Highly active and thermostable luciferase mutants suitable for mammalian cell expression systems

Abstract

The present invention discloses a highly active and highly thermostable luciferase mutant suitable for a mammalian cell expression system. The present invention transforms the molecular structure of luciferase using a rational design method based on codon-optimized firefly luciferase to obtain a luciferase mutant with improved thermostability and activity, and the amino acid sequence of the mutant is shown in SEQ ID NO.3‑5. The nucleotide sequence encoding its protein is shown in SEQID NO.6‑8. The mutant includes at least one of the double mutation sites T214N T290P, T214N K28R and A532RT214N. Compared with the prior art, the luciferase mutant obtained by the present invention can be efficiently expressed in 293 cells, and the expression product has the characteristics of high activity and high thermostability.

Description

Technical Field

[0001] The invention relates to a luciferase mutant with high activity and high thermal stability suitable for a mammalian cell expression system, and belongs to the technical field of genetic engineering. Background Art

[0002] The relative molecular mass of luciferase extracted from the North American firefly (Photinus pyralis) is 60kDa. It is a single polypeptide chain composed of 551 amino acid residues and contains a large number of hydrophobic amino acid residues. It consists of two domains, namely the N-terminal domain (1-436) and the C-terminal domain (440-550), which are connected by the intermediate linker sequence (436-440). The gap formed by the two domains is considered to be the active site (Xue Xiuhua, Huang Chenxi. Research progress of luciferase gene [J]. Bulletin of Biology, 2013, 48 (09): 1-4; Zako T, Ayabe K, Aburatani T, et al. Luminescent and substrate binding activities of firefly luciferase N-terminal domain [J]. BBA-Proteins and Proteomics, 2003, 1649 (2): 183-189.).

[0003] The catalytic reaction process of luciferase is: in the presence of oxygen, ATP, Mg 2+ Under certain conditions, luciferase catalyzes the oxidation of the substrate luciferin and emits fluorescence. This process does not require an excitation light source. The luminescence energy mainly comes from the chemical reaction and the luminescence can last for a certain period of time. Therefore, it has a wide range of applications in scientific research, medicine, and food industries.

[0004] Comprehensive application of luciferase gene in scientific research and medicine shows that it has wide applications in gene expression, pyrophosphate sequencing technology, drug screening, microbial labeling (tracing), protein interaction research, RNA interference, live imaging of labeled cells, detection of cell apoptosis, etc. In addition, luciferase also has broad application prospects in the food industry, because the luciferin-luciferase luminescence system has high sensitivity, and the luminescence intensity is proportional to the ATP content in the system. The determination of ATP can directly reflect the content of cells or microorganisms. With the popularization of the application of luciferase, the demand continues to increase. It is of great significance to study luciferase with high activity, good tolerance to temperature and pH, and low cost.

[0005] However, wild-type and recombinant luciferases are very unstable. When they are exposed to 30°C, especially above 35°C, they will quickly lose their activity (Xu Yong, Zhang Zhongdong, Li Jing, Wang Hongping, Wang Juan, Hu Qian, Zhao Nana. Cloning and bioinformatics analysis of the firefly Luc gene [J]. Biotechnology, 2020, 30(04): 328-334. DOI: 10.16519 / j.cnki.1004-311x.2020.04.0053. Yu Haoran. Rational design to modify the thermal stability of luciferase [D]. Tianjin University, 2014.). The reasons for the poor thermal stability of luciferase include a large number of hydrophobic amino acid residues in luciferase, a large number of random coil structures in the secondary structure, and the absence of disulfide bonds in the luciferase structure, which are not conducive to maintaining the structural stability of the protein. It is easy to lose activity when stored in the reagent, so it is of great significance to modify luciferase to improve its activity and thermal stability in the application of enzymes. In recent years, methods for modifying firefly luciferase through genetic engineering technology have also matured, such as exploring the characteristics of the enzyme's luminescence intensity, stability, and the law of changes in bioluminescent optical properties by using random mutation, semi-rational design, rational design, codon optimization, etc. Although some progress has been made in improving the stability and activity of luciferase, research in this area is currently mainly concentrated in Western countries. With the widespread application of firefly luciferase in China, it is very necessary to produce highly stable firefly luciferase with independent intellectual property rights. Summary of the invention

[0006] The technical problem to be solved by the present invention is that the existing luciferase has the problems of poor thermal stability, easy inactivation, low enzyme activity, etc.

