Primer probe set, detection kit and application for simultaneously detecting three serotypes of capripoxvirus

By designing specific primer and probe sets and using real-time PCR technology, the problem of the inability to effectively detect the three serotypes of sheep poxvirus in existing technologies has been solved, achieving rapid, accurate, and convenient detection results and avoiding missed detection of circulating strains from different sources in cross-border products.

CN115852050BActive Publication Date: 2025-12-16DALIAN NATIONALITIES UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211367580.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-03
Publication Date
2025-12-16
Estimated Expiration
2042-11-03

AI Technical Summary

Technical Problem

Existing detection methods cannot effectively cover the three serotypes of sheep poxvirus from different isolates around the world, posing a risk of missed detection, and lack rapid, accurate, and convenient detection methods.

Method used

A primer-probe set, including specific upstream and downstream primers and probes, was designed and combined with real-time PCR technology to simultaneously detect three serotypes of the sheep poxvirus genus. Through real-time PCR reactions labeled with fluorescent groups and quenching groups, rapid and accurate detection of CaPV was achieved.

Benefits of technology

It enables accurate and reliable detection of three serotypes of sheep poxvirus, and features rapid, simple, efficient and highly sensitive detection. It can cover epidemic strains from different sources and avoid missed detections.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115852050B_ABST
    Figure CN115852050B_ABST
Patent Text Reader

Abstract

The application provides a primer probe set, a detection kit and application for simultaneously detecting three serotypes of capripoxvirus. The primer probe set comprises upper and lower primers and a probe, wherein the nucleotide sequences of the upper and lower primers are shown as SEQ ID NO. 1 and SEQ ID NO. 2, Y represents C or T, and M represents A or C, and the nucleotide sequence of the probe is shown as SEQ ID NO. 3. The TaqMan Probe real-time qPCR method for simultaneously detecting three serotypes of capripoxvirus provided by the application can simultaneously detect three serotypes of capripoxvirus, namely bovine papular dermatosis virus (LSDV), sheep pox virus (SPV) and goat pox virus (GPV), and has the characteristics of rapidness, accuracy, simplicity, high efficiency, strong specificity, high sensitivity and the like.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a primer probe set, a detection kit and application for simultaneously detecting three serotypes of capripoxvirus. BACKGROUND

[0002] Goatpox virus (GPV), Sheeppox virus (SPV) and Lumpy skin disease virus (LSDV) are three genetically similar serotypes of pathogenic agents of the Capripoxvirus genus (CaPV) of the Poxviridae family. CaPV is a local disease in many regions of the world, including China, and is currently more prevalent in northern Africa, the Middle East and some countries in Asia, causing huge economic losses.

[0003] Animals sensitive to the three serotypes of CaPV, SPV, GPV and LSDV, are sheep, goats and cattle, respectively. After CaPV infection, the animals will show clinical manifestations including fever, depression, reduced milk production (in cows) and skin damage (nodules, papules and patches). Capripox is an important economic disease in the production areas of goats, sheep and cattle around the world, hindering the introduction of valuable breeds of cattle and sheep and the large-scale production of cattle and sheep. The disease can be transmitted through mechanical contact of arthropods. Mosquitoes, flies and ticks can be accomplices in the long-distance spread of the epidemic across regions. When detected, the disease can be preliminarily diagnosed through clinical symptoms such as fever, skin nodule-like changes and lymph node enlargement, but its definitive diagnosis relies on laboratory detection, especially when the disease is in the incubation period. In addition, there are cases of latent infection without clinical symptoms, which also need to be diagnosed by laboratory detection. However, the current detection method is only developed for the Chinese epidemic strain or a single epidemic strain. Due to the large genetic variation between CaPV species, there is a risk of missing detection of different isolates from different parts of the world (including different isolation times, different isolation locations and different hosts) in cross-border products. Therefore, it is necessary to develop a rapid, accurate and simple CaPV-specific detection method that can fully cover all epidemic strains. SUMMARY

[0004] To solve the above technical problems, the application provides a primer probe set, a detection kit and application for simultaneously detecting three serotypes of capripoxvirus.

