digested with EcoR1 restriction enzyme, and the gRNA scaffold_spacer sequence was recombinantly ligated with the PCC vector using the In-Fusion HD Cloning Kit. The ligation product was transformed into competent E. coli DH5α cells, and single clones were screened in spectinomycin hydrochloride resistant medium for culture. After plasmid extraction, Sanger sequencing was performed using the 'final vector detection-F' primers (Appendix 1). The plasmid that has been successfully ligated with the pCC vector and verified by sequencing is the final CRISPR / Cas9 vector (e.g., ...). Figure 3 (As shown).

[0040] 4) Transform the final vector into Agrobacterium: The constructed CRISPR / Cas9-based tomato PHO2 gene knockout vector was transformed into Agrobacterium competent cells GV3101. Positive strains were screened using media containing spectinomycin hydrochloride and rifampin resistance. After PCR amplification and gel electrophoresis, Agrobacterium strains with a single band were selected for subsequent infection experiments.

[0041] The protein encoded by a gene that regulates the growth and development of tomatoes has the amino acid sequence shown in SEQ ID NO.1.

[0042] SEQ ID NO.1 (PHO2 gene CDS sequence, 2778 bp in length):

[0043] ATGGATACATCTCTAAGTGACTTCGATAGTTTCAGCGAGAGCAGCAGTTATGATGATCAGGATTATGTTGAATATCTGTATGGTGGGCATGCATGTTCTATTCTTTCAAGTCTTGAGGAAAGCATCGGTAAGATCGATGATTTCCTCTCTTTCGAGAGGGTGTTCATGTATGGAGACATAGTATGTTCCGAAAAAGAACCATCTGGACAGATGGGAAAAGTGGTCAACGTCGAGATGACTGTTGACCTGGAATGTATTTATGGAAGCAAAATACAAGATGTTAACTCAAAAGATCTTGTAAAAATACGTCCAATTTCTGTTGGGGATTATGTAGTGATGGGCCCATGGCTAGGGAAAGTTGAAAAGATTGTCGATAAAATTAAAGTTCTCTTTGATGATGGTGCAAAGTCTGAATTTTCAGCAGAAGCTTCAGAAATACTCACACCCATTTCCCCTGATTTAGTCGAAGACCCCCA ATTTCCTTTCTATCCGGGTCAAAGGGTGCAAGTTCAGTCTGTATCTGCCTCCGGGTCAACCAGTTGGTTATGTGGTGTAAGAAGTGGCAAAAGAGAGCAAGGTACCATTTATGCTGTGGAGGCTGGAGTGGTGCATGTAGATTGGATTGGCTGTGGCAGTCTAGGTTGTGAAAAGATGCCTAGTCCTCCAACTTTGCAGGACTCAGAAAAGTTGACCTTGTTGTCTTGCTACTCCCAT GCAAAGTGGCAGCTTGGAGATTGCTGTGTACTTCCTGTTGCTGACTCTAAGAACATTGTGCGAAAGAGTATTCAAAGCTCACCTCCCTGTGGACCAATGGAACAGGATAGGCAACTAAACAAGGCATCTCAGAAAACTAATAGGAGCTCAACTTTTTTTGCAAGTTGCTGTAATTTCAAAGACAAGGACAAAAGTTGATATTTTATGGCAGGATGGAAGCGTGACTACTGGATTGGACT

