Application of miRNA-140 and method for regulating craniofacial skeleton and scale development of zebrafish

Abstract

The present invention relates to the fields of life science and biotechnology, and particularly relates to a method for constructing a miR-140 gene knockout zebrafish model, which causes abnormal craniofacial and scale development. By designing upstream and downstream targets of the miR-140 gene and using the CRISPR / Cas9 technology to knockout the gene, a miR-140 gene knockout zebrafish model is constructed. Compared with the wild zebrafish of the AB strain, the shape of the scales on the posterior part of the head of miR-140<supgt;‑ / ‑< / supgt; zebrafish changes, the scales become larger, the craniofacial bones develop abnormally, and the mouth becomes pointed, indicating that zebrafish miR-140 regulates the development of its scales and craniofacial bones; it can further study the function of the miR-140 gene, and also has great significance for the evolutionary study of scaled fish and scaleless fish.

Description

Technical Field

[0001] The present invention belongs to the fields of life science and biotechnology, and particularly relates to a method for constructing a miR-140 gene knockout zebrafish model, which causes abnormal craniofacial and scale development. Background Art

[0002] MicroRNA is an endogenous non-coding RNA. It is now known that it controls nearly 30% of the gene expressions in organisms. It regulates genes by complementary pairing with the 3'-untranslated region (3'UTR) of the mRNA of target genes, activating the degradation of target gene mRNA or preventing its translation into proteins, and is a very important class of non-coding RNA in organisms. In recent years, with the rise of CRISPR technology and as a powerful and convenient gene modification and editing technology, it has been pursued by many researchers and has been rapidly and widely applied to explore gene functions and study the occurrence of tumors in various organisms such as human cells, Drosophila, mice, and zebrafish. miR-140 is specifically highly expressed in chondrocytes. miR-140 was first identified in zebrafish, and then it was found that it is also specifically expressed in human and mouse cartilage. This gene exists on the short arm of chromosome 16 in humans and mice. In recent years, studies have found that it is involved in the differentiation of chondrocytes and is related to the pathogenesis of osteoarthritis. Miyaki et al. found that miR-140 - / - mice showed mild skeletal phenotypes, including short stature, low body weight, and craniofacial deformities, short nose, and domed skull. Fish scales, as the exoskeleton of fish, are homologous to teeth and bones and are all derivatives of the dermal skeleton. They play important biological roles such as protecting fish from external microbial invasion, reducing frictional damage caused by water when fish swim, and maintaining the special body shape of fish. At present, the research on zebrafish scales mainly focuses on the formation pattern and morphogenesis. At the molecular level, it is mainly to study by knocking out genes related to fish scales such as EDA, EDAR, and FGFRs, but there is no relevant literature report on miRNAs involved in scale development, and its research is also of great significance for revealing the evolution of scaled fish and scaleless fish. Summary of the Invention

[0003] The present invention aims to provide the application of the miR-140 gene.

[0004] The present invention provides a method for knocking out miR-140 in zebrafish.

[0005] The present invention also aims to use zebrafish as a model to knock out miR-140 by CRISPR / Cas9 technology, so as to simulate its influence on the craniofacial bone and scale development processes in fish.

[0006] The present invention also provides a method for regulating the development of zebrafish craniofacial bones or scales.

[0007] The technical solution of the present invention is the application of miRNA-140 in regulating the craniofacial bone development or scale development of zebrafish.

[0008] By knocking out the miRNA gene, a miR-140 gene knockout zebrafish model was constructed, and then methods such as calcein staining and micro-ct were used to observe and verify its function. Through repeated comparison and observation, it was found that miR-140 - / - In zebrafish compared with the wild-type zebrafish of the AB strain, the shape of the scales at the rear of the head changed, the scales became larger, the craniofacial bone development was abnormal, and the mouth became pointed, indicating that zebrafish miR-140 can regulate the development of its scales and craniofacial bones.

[0009] A method for regulating the craniofacial bone development or scale development of zebrafish, specifically, knocking out the miRNA-140 gene of zebrafish or enhancing the expression of the miRNA-140 gene.