[0005] To achieve the above-mentioned purposes, the application adopts the following technical solutions:

[0006] The primer probe set for simultaneously detecting three serotypes of Capripoxvirus, comprising upstream and downstream primers, and a probe, wherein the nucleotide sequences of the upstream and downstream primers are shown as SEQ ID NO. 1 and SEQ ID NO. 2, wherein Y represents C or T, and M represents A or C, and the nucleotide sequence of the probe is shown as SEQ ID NO. 3.

[0007] The primer probe set as described above, preferably, the 5' end of the probe is labeled with a fluorescent group, and the 3' end of the specific probe is labeled with a quenching group.

[0008] Preferably, the fluorescent group is any one of Cy5, CF647, Alexa647, FAM, CF488, HEX, VIC, CF532, Cy5.5, CF680, or Quasar705, and the quenching group is BHQ2, TAMRA, MGB, BHQ3, MAX or BHQ1.

[0009] The kit for simultaneously detecting three serotypes of Capripoxvirus, comprising the primer probe set as described above.

[0010] The kit as described above, preferably, further comprising Probe qPCR Mix, and a positive control.

[0011] Preferably, the positive control contains the nucleotide sequence shown as SEQ ID NO. 4.

[0012] A method for simultaneously detecting three serotypes of Capripoxvirus, which is a non-diagnostic purpose detection, comprising the following steps:

[0013] (1) extracting sample genomic DNA;

[0014] (2) performing a fluorescent quantitative PCR reaction with primers having sequences shown as SEQ ID NO. 1 and SEQ ID NO. 2, and a probe shown as SEQ ID NO. 3, wherein the 5' end of the probe is labeled with a fluorescent group, and the 3' end of the specific probe is labeled with a quenching group;

[0015] (3) collecting the fluorescent signal in the fluorescent quantitative PCR amplification process, and detecting whether the sample to be detected contains SPV, GPV and LSDV components of the three serotypes of CaPV through the fluorescent signal.

[0016] The method as described above, preferably, in step (2), the fluorescent quantitative PCR reaction system adopts a 25.0-microliter system, including a final concentration of 1x Probe qPCR Mix, 0.2 pmol / ul of primers as shown in SEQ ID NO. 1 and SEQ ID NO. 2, and 0.2 pmol / ul of a probe as shown in SEQ ID NO. 3; the probe is labeled with FAM and BHQ1 at both ends.

[0017] The method as described above, preferably, in step (2), the PCR reaction program is as follows: 95 DEG C pre-denaturation for 30 s, 1 cycle; 95 DEG C denaturation for 5 s, 60 DEG C for 30 s, 45 cycles.

[0018] Result determination:

[0019] If there is an "S" type fluorescence signal amplification curve, and the Ct value is less than 35, it is judged to be positive;

[0020] If there is no "S" type fluorescence signal amplification curve, no Ct value or Ct value is greater than 45, it is judged to be negative;

[0021] If the Ct value is between 35 and 45, it is recommended to repeat the experiment, if the Ct value is less than 45, the fluorescence signal amplification curve has obvious peak, the sample is judged to be positive, otherwise it is negative.

[0022] The present application has the advantages of:

[0023] The primer probe set for simultaneously detecting three serotypes of capripoxvirus provided by the present application can be used to accurately and reliably simultaneously detect bovine papular dermatosis virus (LSDV), sheep pox virus (SPV) and goat pox virus (GPV), which are three different serotypes of capripoxvirus.

[0024] The TaqMan probe real-time qPCR method for simultaneously detecting three serotypes of capripoxvirus provided by the present application for detecting capripoxvirus has the characteristics of rapidness, accuracy, simplicity, high efficiency, strong specificity, high sensitivity and the like, can perform full coverage homology analysis on epidemic strains from all over the world, and avoids the risk of missing detection of epidemic strains of different origins carried in cross-border products. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 The homology analysis results of P32 genes of 39 CaPV isolates are analyzed by using DNAStar software.