[0044] CAGATTCTGTTTTCCCTGTCAATATTGTGGATGCTCATGAGTTTTGGCCTGAGCATTTCGT

[0045] GCTTGAGAAGGGAATGGGTGATGACTCATCTGTTCCCAGTCCAAAACGCTGGGGGTGTGG

[0046] TGAGATGCGTTGACGCAAAGGAGCGAACAGTGAAGGTAAAATGGACAACTTATTCCTT

[0047] GCATGAACCAAACAACTTCAGGGTTGAGCAAAGTGAAGAAAATAGTGAGTGCGTATGAA

[0048] CTGATGGACCATCCAGACTACTCATACTGTTTAGGTGATGCGGTTTGCAAGTTTTGTGAG

[0049] GATCAGGGTTTTCAGTCTTGAGGGGAAGAGCTTAAGTACGCACATGTTCTCTGAGACTGG

[0050] CATGGACAGCAACACTGATCTCAAGAATGTTGATACTGGAAAGGATAATTTGGATTTCCC

[0051] CAAATATGACCATTTATCTTGTATCGGTATTATTGTTGGCTTCAAAGATGGCGATATTGAAA

[0052] TAAAATGGGCTACTGGTTTTACAAGCATGGTTGCACCCCTTTGAAATCTACCGGATAGATA

[0053] ATGTGAAGCTGCTGTTTCCATTAGTGCATCCAATGCTGAAAATGCTGAGCCATCAAACG

[0054] TGGAGATGAGTTCAAATGAAAGTCAGCTCTCAAAGCATGAGGAAAAGGGCTTGCTGAA

[0055] GTTTGGTAGCAATAGTGAAAGTTGCAATGAGAGCTTGTGGACTCTGGTTCCTGTTTGAT

[0056] TTCTCGAACTGCTGTTGGCTTTTTCTCTAGTATCACCTCAACTCTTTTTGGCTCATTGAGC

[0057] ATATCACTTTTTGGTACATACCAAACTATATCAGAAGAAGGCCAGAAATCAAGGATTGTC

[0058] GATGAGGAGGAAGTCATAGAGCTTAGCCATCTGAATGCAGGAATTCCCACATTTGAGAA

[0059] CTTGAAGGCTTCGCCTGAAATGGAACTAGAGCAAGTACAGGAAACAACTGAGGGCCAA

[0060] AAAGATGATGCTTTGCCATCTTCCAGCAATCTGCCTGAACATTTTAAACAGTTTGATGTG

[0061] GTCACTGATTTCTCAGACCACCATTTTGCAGATGGTGCTGGAAAGGCCCAGCTATCCCA

[0062] GGTGAGAAGAGGTTGGCTGAAGAAGGTCCAGCAAGAGTGGAGCATTTTGGAACGTGAT

[0063] CTTCCTGAGACTATCTATGTACGCATCTATGAGGAAAGAACTGATTTGATCCGAGCTGCC

[0064] ATTATTGGTGCACCTGCGACTCCGTATCATGATGGAATCTTCTTCTTTGATATTTACCTACC

[0065] TCCGGACTATCCTCATGAGCCACCTATGGTCTACTATCACTCTGGCGGGCTTCGTGTCAAT

[0066] CCTAACCTGTATGAGTCAGGAAAGGTTTGCCTCAGCCTCTTAAACACATGGACGGGCTC

[0067] TGGAAATGAAGTGTGGAACCCCAAAAGTTCCACGATTCTACAAGTTCTCCTCTCTCTTC

[0068] AAGCCTCTTGTGCTCAATGAAAAGCCTTATTTCAATGAGGCTGGATATGATGCGCAGATTG

[0069] GTAAAGCTGACGGTGAAAAGAACTCCGTCAGCTATAATGAAATGCTTTCCTTGTTACCT

[0070] GGAAGTCCATGTTATACCTGCTCCACAAGCCACCCAAGCATTTTGATGCACTTGTGCAAG

[0071] AGCACTTTGGTAACCGATGGAAAAACATTTTGTTAGCTTGTAAGGCGTACATGGATGGC

[0072] GCACCAGTTGGTTCAGCATTCCAACCCAAGAACCAGGACAAAGAACCAATAAAAGGAA

[0073] GCTCTACTGGATTCAAAATTATGCTTGGCAAGCTTTACCCTAAACTCGTGGAGGCATTTT

[0074] CCAACAAAGGTATCGATTGCAGTCAGTTGTCCGATTAA

[0075] A gene that regulates the growth and development of tomatoes, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0076] SEQ ID NO.2 (PHO2 gene sequence, 5064 bp in length):