[0007] In order to solve the above technical problems, the present invention provides a firefly luciferase mutant. The firefly luciferase is optimized by mammalian codons, and its wild-type codon-optimized amino acid sequence is shown in SEQ ID NO.1, and its nucleotide sequence is shown in SEQ ID NO.2; the mutant includes at least one of the double mutation sites T214N T290P, T214N K28R and A532R T214N;

[0008] The T214N T290P refers to mutation of the 214th and 290th threonines to asparagine and proline, respectively;

[0009] The T214N K28R is that the threonine and lysine at positions 214 and 28 are mutated to asparagine and arginine respectively;

[0010] The A532R T214N is that the threonine and alanine at positions 214 and 532 are mutated to asparagine and arginine respectively.

[0011] Wherein, the amino acid sequence of the above codon-optimized luciferase is as follows:

[0012] (SEQ ID NO.1);

[0013] The gene sequence of the above codon-optimized luciferase is as follows:

[0014]

[0015] Preferably, the amino acid sequence of the mutant is shown in SEQ ID NO.3-5.

[0016] Among them, the amino acid sequence of the T214N T290P mutant is as follows:

[0017] (SEQ ID NO.3);

[0018] The amino acid sequence of the T214N K28R mutant is as follows:

[0019] MEDAKNIKKGPAPFYPLEDGTAGEQLHRAMKRYALVPGTIAFTDAHIEVDITYAEYFEMSVRLAEAMKRYGLNTNHRIVVCSENSLQFFMPVLGALFIGVAVAPANDIYNERELLNSMGISQPTVVFVSKKGLQKILNVQKKLPIIQKIIIMDSKTDYQGFQSMYTFVTSHLPPGFNEYDFVPESFDRDKTIALIMNSSGSTGLPKGVALPHRNACVRFSHARDPIFGNQIIPDTAILSVVPFHHGFGMFTTLGYLICGFRVVLMYRFEEELFLRSLQDYKIQSALLVPTLFSFFAKSTLIDKYDLSNLHEIASGGAPLSKEVGEAVAKRFHLPGIRQGYGLTETTSAILITPEGDDKPGAVGKVVPFFEAKVVDLDTGKTLGVNQRGELCVRGPMIMSGYVNNPEATNALIDKDGWLHSGDIAYWDEDEHFFIVDRLKSLIKYKGYQVAPAELESILLQHPNIFDAGVAGLPDDDAGELPAAVVVLEHGKTMTEKEIVDYVASQVTTAKKLRGGVVFVDEVPKGLTGKLDARKIREILIKAKKGGKIAV (SEQ ID NO.4);

[0020] The amino acid sequence of the A532R T214N mutant is as follows:

[0021] (SEQ ID NO.5).

[0022] The present invention also provides a gene encoding the firefly luciferase mutant, the nucleotide sequence of which is shown in SEQ ID NO.6-8.

[0023] Among them, the nucleotide sequence of the T214N T290P mutant is as follows:

[0024]

[0025] The nucleotide sequence of the T214N K28R mutant is as follows:

[0026]

[0027] The nucleotide sequence of the A532R T214N mutant is as follows:

[0028]

[0029] The present invention also provides a recombinant vector, recombinant bacteria or protein expression host cell containing the above gene.