[0026] Figure 2 The homology alignment results of P32 genes of different source site isolates of the qPCR method for simultaneously detecting three serotypes of CaPV.

[0027] Figure 3Standard curve analysis for 7 dilution levels of PCAs detected by the qPCR method of the present application.

[0028] Figure 4 Probability regression analysis plot for the detection sensitivity LOD 95% based on PCAs as templates.

[0029] Figure 5 Probability regression analysis plot for the detection sensitivity LOD 95% based on clinical sample DNA as templates. DETAILED DESCRIPTION

[0030] The following examples are intended to further illustrate the present application but not limit the present application. Any modification and replacement made to the present application without departing from the spirit and essence of the present application shall fall within the scope of the present application.

[0031] Unless otherwise specified, the technical means used in the examples are the routine means well known to those skilled in the art. Unless otherwise specified, the reagents used in the methods of the present application are of analytical purity or above.

[0032] All viruses and bacteria used for specific analysis in the present application are clinical samples or cultures. Three members of the Capripoxvirus genus (LSDV, SPV and GPV) were used. Other viruses and bacteria include foot-and-mouth disease virus (FMDV), Peste des petits ruminants virus (PPRV), bovine viral diarrhea virus (BVDV), Brucella, Mycobacterium tuberculosis, Bacillus anthracis. All infected viruses and bacteria clinical samples or cultures were preserved and used by the China Animal Disease and Pest Control Center (Beijing, China). The clinical samples used for clinical validation experiments in the study were from naturally infected animals. 85 CaPV naturally infected clinical samples (skin tissue, whole blood and lymph node) included from cattle (n=30), sheep (n=29) and goats (n=26) were all taken from animals showing mild to severe clinical symptoms (fever and skin lesions). 50 negative control samples included from cattle (n=19), sheep (n=15) and goats (n=16) were collected from healthy animals. All clinical samples were initially diagnosed by the SYBR Green PCR recommended by OIE and were preserved and used by the China Animal Disease and Pest Control Center.

[0033] Example 1 Primer and probe design

[0034] The DNA fragment of P32 gene is selected as the target of the TaqMan probe real-time qPCR method for CaPV detection. The base sequence of this P32 gene region has large interspecies genetic variation, small intraspecies genetic variation, high identification ability, and has been used for CaPV analysis method research. However, there is a lack of full coverage homology analysis of different isolates from all over the world (including different isolation times, different isolation places, and different hosts), which prevents the risk of missing detection of different source isolates in cross-border products. The present application retrieves all possible accession numbers of P32 genes of three members of CaPV: bovine nodular dermatopathy virus (LSDV), sheep pox virus (SPV), and goat pox virus (GPV) in NCBI, selects representative isolates from all over the world (including different isolation times, different isolation places, and different hosts), and analyzes the genetic homology of these isolates using DNAStar software. 155 accession numbers (including 21 accession numbers of LSDV isolates, 69 accession numbers of SPV isolates, and 65 accession numbers of GPV isolates) based on CaPV P32 gene sequences are searched in NCBI. The P32 gene sequences of 39 accession numbers of CaPV three-member isolates (including different isolation times, different isolation places, and different hosts) are selected from the 155 accession numbers, as shown in Table 1, and the homology of the P32 gene sequences of the three members of CaPV (including LSDV, SPV, and GPV) is analyzed by DNAStar software, which is 94.2% to 100% (such as Figure 1 ). Based on the 39 accession numbers, MEGA 4.0 is used for homology comparison of primer and probe sequences. Figure 3 After comparison of the 39 gene sequences, there are individual isolates with 1 base different from the forward primer and 1-3 bases different from the probe sequence. The present application replaces the different bases with degenerate bases, so that the designed goat pox virus (CaPV) can simultaneously detect three serotypes of goat pox virus (CaPV) isolates from all over the world: GPV, SPV, and LSDV, and can prevent the risk of missing detection of different source epidemic strains in cross-border products.