[0010] After knocking out the miRNA-140 gene of zebrafish, the shape of the scales at the rear of the head of zebrafish changed, the scales became larger, the craniofacial bone development was abnormal, and the mouth became pointed. Enhancing the expression of the miRNA-140 gene of zebrafish, a method for constructing a zebrafish model with abnormal craniofacial and scale development, specifically, knocking out the miRNA-140 gene of zebrafish. The specific steps include:

[0011] (1) Knock out the miRNA-140 gene in the fertilized eggs at the one-cell stage of zebrafish to obtain the heterozygous F0 generation of miR-140 gene knockout zebrafish;

[0012] (2) Hybridize the F0 generation with wild-type zebrafish of the AB type to obtain the F1 generation, and through gene sequencing, obtain the heterozygous individuals lacking the miR-140 gene;

[0013] (3) Interbreed the mature F1 generation of miR-140 gene-deficient female and male heterozygotes to obtain the F2 generation, and obtain the homozygous zebrafish of the F2 generation lacking the miR-140 gene.

[0014] Preferably, it further includes step (4): Mate the homozygous zebrafish of the F2 generation lacking the miR-140 gene to produce the F3 generation, the homozygous zebrafish.

[0015] Through the above method, a zebrafish model with abnormal craniofacial bone development and enlarged scale shape can be established.

[0016] The method for knocking out the miRNA-140 gene of zebrafish is specifically to use the CRISPR / Cas9 technology to double knockout miR-140.

[0017] Knock out the nucleotide sequence with a length of 297 bp at positions 217 - 513 in SEQ ID No.1, including the following steps: Inject Cas9 and upstream and downstream gRNAs into the one-cell stage fertilized eggs of zebrafish.

[0018] The upstream and downstream gRNAs are prepared through the following steps:

[0019] (A) Using the oligonucleotide sequences shown in SEQ ID No.6 and SEQ ID No.7, and the sgRNA scaffold sequence shown in SEQ ID No.6 as templates, amplify to obtain the gRNA in vitro transcription template;

[0020] (B) According to the gRNA in vitro transcription template, perform in vitro transcription of the T7 promoter to obtain the upstream and downstream gRNAs.

[0021] The oligonucleotide includes an upper target oligonucleotide and a lower target oligonucleotide, including a T7 promoter, a target sequence, and a sequence for recognizing the sgRNA scaffold.

[0022] Upper target oligonucleotide Oligo-1:

[0023] GATCACTAATACGACTCACTATAGGAGAGGAAGGCCTGGATTAGTTTTAGAGCTAGAAATAGC (SEQ ID No.6).

[0024] Lower target oligonucleotide Oligo-2:

[0025] GATCACTAATACGACTCACTATAGGCAAAGATGATTGAGGGTGGTTTTAGAGCTAGAAATAGC (SEQ ID No.7)

[0026] Wherein GATCACTAATACGACTCACTATA is the T7 promoter, and GGAGAGGAAGGCCTGGATTA and GGCAAAGATGATTGAGGGTG in SEQ ID No.6 and SEQ ID No.7 are the target sequences respectively. GTTTTAGAGCTAGAAATAGC is used to recognize and ligate the sgRNA scaffold.

[0027] sgRNA scaffold (SgRNA-scaffold):

[0028] AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (SEQ ID No.8).

[0029] Knockout was performed targeting SEQ ID NO.2 and SEQ ID NO.3 located upstream and downstream of the miR-140 gene.

[0030] Upstream target TS-140-1: 5′-GGAGAGGAAGGCCTGGATTA-3′ (SEQ ID NO.2)

[0031] Downstream target TS-140-2: 5′-GGCAAAGATGATTGAGGGTG-3′ (SEQ ID NO.3).

[0032] A primer for identifying the phenotype of the zebrafish miRNA-140 gene, the upstream and downstream primer sequences of which are shown as SEQ ID No.4 and SEQ ID No.5.

[0033] TS-140-F: 5′-TGGGAATGCATTATTTGCTGATTTG-3′ (SEQ ID NO.4)

[0034] TS-140-R: 5′-ATCGGGGCCGTAACTCTAAG-3′ (SEQ ID NO.5)

[0035] The present invention mainly constructs a miR-140 gene knockout zebrafish model by designing upstream and downstream targets of the miR-140 gene and using the CRISPR / Cas9 technology to double knockout miR-140. By using calcein staining and micro-ct to observe and verify its function, it was found that compared with the wild zebrafish of the AB strain, miR-140 - / - in zebrafish shows changes in the shape of the scales at the rear of the head, enlarged scales, abnormal craniofacial bone development, and a pointed mouth, indicating that zebrafish miR-140 regulates the development of its scales and craniofacial bones.