[0030] Preferably, the recombinant vector is obtained by subjecting a vector containing a codon-optimized Luc gene to site-directed mutagenesis, wherein the site-directed mutagenesis is performed by inverse PCR to change the 214th and 290th threonine codons on the codon-optimized North American firefly luciferase (P. Pyralis luciferase) gene into codons for asparagine and proline, respectively, the 214th and 28th threonine and lysine codons into codons for asparagine and arginine, respectively, or the 214th and 532nd threonine and alanine codons into codons for asparagine and arginine, respectively;

[0031] The recombinant bacteria are obtained by transforming the above-mentioned recombinant vector into Escherichia coli stbl3;

[0032] The protein expression host cell is obtained by transferring the above recombinant vector into 293 cells.

[0033] The present invention also provides the use of the above mutant, the above gene, the above expression vector, recombinant vector, recombinant bacteria or protein expression host cell in the preparation of luciferase detection reagent.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] (1) The present invention starts with rational design (based on consensus sequence and surface amino acid replacement) to transform the molecular structure of firefly luciferase, and obtains a luciferase mutant with improved thermal stability and enzyme activity; the luciferase mutant obtained by the present invention has high luminescence intensity: under the same conditions, the luciferase mutant obtained after the transformation of the present invention has improved luminescence intensity compared with the wild type, showing improved enzyme activity; among them, the enzyme activities of the T214N K28R, A532R T214N, and T214NT290P double-site combination mutants are respectively increased by 1.6, 1.4, and 1.0 times compared with the wild type;

[0036] (2) The luciferase mutants obtained by the present invention have good thermal stability: the enzyme activity of the wild type and codon opt after being bathed at 35°C for 5 minutes is less than 25%, and the luminescence intensity is very weak. T214N T290P, A532R T214N, and T214N K28R still have luminescence intensities of about 89%, 79%, and 74% respectively after being bathed at 35°C for 5 minutes, and T214N T290P still has a luminescence intensity of about 20% after being bathed at 40°C for 5 minutes; under the same measurement conditions, the luminescence intensity of the wild type luciferase drops to less than 3% of the original after being bathed at 35°C for 10 minutes, and the longer the time, the weaker the luminescence intensity. The combined mutants of T214N T290P, T214N K28R, and A532RT214N still have luminescence intensities of about 28%, 13%, and 12% after being bathed at 35°C for 25 minutes. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 A vector map for constructing the firefly luciferase mutant recombinant plasmid of the present invention;

[0038] Figure 2 This is a double restriction enzyme digestion verification diagram of the firefly luciferase mutant recombinant plasmid;

[0039] Figure 3 Schematic diagram of the comparison of luminescence intensity between wild-type firefly luciferase and mutants; WT: wild-type luciferase, codon opt: codon-optimized luciferase;

[0040] Figure 4 The invention compares the thermal stability of the firefly luciferase mutant and the wild type after being exposed to a 35°C metal bath for different time periods; specifically, the wild type firefly luciferase and the modified luciferase are exposed to a 35°C metal bath for 5 minutes, 10 minutes, 15 minutes, 20 minutes, and 25 minutes, respectively, and then placed on ice. After cooling, the luminescence of the luciferase is measured under the same conditions, and the luminescence intensity is compared with that before the metal bath; WT: wild type luciferase, codon opt: codon optimized luciferase, con: blank control;

[0041] Figure 5 The invention compares the thermal stability of the mutant enzyme of the present invention and the wild-type firefly luciferase at different temperatures. Specifically, the wild-type firefly luciferase and the modified luciferase are placed on ice after being placed in a metal bath at 25°C, 30°C, 35°C and 40°C for 5 minutes, and the luminescence of the luciferase after the metal bath is measured under the same conditions after cooling, and the luminescence intensity is compared with that before the metal bath; WT: wild-type luciferase, codon opt: codon-optimized luciferase, con: blank control. DETAILED DESCRIPTION

[0042] In order to make the present invention more clearly understood, preferred embodiments are described in detail below with reference to the accompanying drawings.