[0035] In addition, the gene sequences of other viruses and bacteria for exclusive testing were retrieved for alignment analysis. Specifically, 6 closely related differential viruses and bacteria (including: foot-and-mouth disease virus, peste des petits ruminants virus, bovine viral diarrhea virus, Brucella, Mycobacterium tuberculosis, Bacillus anthracis) were retrieved in NCBI, and the gene sequences were aligned using MEGA 4.0. The forward primer, TaqMan probe, and reverse primer sequences of the capripoxvirus (CaPV) are not matched with the differential viruses and bacteria, and theoretically, three serotypes of capripoxvirus (CaPV) GPV, SPV, and LSDV can be detected simultaneously, and other closely related differential viruses and bacteria can be excluded. Figure 2

[0036] The P32 gene sequence accession number of the capripoxvirus (CaPV) used in the present application is shown in Table 1.

[0037] Table 1 39 accession numbers of capripoxvirus (CaPV) P32 gene sequences for real-time qPCR analysis

[0038]

[0039]

[0040]

[0041] The P32 gene sequence of the capripoxvirus (CaPV) was aligned with the gene sequences of closely related viruses and bacteria (including foot-and-mouth disease virus, peste des petits ruminants virus, bovine viral diarrhea virus, Brucella, Mycobacterium tuberculosis, Bacillus anthracis), and the most variable fragment was screened. The 3' end of the primer was placed at the position where the target virus and closely related viruses and bacteria showed different nucleotides, ensuring the specificity of the target virus. Primer Express software 5.0 was used to design primers and probes, and the secondary structure and the presence of possible primer dimers were evaluated. The specific qPCR method for detecting capripoxvirus used TaqMan probe. The fluorescence reporter group FAM was labeled at the 5' end of the probe, and the quenching group BHQ1 was labeled at the 3' end. Table 2 lists the sequences of all primers and probes used in the present application. The primers and probes were synthesized by Bosheng Bioengineering (Dalian) Co., Ltd. (Dalian, China).

[0042] Table 2 Primer and probe sequence information for qPCR analysis in the present application

[0043]

[0044] wherein Y represents C or T, and M represents A or C.

[0045] ​Method of qPCR amplification: Real-time fluorescent qPCR analysis of the present application can be performed on Q7 Fast Thermal Cycler (Life Technologies) or other brands of thermal cycler (such as CFX96 Bio-Rad Thermal Cycler). qPCR analysis is performed using Probe qPCR Mix (Code 391A, TaKaRa) or other brands of Probe qPCR reaction base reagent (such as GoTaq qPCR Master Mix, Code A6101, Promega). After optimization, the composition of the PCR master mix of the present application includes 1x Probe qPCR Mix (master mix) and 2 μl template, plus balanced nuclease-free water, with a final volume of 25 μl. The final concentration of primers and probes used in the PCR master mix is as follows: 0.2 pmol / μl forward primer, 0.2 pmol / μl reverse primer and 0.2 pmol / μl probe. The optimized thermal cycling conditions for qPCR include 95°C for 30 s, 1 cycle; 95°C for 5 s, 60°C for 30 s, 45 cycles.

[0046] Result determination:

[0047] If there is an "S" type fluorescence signal amplification curve, Ct value < 35, it is judged as positive;

[0048] If there is no "S" type fluorescence signal amplification curve, no Ct value or Ct value > 45, it is judged as negative;

[0049] If the Ct value is between 35-45, it is recommended to repeat the experiment. If the Ct value is < 45, the fluorescence signal amplification curve has obvious peak, the sample is judged as positive, otherwise it is negative.

