Endophytic fungus Chaetomium spiralis from Dendrobium officinale and its application in the growth of Dendrobium officinale

Abstract

The present invention discloses a kind of endophytic fungus spiral Chaetomium of Dendrobium and its application in the growth of Dendrobium. It is classified and named as spiral Chaetomium Chaetomium spirochaete, and its classification status is Ascomycetes, Ascomycetes, Chaetomaceae, Chaetomium, and the strain number is JSNLSHQH-5. It has been deposited in the General Microbiological Center of China Microbiological Culture Collection Committee, and the deposit number is CGMCC NO.18542. The deposit date is September 2, 2019. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing, Postal Code 100101. The spiral Chaetomium spirochaete strain JSNLSHQH-5 of the present invention has obvious growth-promoting effect on Dendrobium officinale seedlings, promotes its growth, and enhances its stress resistance. At the same time, it can be artificially cultured, the culture conditions are simple, and it is easy to mass produce, and it has good development and application prospects.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to an endophytic fungus Chaetomium spiralis of dendrobium and application thereof in the growth of dendrobium. Background Art

[0002] Dendrobium officinale is a perennial epiphytic herb of the genus Dendrobium in the orchid family. It is mainly distributed in provinces south of the Yangtze River, such as Zhejiang, Anhui, and Fujian. It has the effects of nourishing yin, moistening the lungs, and thickening the stomach and intestines. It is a rare Chinese medicinal material included in the Chinese Pharmacopoeia. Dendrobium officinale belongs to the orchid family. Like most orchids, it needs to coexist with fungi to complete its entire life history. As wild Dendrobium officinale resources are becoming increasingly endangered, the market demand for Dendrobium officinale currently relies mainly on artificial cultivation. Seedling breeding mainly relies on tissue culture and rapid propagation, but tissue culture seedlings themselves have many problems such as low transplant survival rate, slow growth, and low content of effective ingredients. In nature, Dendrobium mycorrhizal fungi can not only promote seed development and growth, but also increase its stress resistance.

[0003] In recent years, many scholars have conducted extensive research on the growth mechanism and related effects of mycorrhizal fungi of Dendrobium. How to obtain mycorrhizal fungi with significant effects to further promote the growth of Dendrobium and increase the stress resistance of seedlings has become a direction that needs continuous research for the development of the Dendrobium officinale industry. Summary of the invention

[0004] Purpose of the invention: In view of the shortcomings and defects of the prior art, one of the purposes of the present invention is to provide an endophytic fungus of Dendrobium officinale, Chaetomium spirochaete, strain number JSNLSHQH-5. Another purpose of the present invention is to provide the use of the above strain in promoting the growth of Dendrobium officinale seedlings.

[0005] Technical solution: The endophytic fungus Chaetomium spirochaete of the present invention is classified and named as Chaetomium spirochaete, and its classification status is Ascomycetes, Sordales, Chaetomaceae, Chaetomium, and the strain number is JSNLSHQH-5. It has been deposited in the General Microbiological Center of China Microorganism Culture Collection Committee, with a deposit number of CGMCC NO.18542 and a deposit date of September 2, 2019. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Postal Code 100101.

[0006] The main biological characteristics of the strain are: after 7 days of cultivation on PDA medium, the colony diameter is 6.8 cm, the growth rate is moderate, the colony is flat, the hyphae are dense, gray-brown, the edges are neat, there is pigmentation, and it is easy to produce spores under artificial culture conditions.

[0007] The full sequence of the ITS region was amplified and sequenced. The full sequence of 16sRNA obtained by PCR amplification (SEQ ID NO.1) was TTGTGACGTTACCTAAACCGTTGCTTCGGCGGGCGGCGCCGGGGTTTACCCCCCGGGCGCCCCTGGGCCCCACCGCGGGCGCCCGCCGGAGGTCACCAAACTCTTGATAATTTATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT GAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAAGCAGTGGCGGGCTC GCTGTCACACCGAGCGTAGTAGCATACATCTCGCTCTGGGCGTGCTGCGGGTTCCGGCCGTTAAACCACCTTTTAACCCAAGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATAT.