[0036] The present invention discovers the regulatory relationship between the zebrafish miR-140 gene and the development of scales and craniofacial bones, and through the upstream and downstream targets of the miR-140 gene, realizes the knockout of the miR-140 gene and constructs a miR-140 gene knockout zebrafish model, which can further study the role of miR-140 and also has great significance for the evolutionary study of scaled fish and scaleless fish. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 Schematic diagram of miRNA-140, upstream and downstream targets, and identification primer sequences of SEQ ID NO.1.

[0038] Figure 2 It is the sequencing map of the zebrafish gene miR-140 "-297bp" type

[0039] Figure 3 is miR-140 of the F3 generation - / - and the phenotypic diagrams of wild-type zebrafish

[0040] Figure 4 is miR-140 of the F3 generation - / - and the lateral views of micro-CT of wild-type zebrafish Detailed implementation manners

[0041] Example 1

[0042] Obtain the zebrafish dre-miR-140 sequence and the complete sequences within 500 bp upstream and 1000 bp downstream from the Ensembl (http: / / asia.ensembl.org / index.html) website, query its precursor and mature sequences in the miRbase (http: / / www.mirbase.org / ) database, and further verify and supplement its information on the NCBI (http: / / www.ncbi.nlm.nih.gov / ) website.

[0043] Based on the ZiFiT (http: / / zifit.partners.org / ZiFiT / ) online software, design the upstream and downstream gRNA target sites TS-140-1 / 2 (Target site sequences) of the zebrafish miR-140 gene knockout, synthesize Oligo and SgRNA-scaffold, obtain the in vitro transcription template of gRNA by PCR according to this template, and then perform in vitro transcription of the T7 promoter according to the in vitro transcription template; and carry out the miR-140 gene knockout experiment on AB-type wild zebrafish embryos.

[0044] 1. Screening and preparation of available gRNA target sites for zebrafish miR-140 knockout

[0045] The position where the miR-140 gene is located is at positions 372-476 of the SEQ ID No.1 sequence. As Figure 1 shown, it is a sequence in SEQ ID NO.1 that is bold, italicized, and underlined, with a total of 105 bp, which is the zebrafish miR-140 gene and is located in the 16th intron region of the wwp2 gene.

[0046]

[0047] In addition, Figure 1 the bold 20-bp sequence is the upstream and downstream target sites, which are designed in the WWP2 gene. The underlined sequence with a wavy line is the identification primer. Starting from the bold and underlined upper target site sequence to the bold and underlined lower target site sequence, the middle 297-bp sequence (Figure 1 The middle gray part) was completely knocked out by sequencing detection. The designed target site sequences are as follows:

[0048] Upper target TS-140-1: 5′-GGAGAGGAAGGCCTGGATTA-3′ (SEQ ID NO.2), lower target TS-140-2: 5′-GGCAAAGATGATTGAGGGTG-3′ (SEQ ID NO.3), which is the reverse target and corresponds to the (caccctc aatcatctttgcc ) of the above sequence.

[0049] The upper target oligonucleotide and the upper target oligonucleotide were designed, and the sequences are shown in SEQ ID No.6 and SEQ ID No.7 respectively, including the T7 promoter, the target sequence, and the sequence recognizing the sgRNA scaffold.

[0050] Upper target oligonucleotide Oligo-1:

[0051] GATCACTAATACGACTCACTATAGGAGAGGAAGGCCTGGATTAGTTTTAGAGCTAGAAATAGC(SEQID No.6).

[0052] Lower target oligonucleotide Oligo-2:

[0053] GATCACTAATACGACTCACTATAGGCAAAGATGATTGAGGGTGGTTTTAGAGCTAGAAATAGC(SEQID No.7).

[0054] The sgRNA scaffold (SgRNA-scaffold) sequence is shown in SEQ ID No.8:

[0055] AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC(SEQ ID No.8)

[0056] The identification primers were designed online using Primer blast on the NCBI website, and the selection conditions were: (1) The upstream and downstream primers were 100 bp away from the target; (2) The lengths of the upstream and downstream primers were 20 - 23 bp; (3) The amplified fragment was about 500 bp; (4) The designed primers had high specificity (i.e., only the required band could be amplified). The designed identification primers are as follows:

[0057] TS-140-F: 5'-TGGGAATGCATTATTTGCTGATTTG-3' (SEQ ID NO.4)

[0058] TS-140-R: 5'-ATCGGGGCCGTAACTCTAAG-3' (SEQ ID NO.5)

[0059] The fragment sizes amplified by the primers can be used to distinguish the following three phenotypes: the result of the wild type is 695 bp; in the gel image of the heterozygote, in addition to a 695-bp band, there is also a 398-bp band below; the homozygote has only a 398-bp band.