[0077] ATGGATACATCTCTAAGTGACTTCGATAGTTTCAGCGAGAGCAGCAGTTATGATGATCAG

[0078] GATTATGTTGAATATCTGTATGGTGGGCATGCATGTTCTATTCTTTCAAGTCTTGAGGAAA

[0079] GCATCGGTAAGATCGATGATTTCCTCTCTTTCGAGAGGGTGTTCATGTATGGAGACATAG

[0080] TATGTTCCGAAAAAGAACCATCTGGACAGATGGGAAAAGTGGTCAACGTCGAGATGAC

[0081] TGTTGACCTGGAATGTATTTATGGAAGCAAAATACAAGATGTTAACTCAAAAGATCTTGT

[0082] AAAAATACGTCCAATTTCTGTTGGGGATTATGTAGTGATGGGCCCATGGCTAGGGAAAGT

[0083] TGAAAAGATTGTCGATAAAATTAAAGTTCTCTTTGATGATGGTGCAAAGTCTGAATTTTC

[0084] AGCAGAAGCTTCAGAAATACTCACACCCATTTCCCCTGATTTAGTCGAAGACCCCCAATT

[0085] TCCTTCTATCCGGGTCAAAGGGTGCAAGTTCAGTCTGTATCTGCCTCCGGGTCAACCAG

[0086] TTGGTTATTGTGGTGTAAGAAGTGGCAAAAGAGAGCAAGGTACCATTTATGCTGTGGAGG

[0087] CTGGAGGTGGTGCATGTAGATTGGATTGGCTGTGGCAGTCTAGGTTGTGAAGATGCCT

[0088] AGTCCTCCAACTTTGCAGGACTCAGAAAAGTTGACCTTGTTGTCTTGCTACTCCCATGC

[0089] AAAGTGGCAGCTTGGAGATTGCTGTGTACTTCCTGTTGCTGACTCTAAGAACATTGTGC

[0090] GAAAGAGTATTCAAAGCTCACCTCCCTGTGGACCAATGGAACAGGATAGGCAACTAAAC

[0091] AAGGCATCTCAGAAAACTAATAGGAGCTCAACTTTTTTGCAAGTTGCTGTAATTTCAAA

[0092] GACAAGGACAAGGTTGATATTTTATGGCAGGATGGAAGCGTGACTACTGGATTGGACT

[0093] CAGATTCTGTTTTCCCTGTCAATATTGTGGATGCTCATGAGTTTTGGCCTGAGCATTTCGT

[0094] GCTTGAGAAGGGAATGGGTGATGACTCATCTGTTCCCAGTCCAAAACGCTGGGGGTGTGG

[0095] TGAGATGCGTTGACGCAAAGGAGCGAACAGTGAAGGTAAAATGGACAACTTATTCCTT

[0096] GCATGAACCAAACAACTTCAGGGTTGAGCAAAGTGAAGAAAATAGTGAGTGCGTATGAA

[0097] CTGATGGACCATCCAGACTACTCATACTGTTTAGGTGATGCGGTTTGCAAGTTTTGTGAG

[0098] GATCAGGGTTTTCAGTCTTGAGGGGAAGAGCTTAAGTACGCACATGTTCTCTGAGACTGG

[0099] CATGGACAGCAACACTGATCTCAAGAATGTTGATACTGGAAAGGATAATTTGGATTTCCC

[0100] CAAATATGACCATTTATCTTGTATCGGTATTATTGTTGGCTTCAAAGATGGCGATATTGAAA

[0101] TAAAATGGGCTACTGGTTTTACAAGCATGGTAAGAGACTCTTCTTTCTGTTCTTTTATTTT

[0102] TCAGGGGTTAAATCCCATCTATTTTTCTGTCACTTTGTTTCCCAAAGCTGAAAATGAGCA

[0103] TGACATTTAACCTGTTTGGGAATTCAAAAGGTTACTTGCTGTTAATTGACATTAGCACTC

[0104] ATGCTTTCCTACAATCATTTCATTATTGTTCTTTTTACATATTTTTTAAATTCGACATATTT

[0105] TGGCTTAAATTTGATAAGAGGAAAGAGCTTGACATTTTGTAACAGAAGGTTTTATTTTTT

[0106] AAGGAGTATTGTTCACATGGTAAATGTTGAAAGTAACAAATAACGTATCAAGGGCTAAAT

[0107] ATTTTGAGAAACTTCTTTTCAAATCTTCTGTTTATGCCTTGAGCTGGCTCAACTCTTGTCTT