[0043] Example 1: Luciferase lactation codon optimization and mutant construction

[0044] 1. Construction of mammalian codon-optimized vectors

[0045] The vector PGL3-basic-Rluc-IRES-MCS was double-digested with XhoI and XbaI, and the North American firefly (P. Pyralis) gene luc on the PGL3-basic vector was synthesized by Sangon Biotech (Shanghai) Co., Ltd. after mammalian codon optimization (SEQ ID NO: 2), double-digested with XhoI and XbaI and ligated to the linear PGL3-basic-Rluc-IRES-MCS vector (from Yoshiman Biotech (Shanghai) Co., Ltd.), named PGL3-basic-Rluc-IRES-Luc (codon opt). The Luc (codon opt) sequence was sequenced using IRES-F, 48256W1F-61161, 48256W2F-61162 and 48256W3F-61163 sequencing primers, and the sequencing was completed by Sangon Biotech (Shanghai) Co., Ltd. The sequencing results showed that the inserted gene sequence of PGL3-basic-Rluc-IRES-Luc (codon opt) was identical to the sequence shown in SEQ ID NO: 2. Enzyme digestion analysis showed that the recombinant vector had the correct length.

[0046] 2. Construction of luciferase double-site combination mutants

[0047] Consensus Finder (http: / / kazlab.umn.edu / ) and GETAREA (http: / / curie.utmb.edu / getarea.html) were used to predict the firefly luciferase mutation sites with improved stability. First, a pair of mutation primers containing homology arms were designed for the mutation point, and then the mutated sequence was amplified by the primers and recombined into a circle using a seamless cloning kit; the recombinant product was transferred into the prepared bacterial competent cells, and the grown monoclonal colonies were sent to a sequencing company for sequencing identification. The correct clone was the successfully constructed vector. The specific steps are as follows:

[0048] Using the PGL3-basic-Rluc-IRES-Luc (codon opt) plasmid as a template, PCR amplification primers were designed, and PCR products were obtained by reverse PCR, and then seamless cloning and connection were performed; the PCR products and the amplification primers used were named as follows:

[0049]

[0050]

[0051] In a specific embodiment of inverse PCR, for example, using the PGL3-basic-Rluc-IRES-Luc(codon opt) plasmid as a template, using Luc(T214N T290P)-F1 and Luc(T214N T290P)-R1 primers to amplify the product Luc(T214N T290P)-PW1, using the PGL3-basic-Rluc-IRES-Luc(codon opt) plasmid as a template, using Luc(T214N T290P)-F2 and Luc(T214N T290P)-R2 primers to amplify the product Luc(T214N T290P)-PW2; using the PGL3-basic-Rluc-IRES-Luc(codon opt) plasmid as a template, using Luc(T214N K28R)-F1 and Luc(T214N K28R)-R1 primers to amplify the product Luc(T214N K28R)-PW1, using PGL3-basic-Rluc-IRES-Luc(codon opt) plasmid as template, using Luc(T214N K28R)-F2 and Luc(T214N K28R)-R2 primers to amplify the product Luc(T214N K28R)-PW2; using PGL3-basic-Rluc-IRES-Luc(codon opt) plasmid as template, using Luc(A532R T214N)-F1 and Luc(A532R T214N)-R1 primers to amplify the product Luc(A532R T214N)-PW1, using PGL3-basic-Rluc-IRES-Luc(codon opt) plasmid as template, using Luc(A532R T214N)-F2 and Luc(A532R T214N)-R2 primers to amplify the product Luc(A532R T214N)-PW2;

[0052] The PCR system was: 10×PCR Buffer for KOD-Plus-Neo 5μL, KOD-Plus-Neo (1.0U / μL) 1μL, 2mM dNTPs 5μL, 25mM MgSO4 3μL, plasmid template 1μL (10ng / μL), primers (10μM each) 1.5μL, ddH2O 29μL. The PCR reaction process was: 1) 94℃ pre-denaturation for 2min; 2) 98℃ denaturation for 10s; 3) 68℃ annealing for 30s; 4) 72℃ extension for 1min; steps 2)-4) were repeated for 29 cycles; 5) 72℃ continued extension for 30s, and cooled to 4℃. The PCR product was recovered by gel.