[0060] 2. Synthesis and purification of the in vitro transcription template of gRNA:

[0061] The synthesized Oligo, SgRNA-scaffold, and identification primers are all dissolved in sterilized ddH2O to 10 μM.

[0062] The 40-μL system is as follows: Oligo (10 μM) 3 μL, SgRNA-scaffold (10 μM) 3 μL, 2x EasyTaq PCR SuperMix (+dye) 20 μL, add water to 40 μL. In addition, the PCR reaction is 94°C for 3 min, 94°C for 30 s, 65°C for 30 s, 72°C for 1 min, 72°C for 5 min, 4°C ∞, 34 cycles. A total of 160 μL from 4 tubes is synthesized into one tube for column purification, and the specific steps refer to the instruction manual of the QIAquick PCR purification kit of QIAGEN company. After purification, measure its concentration with NanoDrop (Thermo, USA), and run gel electrophoresis at 160 V / 22 min to check whether the size is correct.

[0063] 3. In vitro transcription and purification of the in vitro transcription template of gRNA:

[0064] The present invention uses the T7 promoter for in vitro transcription. The specific operation steps refer to the use of the mMESSAGE mMACHINE T7 Ultra Kit of Life company for in vitro transcription, and complete the in vitro transcription according to the instruction manual.

[0065] The specific steps for purifying gRNA are as follows:

[0066] First, add 1 μL of TURBO DNase to the above transcription product, incubate at 37 °C for 15 min to remove the excess untranscribed template DNA, and then add 1 μL of 0.5 M EDTA to terminate the reaction. Then add 2.5 μL of 4 M LiCl and 100 μL of absolute ethanol, mix well, and place at -80 °C overnight. The next day, centrifuge at 12,000 rpm at -4 °C for 15 min, finally discard the supernatant, add 1 mL of 70% ice-cold ethanol for washing, and finally resuspend the RNA with Nuclease-free water. Measure the concentration using NanoDrop and detect the size and quality by electrophoresis.

[0067] Example 2 Construction of a Zebrafish Model with miRNA-140 Gene Knockout

[0068] 1. Microinjection

[0069] Cas9 protein (purchased directly from Genscript) and the upstream and downstream transcribed gRNAs obtained in Example 1 were co-injected into the one-cell stage fertilized eggs of zebrafish. The dosage of the mixed Cas9 protein and gRNA: 400 pg / μL: 100 pg / μL, injection volume: 1 nL / fertilized egg. Place the target on ice during injection and use it immediately after mixing.

[0070] Specifically, the process of obtaining miR-140 gene knockout homozygous zebrafish with stable inheritance through the above cultivation is as follows: (1) Perform gene sequencing on the injected zebrafish to obtain F0 generation heterozygous zebrafish with miR-140 gene knockout; (2) Hybridize the F0 generation with AB wild-type zebrafish to obtain the F1 generation. After gene sequencing, obtain "-297bp" (deletion of 297bp) heterozygotes; (3) Interbreed the mature F1 generation "-297bp" (deletion of 297bp) female and male heterozygotes to obtain the F2 generation. After gene sequencing, obtain "-297bp" (deletion of 297bp) gene-edited F2 generation female homozygotes and "-297bp" (deletion of 297bp) gene-edited F2 generation male and female homozygotes after gene sequencing. (4) Mate the "-297bp" (deletion of 297bp) gene-edited F2 generation female homozygous zebrafish with the "-297bp" (deletion of 297bp) gene-edited F2 generation male heterozygous zebrafish to produce the F3 generation. After gene sequencing, obtain F3 "-297bp" (deletion of 297bp) type female and male homozygous zebrafish. Among them, the upstream target sites are TS-140-1: 5′-GGAGAGGAAGGCCTGGATTA-3′ (SEQ ID NO.2) and TS-140-2: 5′-GGCAAAGATGATTGAGGGTG-3′ (SEQ ID NO.3). The primers used for gene sequencing are TS-140-F: 5′-TGGGAATGCATTATTTGCTGATTTG-3′ (SEQ ID NO.4) and TS-140-R: 5′-ATCGGGGCCGTAACTCTAAG-3′ (SEQ ID NO.5).