[0008] The invention discloses an application of the endophytic fungus Chaetomium spiralis in the growth of Dendrobium.

[0009] The invention discloses an application of the dendrobium endophytic fungus Chaetomium spiralis in promoting the growth of the dendrobium officinale seedlings.

[0010] When preparing the microbial agent of the present invention, the spiral Chaetomium strain JSNLSHQH-5 is prepared into a liquid agent, which is added into the cultivation substrate of Dendrobium officinale, and the relative water content of the substrate is maintained at 60% to 80% for 5 to 6 days to ensure the survival of the fungus in the substrate.

[0011] The inoculation amount of liquid bacterial agent per cubic meter of Dendrobium officinale cultivation substrate is 30g to 50g.

[0012] When preparing the liquid bacterial agent, corn is used as a culture medium, ammonium sulfate is used as an exogenous nitrogen source, and glucose is used as an exogenous carbon source to prepare a liquid culture medium; after sterilization, spiral Chaetomium is inoculated for liquid shaking culture, and after the culture is completed, the fermentation liquid containing the mycelium balls is broken into a homogenous bacterial agent.

[0013] The corn is added in the form of corn extract. Take 20g-40g corn flour, add 500ml distilled water, boil for 30min and filter to obtain corn extract.

[0014] The corn extract is added to a liquid culture medium containing ammonium sulfate and glucose, and sterilized at 121° C. and 0.11 MP for 30 minutes to obtain a liquid culture medium.

[0015] The liquid shaking culture conditions are 25°C to 30°C, 12h light / 12h dark, pH 6.4 to 6.6, and 120r / min to 150r / min liquid shaking culture for 20d to 25d.

[0016] The mass concentrations of ammonium sulfate and glucose in the liquid culture medium are 5.0 g / L to 7.0 g / L and 8.0 g / L to 25.0 g / L respectively.

[0017] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: After testing, the Chaetomium spirochaete strain JSNLSHQH-5 of the present invention has a significant growth-promoting effect on Dendrobium officinale seedlings, and can significantly increase the net growth and chlorophyll content of Dendrobium officinale seedlings after application, and significantly reduce its POD enzyme activity, thereby promoting its growth and enhancing its stress resistance. At the same time, the strain can be artificially cultured, the culture conditions are simple, the application is convenient, it is easy to preserve, and it is easy to mass produce, and has good development and application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The front morphology of the colony cultured by the strain of the present invention;

[0019] Figure 2 It is the back morphology of the colony cultured by the strain of the present invention. DETAILED DESCRIPTION

[0020] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and specific implementation methods.

[0021] Embodiment 1:

[0022] In June 2017, a strain JSNLSHQH-5 that can promote the growth of Dendrobium officinale seedlings was isolated and screened from the roots of Dendrobium candidum in good growth condition in the Dendrobium cultivation area in Jiangsu Agricultural Expo Park in Jurong City, Jiangsu Province.

[0023] The strain was cultured on PDA plates. The colonies were flat, the hyphae were dense, gray-brown, with neat edges and pigmentation, and it was easy to produce spores under artificial culture conditions.

[0024] The full sequence of the ITS region was amplified and sequenced. The full sequence of 16sRNA obtained by PCR amplification (SEQ ID NO.1) was TTGTGACGTTACCTAAACCGTTGCTTCGGCGGGCGGCGCCGGGGTTTACCCCCCGGGCGCCCCTGGGCCCCACCGCGGGCGCCCGCCGGAGGTCACCAAACTCTTGATAATTTATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT GAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAAGCAGTGGCGGGCTC GCTGTCACACCGAGCGTAGTAGCATACATCTCGCTCTGGGCGTGCTGCGGGTTCCGGCCGTTAAACCACCTTTTAACCCAAGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATAT.