[0053] Seamless cloning connection: using Hieff clone TM Plus One Step Cloning Kit (from Yeasen) was used to seamlessly clone and connect the PCR products obtained above.

[0054] The ligation reaction system is as follows: 5×CE Buffer 4 μL, PCR product 1 0.5 μL, PCR product 2 0.5 μL, seamless cloning enzyme 2 μL, ddH2O 13 μL, ligated at 50°C for 20 min. Then transformed into Escherichia coli stbl3 strain, coated with LB culture medium plate containing 50 mg / L ampicillin, isolated ampicillin-resistant transformants, extracted plasmids, and judged by plasmid size (about 6863 bp) and double enzyme digestion. In the specific embodiment, PCR products include Luc (T214N T290P) -PW1, Luc (T214NT290P) -PW2, Luc (T214NK28R) -PW1, Luc (T214N K28R) -PW2, Luc (A532R T214N) -PW1, Luc (A532RT214N) -PW2.

[0055] See the gel image for double enzyme digestion identification. Figure 2 ;

[0056] Sequencing: The constructed three double-site combination mutant plasmids were sent to Bio-Tech for sequencing using sequencing primers, and sequencing comparison showed that the target region was correct. PGL3-basic-Rluc-IRES-Luc (codon opt) was sequenced using IRES-F, 48256W1F-61161, 48256W2F-61162 and 48256W3F-61163.

[0057] The three constructed double-site combination mutants were named PGL3-basic-Rluc-IRES-Luc(T214NT290P), PGL3-basic-Rluc-IRES-Luc(T214NK28R), and PGL3-basic-Rluc-IRES-Luc(A532RT214N).

[0058] Wherein, the primer sequences of the above steps are as follows:

[0059] 1) PCR amplification primer sequence

[0060] Luc(T214N T290P)-F1:

[0061] CTGCCCCACCGG AAC GCCTGCGTGCGGTTTAGCC(SEQ ID NO.9);

[0062] Luc(T214N T290P)-R1:

[0063] AAGAAGCTGAACAG GGG GGGGACCAGCAGGGCGGAC(SEQ ID NO.10);

[0064] Luc(T214N T290P)-F2:

[0065] CC CCC CTGTTCAGCTCTTCTCGCCAAGTC (SEQ ID NO. 11);

[0066] Luc(T214N T290P)-R2:

[0067] GTT CCGGTGGGGCAGGGCCAC (SEQ ID NO. 12);

[0068] Luc(T214N K28R)-F1:

[0069] AGCTGCAC AGG GCCATGAAGCGGTACGCCCT(SEQ ID NO.13);

[0070] Luc(T214N K28R)-R1:

[0071] GTT CCGGTGGGGCAGGGCCAC (SEQ ID NO. 14);

[0072] Luc(T214N K28R)-F2:

[0073] CTGCCCCACCGG AAC GCCTGCGTGCGGTTTAGCC(SEQ ID NO.15);

[0074] Luc(T214N K28R)-R2:

[0075] CATGGC CCT GTGCAGCTGCTCGCCG(SEQ ID NO.16);

[0076] Luc(A532R T214N)-F1:

[0077] CCACCGG AAC GCCTGCGTGCGGTTTAGCC(SEQ ID NO.17);

[0078] Luc(A532R T214N)-R1:

[0079] CTAATCTTCCT CCT GTCCAGCTTCCCTGTCAGGC(SEQ ID NO.18);

[0080] Luc(A532R T214N)-F2:

[0081] GGAC AGG AGGAAGATTAGGGAGATCCTGATCAAGG(SEQ ID NO.19);

[0082] Luc(A532R T214N)-R2:

[0083] CAGGC GTT CCGGTGGGGCAGGGCCAC(SEQ ID NO.20).