[0071] 2. Detection of the effectiveness of F0 generation embryo injection:

[0072] The injected zebrafish embryos develop to 24h - 48h. Randomly select ten groups (5 eggs / group), and roughly extract genomic DNA by the alkaline lysis method. The main operation steps are as follows:

[0073] (1) Add 50 μL of 50 mM NaOH solution to each tube of zebrafish embryos and incubate at 95°C for 10 min;

[0074] (2) Briefly centrifuge to make the liquid reach the bottom of the tube, vortex for about 1 min, and then incubate at 95°C for 10 min;

[0075] (3) After briefly centrifuging again, place on ice for 1 - 2 min, add 5 μL of Tri-HCl (PH = 8.0), vortex, centrifuge at 12000 rpm at room temperature for 10 min, store briefly at 4°C, and store long-term at -20°C;

[0076] (4)Finally, using the extracted zebrafish genomic DNA as a template, a PCR reaction was carried out to identify the effectiveness of zebrafish knockout.

[0077] The identification primer sequences are as follows:

[0078] TS-140-F: 5′-TGGGAATGCATTATTTGCTGATTTG-3′ (SEQ ID NO.4)

[0079] TS-140-R: 5′-ATCGGGGCCGTAACTCTAAG-3′ (SEQ ID NO.5)

[0080] The 20 μL system is as follows: 1 μL of TS-140-F (10 μM), 1 μL of TS-140-R (10 μM), 10 μL of 2xEasyTaq PCR SuperMix (+dye), 1 μL of the extracted genome, and finally add water to 20 μL. In addition, the PCR reaction is 94°C for 3 min, 94°C for 30 s, 60°C for 30 s, 72°C for 1 min, 72°C for 5 min, 4°C ∞, 34 cycles.

[0081] Electrophoresis was used to detect the effectiveness of the knockout, and the PCR products of possible mutants were unidirectionally sequenced. The peak map was viewed using the software Chrome, and the sequence was aligned with blast n on the NCBI website. The results showed that compared with the wild type, the mutant showed a double peak in the peak map near the target site, indicating the effectiveness of the knockout. The remaining fertilized eggs were raised to 2 months old, the tails were cut, and genomic DNA was extracted by the alkaline lysis method mentioned above. PCR reaction was carried out with the 20 μL system mentioned above, and electrophoresis was performed and sent for sequencing. After identification, the mutant heterozygote (-297 bp) was mated with AB wild-type zebrafish to obtain the F1 generation.

[0082] 3. Screening of F1 generation mutants

[0083] The F1 generation zebrafish obtained by mating the mutants screened from the F0 generation with AB wild-type zebrafish were raised until they could lay eggs. The tails were cut and mutants were screened by the same method as above. After gene sequencing, a heterozygote of "-297 bp" (deletion of 297 bp) was obtained. Subsequently, the screened male and female mutants were mated to obtain the F2 generation.

[0084] As Figure 2 The sequence comparison diagram can clearly show that the homozygous sequencing starts from GGCCTGGATTA in the upper target site 5′-GGAGAGGAAGGCCTGGATTA and deletes until CACCCTC in the lower target site AATCATCTTTGCC ends at CACCCTC. Among them, due to the deletion of 297 bp in the WT sequence, and because the sequence is too long, the intermediate sequence is omitted with "-".

[0085] In addition, comparing the peak graphs of the two (the position indicated by the arrow mark is the starting position of the downstream target sequence, and the underlined part is the first 7 bases of the downstream target sequence), it can be clearly seen that the first 7 sequences before the sequence of the F2 generation homozygote are the upstream target sequence, while that of the wild type is not.

[0086] 4. Screening of F2 generation homozygotes and obtaining of F3 generation

[0087] Using the same method as above for tail-clipping screening, after gene sequencing, male and female adult F2 generation homozygotes with the "-297bp" (deletion of 297bp) gene were obtained, and they were mated to obtain the F3 generation.

[0088] Example 3: Detection of phenotypes of F3 generation homozygotes by calcein staining

[0089] The F3 generation zebrafish obtained in Example 2 was taken for phenotype detection.