[0108] TATTCATATATGCTCATCAGGTTGCACCCTTTGAAATCTACCGGATAGATAAATGTGAAGC

[0109] TGCTGTTTCCATTAGTGCATCCAATGCTGAAAATGCTGAGCCATCAAACGTGGAGATGAG

[0110] TTCAAATGAAAGTCAGCTTCCAAAGCATGAGGAAAAGGTAAGTCTAATTGCCTCCTTGT

[0111] GTGTTGTGCCTTCACTGTGATTGCAAGATCATTTGCATCCACACTAAAAAGCAGCTTAT

[0112] ATTGCATAGATTTTCACTAGATATTAGGTATCCTTATTTTACAATCTTCAACTTCTCGTCTG

[0113] AAAGTTTGACAGAGTTCATTTTCTTTTATATTCAGGGCTTGCTGAAGTTTGGTAGCAATA

[0114] GTGAAAGTTGCAATGAGAGCTTGTGGGACTCTGGTTCCTGTTTGATTTCTCGAACTGCT

[0115] GTTGGCTTTTTCTCTAGTATCACCTCAACTCTTTTTGGCTCATTGAGCATATCACTTTTTG

[0116] GTACATACCAAACTATATCAGAAGAAGGCCAGAAATCAAGGATTGTCGATGAGGAGGAA

[0117] GTCATAGAGCTTAGCCATCTGAATGCAGGAATTCCCACATTTGAGAACTTGAAGGCTTCG

[0118] CCTGAAATGGAACTAGAGCAAGTACAGGAAACAACTGAGGGCCAAAAAGATGATGCTT

[0119] TGCCATCTTCCAGCAATCTGCCTGAACATTTTAAACAGTTTGATGTGGTCACTGATTTCTC

[0120] AGACCACCATTTTGCAGATGGTGCTGGAAAGGCCCAGCTATCCCAGGTTCAAAATACTT

[0121] TCTGTTTTTCCCAGATGAACATGACTTCTCAGTGTTCTTTTTTACTACTCCCTTTTCTGTT

[0122] CTTTAATCTCTCTGTTATTTCGCAGGTGAGAAGAGGTTGGCTGAAGAAGGTCCAGCAAG

[0123] AGTGGAGCATTTTGGAACGTGATCTTCCTGGTGAGAATTTCAACCTATTTTTCTGTTCAA

[0124] GTATGTCTAATGATGTGATATTTACATTCTGCTATAGTTTTCTATATCTACCAATGTTTTTGG

[0125] CAAGTATAAGTCATACTTGTTAATCTAAAAGATGGTGGATGGAATAGAATGTCATAAC

[0126] ATTGGGAATGGTGAAGCTACTCAGATGTATGAAAACAAGGGAAAATTTTGAAAAGCTAT

[0127] AACCCTGTCGTTCAATGAGAATTTGCAAGATGTGCCACTAGAATTTTAATACCTTAAATAT

[0128] TGTTCTTCAGTAGATTATGGAATATGATAAATATCAGTTGTTCTGGATTTCATGTACTGAA

[0129] GGCAAATGGTAATTCCTTTGGTTGGGCAGTCCACAAGTTTTATGTTTTATCTGTGCATCAG

[0130] AGCAAAATGATTGATCTTTTATTCAAAATTCATTTTGTGGGTTATTCCATCAGATCTTTGC

[0131] AAGAAGAATAGCCAACAATTAGTTTTTCATTTGATGTTTCTGATATTATGTGCCAATTGTT

[0132] TAGTTTTTGCTGTTTGTAACGGCCCTTCTGCAACATATCAATTTCTTAAGAAAGCTCCCTT

[0133] CTCCTTCTCAAAAACGAAAGTTCCCTTCTCCTTAATTCAATGTTGGTTGATAGCTGTTAA

[0134] AAGTTAATGACTTTCACCCTGGAAGGGAGAGAGTTCCGAGTGATGATAAGTGGTATGAA

[0135] CAATTGAACATCAACCAACTGAAAAATTCCAACTTTTTGGAAAAACCAAACACATTATT

[0136] GCTCAATTAGGAAAACATTTGGGGGAGGGGCTGAGATATAGACCCTAAATATACCTCAAC

[0137] TCGACTCTGCTAAAAAAAATTCTTTTTTGGGATAAAGCTGCATAATATCTACTTGTATCAA

[0138] CAAGAAACCACTTTATCATTGAATATATGGTTACATTGCATTTCTTTGGCTATTTATCCCCA