[0084] 2) Sequencing primer sequences

[0085] IRES-F: TCACCTCAAGCGTATTCAAC(SEQ ID NO.21);

[0086] 48256W1F-61161: GTTGAACAGCATGGGAATCTCC(SEQ ID NO.22);

[0087] 48256W2F-61162: GACTACAAGATCCAGTCCGCC(SEQ ID NO.23);

[0088] 48256W3F-61163: GTGGATAGACTGAAGAGCCTGATC (SEQ ID NO. 24).

[0089] Example 2: HEK-293 cell culture, expression of optimized wild-type luciferase and its mutant gene

[0090] 1. HEK-293 cell culture: It is an anchorage-dependent epithelial-like cell. The growth conditions are DMEM+10FBS+1% P / S. The culture environment is: 95% air+5% carbon dioxide (CO2).

[0091] 2. Plasmid transient cell transfection and expression:

[0092] 1) HEK-293 cell plating: One day before transfection, blank cells in good condition and in the logarithmic growth phase were digested with 0.25% trypsin, suspended into a single cell suspension with complete culture medium, and after cell counting, inoculated into a 24-well culture plate. When the cells grew to 70% to 80%, they were ready for transfection.

[0093] 2) Replace the medium with fresh culture medium 2 hours before transfection. Take a sterile 1.5mL EP tube and use the transfection system as shown in the following table:

[0094] Components quantity opti-MEM 50μL pRL-TK 50ng Target plasmid 500ng HG transgene reagent 1.5 μg

[0095] Among them, internal reference: target plasmid = 1:9;

[0096] Take 2 EP tubes, add 25 μL of opti-MEM to each, add the above plasmid to one EP tube and mix well, add 1.5 μg of HG transgene reagent to the other EP tube and mix well, incubate at room temperature for 5 minutes, mix the two tubes of liquid, leave at room temperature for 15-20 minutes, add dropwise to the culture plate that has been replaced with liquid in advance, and then culture in a CO2 incubator.

[0097] 3) Collect samples for testing 48 hours after transfection.

[0098] 3. Enzyme collection:

[0099] 1) After transfection, take the target cells out of the incubator, gently aspirate the culture medium, and wash twice with PBS.

[0100] 2) Discard PBS and add 100 μL (corresponding to the well plate system) of Cell Lysis buffer to each well.

[0101] 3) After cell lysis, transfer the sample enzyme into an Eppendorf tube and store it in a -80 degree refrigerator.

[0102] Example 3: Activity determination of wild-type firefly luciferase and mutant enzyme ATP standard solution system

[0103] The detection was performed according to the instructions of the reporter gene detection kit (provided by Jiman Biotechnology Co., Ltd.).

[0104] The enzyme solution obtained in Example 2 was centrifuged at 10,000-15,000 rpm for 3-5 min. After centrifugation, the supernatant was transferred to a new EP tube for luciferase detection. 100 μL of luciferase activity assay system (20 μL luciferase, 15 nM luciferin, 40 pM ATP, 200 mM Hepes, 3 mM EDTA, 2 mM MgSO4, pH 7.6) was prepared, and the luminescence intensity was quickly measured using a SpectraMax L chemiluminescence microplate reader.