[0025] Morphological and molecular biological identification showed that the strain was Chaetomium spirochaete, isolated from the genus Chaetomium of the family Chaetomaceae, class Chaetomycetes, order Chaetomales, phylum Ascomycetes, strain number JSNLSHQH-5, and has been deposited in the General Microbiology Center of China Culture Collection of Microorganisms with the deposit number CGMCCNO.18542 and the deposit date of September 2, 2019. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code 100101.

[0026] Embodiment 2:

[0027] Analysis of the growth-promoting effect of Chaetomium spirochaete strain JSNLSHQH-5 on Dendrobium officinale.

[0028] 1) A liquid culture medium is prepared using corn flour as a culture medium, ammonium sulfate as an exogenous nitrogen source, and glucose as an exogenous carbon source, and Chaetomium spirochaete is inoculated for liquid shaking culture. After the culture is completed, the fermentation liquid containing the mycelium balls is broken into a homogenous bacterial agent. First, 30g corn flour was taken, 500ml distilled water was added, and the mixture was boiled for 30min and filtered to obtain corn extract. The corn extract was added to distilled water, and 6.0g ammonium sulfate and 15.0g glucose were added to make the volume 1L. The mixture was sterilized at 121℃ and 101.3 kPa for 30min. After the culture matrix was cooled, the mycorrhizal fungus Chaetomium spirochaete strain JSNLSHQH-5 was inoculated under sterile conditions. The mixture was cultured under shaking conditions of 28℃, 120h / min, 12h light + 12h dark for 20d. After the culture was completed, the fermentation liquid containing mycelium balls was broken into a homogenous inoculant, and the inoculant was mixed into the cultivation matrix of Dendrobium officinale. The relative water content of the matrix was maintained at 60% to 80% for 5 days to ensure the survival of the fungus in the matrix. The inoculation amount of the liquid inoculant per cubic meter of the cultivation matrix of Dendrobium officinale was 30 to 50g.

[0029] 2) Dendrobium officinale tissue culture seedlings were selected as cultivation materials, washed, dried until the roots turned white, weighed, and planted in the above-mentioned inoculated cultivation medium at a planting density of 5 plants / clump and 30 clumps / ㎡, and the uninoculated medium was set as a non-control (ck).

[0030] 3) Carry out normal water and fertilizer management. After 60 days of cultivation, take out the Dendrobium officinale seedlings by multi-point random sampling and analyze the growth-promoting effect.

[0031] Analysis of growth-promoting effects:

[0032] 1. Determination of weight gain: Clean the cultivation medium on the roots and tubers, air-dry under natural conditions, weigh the fresh weight of the Dendrobium officinale seedlings with an analytical balance (0.0001g), and subtract the weight of the Dendrobium officinale seedlings before transplanting to obtain the net weight gain.

[0033] 2. Content of chlorophyll a, chlorophyll b and chlorophyll a+b: Weigh about 0.5g of healthy Dendrobium officinale leaves, chop them, add 25mL of a mixed extract of anhydrous ethanol and acetone (volume ratio of 1:1), and extract for 24h in the dark. After 24h, centrifuge the extract and measure the absorbance A645 and A663 of each supernatant at 645nm and 663nm using a UV-visible spectrophotometer.

[0034] The measured data were used to calculate the chlorophyll a, chlorophyll b and total chlorophyll contents according to the following formulas:

[0035] Ca(mg / g)=(12.71A663-2.59A645)*V / 1000m;

[0036] Cb(mg / g)=(22.88A645-4.67A663)*V / 1000m;

[0037] Ca+b(mg / g)=(8.04A663+20.29A645)*V / 1000m;

[0038] In the above formula: V represents the final volume (mL) of the mixed extract of anhydrous ethanol and acetone in a volume ratio of 1:1, and m represents the fresh weight (g) of the Dendrobium officinale leaves used.