[0050] Example 2 amplification efficiency (E)

[0051] The 550 bp sequence of CaPV P32 gene (accession number MG458377.1) is selected as shown in SEQ ID NO. 4. The sequence of SEQ ID NO. 4 is as follows: ATGGCAGATATCCCATTA TATGTTATACCAATCGTTGG TCGCGAAATTTCAGATGT AGTTCCA GAATTAAAAAGTGACAATGATATATTTTATAAAAAAGTTGACACAGTAAAAGATTTTAAAAATTCAGATGTAAATTTTTTTTTTAAAGATAAAAAAGATGATATCAGTTTATCATATAA GTTACTTATATGGGAAAAGGTAGThe 550bp sequence was inserted into the commercial vector pMD19-T to construct a plasmid. The plasmid was digested with Sac I to obtain a linearized plasmid, which served as a positive amplification control (PAC). The PAC plasmid was synthesized by TaKaRa. The purified PAC plasmid was quantified using a spectrophotometer. The copy number concentration of PAC was used as a template for the limit of detection (LOD) study.

[0052] Using the CaPV artificial positive amplification control (PAC) plasmid described above as a template, seven serial dilution levels were prepared, including: 5.8 × 10⁻⁶. 6 5.8×10 5 5.8×10 4 5.8×10 3 5.8×10 2 5.8×10 1 The amplification efficiency of qPCR in Example 1 was calculated using 5.8 copies / μl (in copy number). Each dilution level was analyzed in six runs, with four runs performed under repeatability conditions (i.e., a new dilution series was prepared before each run), and each dilution level was measured in six separate runs, resulting in 24 data points per dilution. The mean Ct value obtained at each dilution level was plotted against the PAC plasmid concentration for linear regression analysis. The slope of the regression line was used, calculated using the formula E = 100(10^2 / 2π). -1 / 斜率 -1) Calculate qPCR efficiency and express it as a percentage. For each target, the slope of the regression curve should be between -3.9 and -2.9, corresponding to a qPCR efficiency range of 80% to 120%. Simultaneously, the correlation coefficient R of the linear curve should be calculated. 2 This is an indicator of the linearity of a qPCR reaction; R0 is the linearity of each target. 2 It should be ≥0.98.

[0053] Results are shown in Table 3, according to the equation E = 100( 10-1 / 斜率 -1), the analytical efficiency was determined as the slope of the regression line, showing a good linear relationship between Ct values and PAC plasmid concentration Figure 3 ).

[0054] Table 3 Amplification efficiency (E) and correlation coefficient (R 2 ) of qPCR method a .

[0055]

[0056] As can be seen from the above, the correlation coefficient R 2 of the TaqMan probe qPCR method for detecting CaPV is 0.9916, the slope of the regression curve is -3.42, and the efficiency E is 96.06%. These results meet the requirements of the general qPCR verification guidelines, i.e. the correlation coefficient R 2 ≥ 0.98, the slope of the regression curve should be between -3.9 and -2.9, and the efficiency E is 80-120%. It is shown that the primers and probes used in the present application have good amplification effect.

[0057] Example 3 Sensitivity

[0058] The analytical sensitivity LOD 95% of the qPCR method of the present application is determined by experiment, and is calculated by semi-log regression analysis. The LOD 95% of two types of plasmid PACs (in units of genome copies) and GPV clinical sample DNA template (in units of DNA concentration) is determined.

[0059] 1) Analytical sensitivity with PACs as template

[0060] In order to determine the analytical sensitivity LOD 95% of the TaqMan probe qPCR method for detecting CaPV, PACs of CaPV plasmid DNA diluted with nuclease-free water were prepared in 8 serial dilution levels (including: 5.8 x 10 4 , 5.8 x 10 3 , 5.8 x 10 2 , 5.8 x 10 1 , 5.8, 2.9, 0.58, 0.058 copies / μl), each dilution level was tested not less than 8 times. The lowest copy number of each analysis was determined by semi-log regression analysis.

[0061] The LOD 95%The copy number is represented for each analysis, with each copy representing one genome copy of the viral particle. The LOD of TaqMan probe qPCR detection of CaPV was evaluated using PACs of CaPV plasmid DNA at eight serial dilution levels as templates, following the qPCR amplification method described in Example 1. 95% The results of the semi-logarithmic probability regression analysis show that ( Figure 4 The analytical sensitivity (LOD) of TaqMan probe qPCR detection of CaPV 95% The detection rate was 3.80 copies / reaction, with a 95% confidence interval of 1.88–38.19 copies / reaction. This is sufficient for detecting trace amounts of CaPV during its latent or prodromal phases.