[0139] CTGATTTTATCAAACTTAAAACAGAGACTATCTATGTACGCATCTATGAGGAAAGAACTG

[0140] ATTTGATCCGAGCTGCCATTATTGGTGCACCTGCGACTCCGTATCATGATGGAATCTTCTT

[0141] CTTTGATATTTACCTACCTCCGGACTATCCTCATGAGCCACCTGTAAGTAAATCTATAGCT

[0142] TGTGGTGTTCATCTCTAACATGATGCACAAGTAGTTGCCTGTTTCCACAATTTTCTGATTG

[0143] ATAGACATGAGCCTTGCCTTCATTTGGAATCTGAATTCATATCATATGTTTTTATTAGATCT

[0144] TAAACATTCTTCGGCATCCAATTATCTAACACTGCCAATTGTGAAGTCCATCTGTTTTTCT

[0145] GATTTATAAGATCAAGCATACACTTTCCAGATAAAGCTTATATAGATTTTGCAAAAATGAA

[0146] ATTTGCAGATGGTCTACTATCACTCTGGCGGGCTTCGTGTCAATCCTAACCTGTATGAG

[0147] TCAGGAAAGGTTTGCCTCAGCCTCTTAAACACATGGACGGGCTCTGGAAATGAAGTGTG

[0148] GAACCCCAAAAGTTCCACGATTCTACAAGTTCTCCTCTCTCTTCAAGCTCTTGTGCTCAA

[0149] TGAAAAGCCTTATTTCAATGAGGCTGGATATGATGCGCAGATTGGTAAAGCTGACGGTG

[0150] AAAAGAACTCCGTCAGCTATAATGAAAATGCTTTCCTTGTTACCTGGAAGTCCATGTTAT

[0151] ACCTGCTCCACAAGCCACCCAAGGTAAATGATTTAAATTTGAAGTTTTCAAAAAAAAAT

[0152] GTCATGTCATGTTTAGATTTCAGATAAAAGATGTAGAGAAGAGACTAAGAACTGAATTT

[0153] GGATTCTGACAACATAAAATTCCAAGAGTTGTTTTCTCATATGTTCACTCTATTAGTACTT

[0154] ATTATCTCAGGAAGTCACTTTCTTTGTTGAAGAAACAAGAAGAAAAATGACTTTCTAATC

[0155] TAATAACTAATAGTTGTTTGACCATATGAGAAATCAACCCAAAGTTATAATTACCACCAAG

[0156] AATTTTTTATACTCCAATAATAGAAGCACTTTCCTTTTACTCTGAAAGTTTCTGAATTGCT

[0157] TGGTCAATTATTCTGCAGCATTTTGATGCACTTGTGCAAGAGCACTTTGGTAACCGATGG

[0158] AAAAACATTTTGTTAGCTTGTAAGGCGTACATGGATGGCGCACCAGTTGGTTCAGCATTC

[0159] CAACCCAAGAACCAGGACAAAGAACCAATAAAAGGAAGCTCTACTGGATTCAAAATTA

[0160] TGCTTGGCAAGCTTTACCCTAAACTCGTGGAGGCATTTTCCAACAAAGGTATCGATTGCA

[0161] GTCAGTTGTCCGATTAA

[0162] Example 2: Construction of pho2 gene mutant tomato plants

[0163] 1) Seed germination

[0164] In a clean bench, wild-type tomato ('MicroTom' variety) seeds were sterilized by repeatedly shaking them in a 10% sodium hypochlorite solution for 8 minutes; then rinsed three times with sterile water, shaking for 5 minutes each time; the seeds were then evenly placed in sterile culture bottles containing germination medium for germination. The culture bottles were placed on a light-controlled culture rack, with 16 hours of light and 8 hours of darkness. Cotyledons will emerge in 8–12 days.