[0039] 3. Determination of malondialdehyde content: Weigh about 1g of healthy Dendrobium officinale leaves, cut them into pieces, add 2ml 10% TCA and a small amount of quartz sand, grind them into a homogenate, add 8ml TCA to grind, centrifuge the homogenate at 4000r / min for 10min, and the supernatant is the sample extract. Then take 2ml of the extract obtained above (add 2ml distilled water for control), add 2ml 0.6% TBA solution, react the mixture in a boiling water bath for 15min, cool it quickly and then centrifuge it. Take the supernatant to measure the extinction at 532, 600 and 450 wavelengths.

[0040] Calculate the content of the measured data according to the following formula.

[0041] C1=11.71D450;

[0042] C2={6.45(D532-D600)-0.56D450}NW -1 ;

[0043] D450, D532, and D600 represent the extinction values ​​at wavelengths of 450, 532, and 600 nm, respectively. N represents the total volume of the extract (ml), and W represents the fresh weight of the plant tissue.

[0044] Analysis of the effect of Chaetomium spirochaete strain JSNLSHQH-5 on the growth-promoting effect of Dendrobium officinale tissue culture seedlings:

[0045] Table 1- Effect of JSNLSHQH-5 on the growth of Dendrobium officinale tissue culture seedlings

[0046]

[0047] After testing, the Chaetomium spirochaete strain JSNLSHQH-5 of the present invention has an obvious growth-promoting effect on the seedlings of Dendrobium officinale. After application, it can significantly increase the net growth and chlorophyll content of the seedlings of Dendrobium officinale, and significantly reduce its POD enzyme activity, thereby promoting its growth and enhancing its stress resistance. At the same time, the strain can be artificially cultured, the culture conditions are simple, the application is convenient, it is easy to preserve, and it is easy to mass produce, and has good development and application prospects.

Claims

1. An endophytic fungus of Dendrobium, Chaetomium spirochaete, is classified and named as Chaetomium spirochaete, the strain number is JSNLSHQH-5, and it has been deposited in the General Microbiological Center of China Microbiological Culture Collection Administration, with a deposit number of CGMCC NO.18542 and a deposit date of September 2, 2019.

2. Use of the endophytic fungus Chaetomium spiralis described in claim 1 in promoting the growth of Dendrobium officinale seedlings.

3. The use according to claim 2, characterized in that: The spiral Chaetomium strain JSNLSHQH-5 is prepared into a liquid bacterial agent, which is added into a cultivation substrate of Dendrobium officinale, and the relative water content of the substrate is maintained at 60% to 80% for 5 to 6 days to ensure the survival of the fungus in the substrate.

4. The use according to claim 3, characterized in that: The inoculation amount of liquid bacterial agent per cubic meter of Dendrobium officinale cultivation substrate is 30g to 50g.

5. The use according to claim 3, characterized in that: When preparing the liquid bacterial agent, corn is used as a culture medium, ammonium sulfate is used as an exogenous nitrogen source, and glucose is used as an exogenous carbon source to prepare a liquid culture medium; after sterilization, spiral Chaetomium is inoculated for liquid shaking culture, and after the culture is completed, the fermentation liquid containing the mycelium balls is broken into a homogenous bacterial agent.

6. The use according to claim 5, characterized in that: The liquid shaking culture conditions are 25°C to 30°C, 12h light + 12h dark, pH 6.4 to 6.6, and 120r / min to 150r / min liquid shaking culture for 20d to 25d.

7. The use according to claim 5, characterized in that: The mass concentrations of ammonium sulfate and glucose in the liquid culture medium are 5.0 g / L to 7.0 g / L and 8.0 g / L to 25.0 g / L respectively.

8. The use according to claim 7, characterized in that: The corn is added in the form of corn extract. Take 20g-40g corn flour, add 500ml distilled water, boil for 30min and filter to obtain corn extract.

Images