[0062] 2) Analytical sensitivity using clinical sample DNA as a template

[0063] Using clinical sample DNA as a template, LOD 95% This indicates the highest dilution level for each test. Using GPV clinical sample DNA serially diluted 10× from healthy goat skin tissue samples as templates, nine serial dilution levels were prepared, including the stock solution (10 ng / μl), 10×... 1 × Diluent (1 ng / μl), 10 2 × Diluent (10) -1 ng / μl), 10 3 × Diluent (10) -2 ng / μl), 10 4 × Diluent (10) -3 ng / μl), 10 5 × Diluent (10) -4 ng / μl), 10 6 × Diluent (10) -5 ng / μl), 10 7 × Diluent (10) -6 ng / μl, 10 8 × Diluent (10) -7 Using ng / μl as a template, the LOD of the qPCR method for detecting CaPV was evaluated. 95% The results of the probabilistic regression analysis show that ( Figure 5 The analytical sensitivity (LOD) of qPCR detection of CaPV 95% 4.91×10 -5 ng (i.e., the highest dilution level per test is 10) 6 (×dilution level), the 95% confidence interval is 1.60×10⁻⁶. -5 ~2.13×10 -3The above results show that the primers and probes used in the present application have high detection sensitivity, and the highest dilution level for each detection is 10 6 × dilution level, which can fully meet the detection of slight infection of micro-virus in the latent or prodromal stage of CaPV.

[0064] Example 4 Specificity and cross-reactivity

[0065] The CaPV exclusion test based on P32 gene was tested using undiluted sample genomic templates obtained from 9 closely related viruses and bacteria, including: goatpox virus, sheep pox virus, bovine tuberculous dermatosis virus, foot-and-mouth disease virus, peste des petits ruminants virus, bovine viral diarrhea virus, Brucella, Mycobacterium tuberculosis, and the differential viruses and bacteria of Bacillus anthracis. Each sample analysis was repeated for no less than 3 times.

[0066] The extraction of viral and bacterial genomic templates used: viral and bacterial DNA (CaPV, Brucella, Mycobacterium tuberculosis, Bacillus anthracis) was extracted from clinical samples according to the manufacturer's instructions using a magnetic bead method DNA extraction kit (DP438-T2K, Tiangen Biochemical Technology Co., Ltd., Beijing, China). Viral RNA (foot-and-mouth disease virus, peste des petits ruminants virus, bovine viral diarrhea virus) was extracted from clinical samples according to the manufacturer's instructions using a magnetic bead method RNA extraction kit (Code DP452, Tiangen Biochemical Technology Co., Ltd.).

[0067] To determine the specificity of the method, the specificity of qPCR detection of CaPV was evaluated using natural infection clinical samples of three members of CaPV (LSDV, GPV and SPV) and sample materials of 6 non-targeted, differentially clinical symptoms (including foot-and-mouth disease virus, peste des petits ruminants virus, bovine viral diarrhea virus, Brucella, Mycobacterium tuberculosis, Bacillus anthracis). The method used the method in Example 1, and the results are shown in Table 4.

[0068] Table 4 TaqMan probe qPCR results specificity analysis

[0069]

[0070] The results show that the specificity for the three members of CaPV (LSDV, GPV and SPV) is 100%, and there is no cross-reaction for 6 non-targeted differential viruses and bacteria. These analysis results confirm the accuracy and specificity of the detection method of the present application.