[0165] 2) Cotyledon pre-culture

[0166] Once the tomato cotyledons have fully emerged but the true leaves have not yet appeared, gently place the cotyledons (with the tips and tails of the leaves removed) onto the pre-culture medium in a clean bench using tweezers, ensuring the cotyledons are facing upwards and that the cut surfaces are in contact with the culture medium as much as possible. Culture the cotyledons on a light-treated medium for 2–3 days.

[0167] 3) Agrobacterium infection of pre-cultured cotyledons

[0168] In a clean bench, 200 μl of Agrobacterium tumefaciens culture containing a CRISPR / Cas9-based tomato PHO2 gene knockout vector was aspirated into 20 ml of LB medium containing spectinomycin hydrochloride and rifampin resistance, and cultured at 28°C and 200 rpm in a shaker. When the OD value reached 0.4–0.6, the culture was centrifuged at 5000 rpm for 10 min, the supernatant was discarded, an equal volume of infection solution was added, and the culture was resuspended.

[0169] Place the pre-cultured cotyledons into the resuspended bacterial solution, wrap them in aluminum foil to protect them from light, and gently shake them manually for 10 minutes to ensure the cotyledons are fully incorporated into the bacterial solution. After shaking, transfer the cotyledons to sterile filter paper, blot off the liquid on the surface of the cotyledons, and finally place them face up in the induction medium and co-culture in the dark for 1 day.

[0170] 4) Tomato selection and differentiation

[0171] After co-culturing in the dark for 1 day, the cotyledons were transferred to the selection medium. The medium was changed every 15–20 days. The explants that had grown leaves were then transferred to culture bottles containing the selection medium for further culture.

[0172] 5) Identification of mutant types and overexpressing plants

[0173] For mutant type detection, a leaf measuring approximately 0.4cm × 0.4cm was first cut from the explant and then... DNA was extracted using the Plant Tissue PCR Kit, and the extracted DNA was used as a template to amplify approximately 300 bp upstream and downstream of the gRNA target sequence using specific primers (see Appendix 1). The amplified products were then subjected to Sanger sequencing. The sequencing files were parsed using the DSDecode online analysis website (http: / / skl.scau.edu.cn / dsdecode / ). When comparing with the reference genome, if the target gene contained non-3-fold insertions or deletions, or if a base mutation / insertion / deletion introduced a codon that prematurely terminated translation, the explant was retained for subsequent culture.

[0174] 6) Positive seedlings continue to be cultured.

[0175] Explants with 3 to 4 leaves were transferred to culture bottles containing stem-growing medium. When a relatively distinct stem emerged, the tomato seedlings with clearly developed leaves and stems were cut off using sterile scissors and transferred to rooting medium to induce rooting. Once the tomato plants had grown 2 to 3 roots, they were transferred to nutrient soil for propagation. For mutant plants, once the tomato plants were robust, DNA was extracted again to test for the mutant type, ensuring that the obtained plants were positive mutants.

[0176] 7) Phenotypic observation of knockout plants

[0177] The selected homozygous lines were germinated aseptically using the germination method described above. After germination, they were placed in planting pots for cultivation, and the phenotype of the plants was observed and recorded regularly, and compared with wild-type tomato plants (e.g., Figure 4 (As shown). The pho2 gene mutant tomato still showed vigorous growth and maintained its ability to flower and bear fruit after 14 months.