[0090] First, the zebrafish were anesthetized with 1% tricaine, and after complete anesthesia, they were placed in a 2% calcein solution prepared with fish-raising water and stained in the dark for 3 - 5 minutes, and then put back into the fish-raising water. The excess stain was removed by changing the water. Before taking pictures, they were anesthetized again, and then the shape of the scales was observed under a fluorescence microscope. From Figure 3 We could clearly see miR-140 - / - Compared with the WT wild-type zebrafish, its craniofacial bones changed, the mouth became pointed, and the scales at the back of the head became larger and their shape changed.

[0091] Example 4: Micro-CT of homozygotes

[0092] After fixing the F3 generation homozygotes with 4% paraformaldehyde, they were sent to Pingsheng Medical Biology Company for micro-CT. From Figure 4 We could clearly see miR-140 - / - The craniofacial bones of the zebrafish changed significantly, which further showed that miR-140 plays a very important role in regulating the craniofacial bones of zebrafish.

[0093] The above examples are only preferred examples of the present invention and do not limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention. Sequence Listing <110> Shanghai Ocean University <120> Method for Application of miRNA-140 and Regulation of Zebrafish Craniofacial Skeleton and Scale Development <130> W-21-1-02695 <140> 2021115355853 <141> 2021-12-15 <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 695 <212> DNA <213> Zebrafish (Danio rerio) <400> 1 tgggaatgca ttatttgctg atttgtatta tgaaacaaat tgataattat ttttatttga 60 tcttttgaca tgtacaaaca tcgccgtgca acatatccat attgttcatg taatccacta 120 atataccctc aacaccgtcc cgtttctcct cagatcatga acatgaagcc gtatgacctc 180 cgccggcgac tctacataat catgagagga gaggaaggcc tggattacgg aggaatcgcc 240 aggcaagtca aaccctgtag catcccgttg tccgtcatcc tggtgctcct gttcagtgtt 300 tgttgtttgg ggagttctgt ggtgttcctc tgcctgtctg ctggagctca tgtagttgtc 360 ttcctgtgtc tgtgtttgtc tcctgtgtcc cgtcagtggt tttaccctat ggtaggttac 420 gtcatgctgt tctaccacag ggtagaacca cggacgggat gtctggaggt gtctgcgtcg 480 ccctgtggtg ccaaaataaa caccctcacc ctcaatcatc tttgcccctt taccttctgt 540 cccgtcgggc tccgagatct tgggttctgc tgctggaccg gttttgattt tcgacgtgtc 600 tgtgtttgtg tttttgttca gtctgtctgc atcttcatca ttgtgtatgg cacttttgtg 660 gatttcttta cagatcttag agttacggcc ccgat 695 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 ggagaggaag gcctggatta 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 ggcaaagatg attgagggtg 20 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <400> 4 tgggaatgca ttatttgctg atttg 25 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 atcggggccg taactctaag 20 <210> 6 <211> 63 <212> DNA <213> Artificial Sequence <400> 6 gatcactaat acgactcact ataggagagg aaggcctgga ttagttttag agctagaaat 60 agc 63 <210> 7 <211> 63 <212> DNA <213> Artificial Sequence <400> 7 gatcactaat acgactcact ataggcaaag atgattgagg gtggttttag agctagaaat 60 agc 63 <210> 8 <211> 80 <212> DNA <213> Artificial Sequence <400> 8 aaaagcaccg actcggtgcc actttttcaa gttgataacg gactagcctt attttaactt 60 gctatttcta gctctaaaac 80

Claims

1. A method for regulating the development of zebrafish scales, characterized in that, Knock out the miRNA-140 gene in zebrafish.

2. Method for constructing a zebrafish model with abnormal scale development, characterized in that, Knock out the miRNA-140 gene in zebrafish.

3. The method for constructing a zebrafish model with abnormal scale development according to claim 2, characterized in that the steps Including: (1) Knock out the miRNA-40 gene in the one-cell stage fertilized eggs of zebrafish to obtain the F0 generation of zebrafish heterozygotes with miR-140 gene knockout; (2) Hybridize the F0 generation with AB-type wild zebrafish to obtain the F1 generation, and through gene sequencing, obtain the heterozygotes with miR-140 gene deletion; (3) Intercross the mature F1 generation of miR-140 gene deletion female and male heterozygotes to obtain the F2 generation, and obtain the female and male homozygous zebrafish with miR-140 gene deletion in the F2 generation.

4. The method for constructing a zebrafish model with abnormal scale development according to claim 3, wherein It also includes step (4): Mate the female and male homozygous zebrafish with miR-140 gene deletion in the F2 generation to produce the F3 generation of homozygous zebrafish.

Images