[0071] Example 5 Robustness of the method

[0072] The robustness of the CaPV detection method developed in the present application was checked by changing several parameters of the qPCR reaction, such as the qPCR instrument (CFX96 Real-Time System, Bio-Rad), the qPCR reagents (GoTaq qPCR Master Mix, Code A6101, Promega), the concentration of primers and probe (± 25%), the PCR annealing temperature (± 1 °C). The parameter variations were evaluated using a orthogonal design (Table 5). In each combination, the GPV clinical sample DNA template was used at 3x dilution (10 -2 ng / ul) to study the influence on the results stability, each analysis was tested in triplicate. The results were obtained following the method in Example 1 and were analyzed using SPSS software regression, using the Kruskal-Wallis H test to evaluate the level of significance of the differences between the results obtained in each method orthogonal design combination, when statistical p > 0.05 indicated that there were no significant differences in the results.

[0073] Table 5 Conditions for the robustness experiment as an orthogonal design

[0074]

[0075] The results showed that there were no significant differences in the Ct values of the method. The Ct value for the TaqMan probe qPCR detection of CaPV was 29.51 ± 0.28, p = 0.435 (Table 6).

[0076] Table 6 Results of the robustness experiment

[0077]

[0078] From the results of the orthogonal experiment it can be concluded that the TaqMan probe qPCR method is robust and can be transferred to other laboratories and used in routine analysis.

[0079] Example 6 Detection of samples

[0080] Using clinical samples from tissues of animals naturally infected with CaPV (cattle, sheep, goats) and healthy animals (blood samples, lymph nodes, skin tissue), the detection sensitivity (DSe) and diagnostic specificity (DSp) of the qPCR method were evaluated. The comparison of the diagnostic performance with the OIE recommended SYBR Green qPCR method was performed by calculating the kappa value to analyze the degree of agreement in the validation of clinical samples.

[0081] 85 clinical samples from CaPV naturally infected animals (cattle, sheep, goat), including 20 skin tissue samples, 46 whole blood samples, 19 lymph node samples. 50 clinical samples from healthy animals (cattle, sheep, goat), including 9 skin tissue samples, 33 whole blood samples, 8 lymph node samples, which were diagnosed by the SYBR Green qPCR method recommended by OIE. Each tissue sample (skin tissue, lymph node) was taken from three different positions, about 1.0 g of sample was cut and ground in a grinder, 1.0 mL of normal saline was added for further grinding, and then transferred to a sterile centrifuge tube after homogenization, and centrifuged at 10000 x g in a high-speed refrigerated centrifuge for 2 min, 100 μL of supernatant was taken in a 1.5 mL sterile centrifuge tube. Whole blood or culture was centrifuged at 10000 x g for 5 min, and 100 μL of supernatant was taken in a 1.5 mL sterile centrifuge tube. The supernatant was stored at -70°C as described above for DNA extraction. The detection was performed by the qPCR amplification method in Example 1. The MedCalc software was used for probability regression analysis to calculate the consistency of these detection methods in verifying clinical samples at a probability level of 95%.

[0082] The clinical verification results showed that the TaqMan probe qPCR method and the SYBR Green qPCR method recommended by OIE were used to verify 30 cases of LSDV naturally infected cattle (including 8 cases of skin tissue, 16 cases of whole blood, 6 cases of lymph node), 29 cases of SPV naturally infected sheep (including 6 cases of skin tissue, 16 cases of whole blood, 7 cases of lymph node) and 26 cases of GPV naturally infected goats (including 6 cases of skin tissue, 14 cases of whole blood, 6 cases of lymph node), and all tests were positive, as shown in Table 7. The clinical verification was performed on 50 samples of healthy animal materials (including 19 healthy cattle, 15 healthy sheep, 16 healthy goats), and all tests were negative, as shown in Table 7. Through probability regression analysis and diagnostic consistency degree analysis, compared with the SYBR Green PCR recommended by OIE, the diagnostic sensitivity (DSe) and diagnostic specificity (DSp) of the TaqMan probe qPCR method of the application for CaPV clinical samples were 100% (95% confidence interval 95.8%-100%) and 100% (95% confidence interval 92.9%-100%) respectively, and the consistency evaluation index kappa value was 1.0 (95% confidence interval 1-1), as shown in Table 8.