[0178] This invention relates to the application of the PHO2 gene in the tomato growth cycle and its ability to maintain continuous flowering and fruiting. The invention designs a CRISPR / Cas9 guideRNA for the PHO2 gene in tomato and constructs a knockout vector using the pCC vector. PHO2 gene knockout plants are obtained through tissue culture and Agrobacterium infection. The knockout of the PHO2 gene is confirmed by Sanger sequencing. Through continuous observation and recording of the phenotype of the PHO2 gene knockout plants over 14 months, it is confirmed that PHO2 gene knockout can prolong the tomato growth cycle and maintain continuous flowering and fruiting ability. This long-term flowering and fruiting phenotype of gene knockout plants is the first report of its kind in tomato.

[0179] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for knocking out genes that regulate tomato growth and development, characterized in that, The nucleotide sequence of the gene regulating tomato growth and development is shown in SEQ ID NO.

2. Knocking out this gene leads to enhanced meristematic ability, prolonged growth cycle, and sustained flowering and fruiting capacity in tomatoes. A tomato PHO2 gene knockout vector was constructed using CRISPR / Cas9 technology to produce... pho2 Mutant tomato plants were found in pho2 Gene knockout tomato plants exhibited a growth cycle extended from 4 to 5 months in the wild type to over 14 months. During this process, the plants continuously produced new branches and displayed a phenotype of multiple flowering and fruiting cycles, including the following steps: Step 1: Design gRNA for the CDS region of the tomato PHO2 gene. Select gRNAs located within 500 bp downstream of the start codon, with high on-target scores and low off-target rates, and synthesize their forward and reverse single-stranded DNA sequences. Step 2, synthesize the spacer: Perform PCR on the two synthesized single strands to obtain the double-stranded product spacer; One of the two single-stranded DNA sequences, gRNA1-F, is as follows: CACCGGGGTCTTCGACTAAATCAG, and gRNA1-R is as follows: AAACCTGATTTAGTCGAAGACCCC; The other single-stranded DNA sequence of the two is as follows: gRNA2-F: GATTGTTGGGGATTATGTAGTGAT, and gRNA2-R: AAACATCACTACATAATCCCCAAC; Step 3: Ligate the spacer to the AtU6-26V4 vector: Digest the AtU6-26V4 plasmid with Bbs1-HF restriction enzyme, and ligate the spacer to the digested AtU6-26V4 plasmid with T4 ligase; transform the ligation product into competent E. coli DH5α cells, and screen single clones in ampicillin-resistant medium for culture by shaking. After extracting the plasmid, Sanger sequencing was performed using the 'intermediate vector detection-F' primer. The plasmid that was successfully ligated to the AtU6-26V4 vector after sequencing verification is the intermediate vector; use the intermediate vector as a PCR substrate, design primers 'SOSO-F' and 'SOSO-R' with homologous arms, and perform PCR amplification of the gRNA scaffold_spacer region; The intermediate vector detection-F primers are as follows: GAGCTCGGATCCACTAGTAA; The SOSO-F primers are as follows: TATGACATGATTACGAATTCGAGCTCGGATCCACTAGTAA; The SOSO-R primers are as follows: CTAATCTGGGGACCGAATTCGTGTGATGGATATCTGCAGA; Step 4: Ligate the gRNA scaffold_spacer sequence with the pCC vector: Digest the pCC plasmid with EcoR1 restriction enzyme, and ligate the gRNA scaffold_spacer sequence with the PCC vector using the In-Fusion HD Cloning Kit; transform the ligation product into competent E. coli DH5α cells, and screen single clones in spectinomycin hydrochloride resistant medium for culture by shaking. After extracting the plasmid, perform Sanger sequencing using the 'final vector detection-F' primer; the plasmid that has been successfully ligated with the pCC vector and verified by sequencing is the final CRISPR / Cas9 vector; The final vector detection-F primers are as follows: ATGCTTCCGGCTCGTATGTT.

2. The application of a gene knockout method for regulating tomato growth and development as described in claim 1, characterized in that: Used to regulate the tomato growth cycle.

Citation Information

Patent Citations

  • Method for simultaneously silencing tomato miR482b and miR482c by using CRISPR-Cas9 system and application

    CN111850032A