[0083] Table 7. Verification of clinical samples

[0084]

[0085]

[0086]

[0087]

[0088]

[0089] Table 8 Consistency analysis of clinical sample diagnosis

[0090]

[0091] These clinical verification results show that the diagnosis of CaPV based on the TaqMan probe qPCR method has good diagnostic consistency with the OIE recommended SYBR Green PCR method. Among them, for the clinical samples detected as weak positive by the OIE recommended SYBR Green PCR (such as positive 11, 16, 70, 82 in Table 7), the method developed by the present application is detected as a stronger positive result, thus to a certain extent, the missed detection of slight infection of trace virus in the incubation period or prodromal period can be avoided.

Claims

1. A primer and probe set for the simultaneous detection of three serotypes of sheep poxvirus, comprising upstream and downstream primers and probes, wherein, The nucleotide sequences of the upstream and downstream primers are shown in SEQ ID NO.1 and SEQ ID NO.2, where Y represents C or T and M represents A or C. The nucleotide sequence of the probe is shown in SEQ ID NO.

3. The amplification target of the primer-probe set contains the nucleotide sequence shown in SEQ ID NO.

4.

2. The primer-probe set according to claim 1, characterized in that, The probe has a fluorescent group labeled at its 5′ end and a quenching group labeled at its 3′ end.

3. The primer-probe set according to claim 2, characterized in that, The fluorescent group is any one of Cy5, CF647, Alexa647, FAM, CF488, HEX, VIC, CF532, Cy5.5, CF680 or Quasar705, and the quenching group is BHQ2, TAMRA, MGB, BHQ3, MAX or BHQ1.

4. A kit for simultaneously detecting three serotypes of sheep poxvirus, characterized in that, It includes the primer and probe set as described in any one of claims 1-3.

5. The reagent kit according to claim 4, characterized in that, It also includes Probe qPCR Mix and / or positive control.

6. The reagent kit according to claim 5, characterized in that, The positive control contains the nucleotide sequence shown in SEQ ID NO.

4.

7. A method for simultaneously detecting three serotypes of sheep poxvirus, wherein the method is for non-diagnostic purposes, characterized in that, It includes the following steps: (1) Extract genomic DNA from the sample; (2) Use primers with sequences as shown in SEQ ID NO.1 and SEQ ID NO.2 and probes as shown in SEQ ID NO.3 to perform real-time PCR reaction; wherein the 5′ end of the probe is labeled with a fluorescent group and the 3′ end of the probe is labeled with a quenching group; (3) Collect the fluorescence signal during the fluorescence quantitative PCR amplification process, and detect whether the sample contains the three serotypes of sheep poxvirus, goat poxvirus and bovine nodular dermatovirus by fluorescence signal detection; the result judgment method is as follows: if there is an "S" type fluorescence signal amplification curve and the Ct value is <35, it is judged as positive; if there is no "S" type fluorescence signal amplification curve, no Ct value or Ct value >45, it is judged as negative; if the Ct value is between 35 and 45, repeat the experiment. If the Ct value is <45 and the fluorescence signal amplification curve has an obvious peak, the sample is judged as positive, otherwise it is negative.

8. The method according to claim 7, characterized in that, In step (2), the real-time PCR reaction system is a 25.0 µL system, including Probe qPCR Mix with a final concentration of 1×, primers as shown in SEQ ID NO.1 and SEQ ID NO.2 at 0.2 pmol / µl, and probes at 0.2 pmol / µl; the probes are labeled with FAM and BHQ1 at both ends, respectively.

9. The method according to claim 7, characterized in that, In step (2), the PCR reaction program is as follows: 95℃ pre-denaturation for 30s, 1 cycle; 95℃ denaturation for 5s, 60℃ for 30s, 45 cycles.

Citation Information

Patent Citations

  • Kit used for detecting sheep pox virus and detection method thereof

    CN103276111A

  • Oligonucleotide primers and fluorescence-labelled probe, method and test system of PCR in real time for detecting capripoxviruses genome

    RU2658493C1