[0105] The detection method is as follows: 1) Turn on the fluorescence detection according to the instrument manual, set the parameters, the measurement time is 10s, and the measurement interval is 2s. 2) Add the sample to the measuring tube in a volume of 20μL (keep the sample volume consistent each time), and add 20μL Firefly Luciferase Assay Reagent and mix 2-3 times (do not vortex to mix), and measure the RLU (Relative light unit) after sufficient mixing, and set the Cell Lysis buffer as the blank control well. 3) Add 20μL of the prepared Renilla Luciferase Assay working solution to the sample after detection and mix 2-3 times, and measure the RLU after sufficient mixing. 4) Compare the RLU value detected in 2) with the RLU value detected in 3), and determine the fluorescence intensity of the reporter gene by the ratio obtained.

[0106] Conclusion: If Figure 3 The results showed that under the same conditions, the luminescence intensity of the luciferase mutants obtained after the modification of the present invention was improved compared with the wild type, showing an increase in enzyme activity. In some specific embodiments, the enzyme activity of the double-site combination mutants T214N K28R, A532R T214N, and T214N T290P was increased by 1.6, 1.4, and 1.0 times, respectively, compared with the wild type.

[0107] Example 4: Stability evaluation of double-site combination mutants

[0108] 1. Determine the thermal stability of luciferase after different time in 35℃ metal bath:

[0109] Determination method: Take 50 μL of luciferase lysate, place at 35°C for 60 minutes, take out a certain amount of sample every 5 minutes and ice bath for 10 minutes, then measure the enzyme activity at room temperature, measure three times, take the average value and calculate the residual activity of the enzyme. Blank cell lysate is used as a control;

[0110] Conclusion: If Figure 4 The results showed that the luminescence intensity of the wild type and codon opt dropped to less than 3% of the original after 10 minutes, and the luminescence performance was almost lost as the metal bath time increased. However, T214N T290P, T214N K28R, and A532RT214N still had luminescence intensities of about 28%, 13%, and 12% after 25 minutes of metal bath at 35°C, which is of great significance for the use of luciferase in solid phase immunoassays, etc.

[0111] 2. Determination of the thermal stability of firefly luciferase at different temperatures:

[0112] Determination method: The wild-type enzyme and the mutant enzyme were placed in a metal bath at 25°C, 30°C, 35°C, 40°C, and 45°C, respectively, and placed on ice after 5 minutes. The luminescence intensity was measured after 10 minutes to calculate the residual activity. Blank cell lysate was used as a control;

[0113] Conclusion: If Figure 5 As shown, it can be found that the luminescence intensity of wild-type and mutant luciferases decreases with the increase of metal bath temperature. The results show that the luminescence intensity of wild-type and codon opt dropped to less than 25% of the original after 35℃ metal bath, while T214N T290P, T214N K28R, A532R T214N still had about 89%, 74%, and 79% of the original intensity after 5 minutes of 35℃ metal bath, and T214N T290P still had about 20% of the original intensity after 5 minutes of 45℃ metal bath.

[0114] Combined with the above thermal stability analysis results, it can be known that mutating the T of the amino acids at positions 214 and 290 of the North American firefly luciferase to N and P, respectively, mutating the T and K of the amino acids at positions 214 and 28 to N and R, respectively, and mutating the A and T of the amino acids at positions 532 and 214 to R and N, respectively, can effectively improve the thermal stability and activity of the enzyme.

Claims

1. A firefly luciferase mutant, characterized in that: The firefly luciferase is mammalian codon optimized, and the amino acid sequence of the wild-type codon optimized is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2; the mutant is one of the double mutation sites T214N T290P, T214N K28R and A532R T214N; The T214N T290P refers to mutation of the 214th and 290th threonines to asparagine and proline, respectively; The T214N K28R is that the threonine and lysine at positions 214 and 28 are mutated to asparagine and arginine respectively; The A532R T214N is that the threonine and alanine at positions 214 and 532 are mutated to asparagine and arginine respectively; The amino acid sequence of the mutant is shown in SEQ ID NO.3-5.

2. A gene encoding the firefly luciferase mutant according to claim 1, characterized in that: The nucleotide sequences thereof are shown in SEQ ID NO.6-8.

3. A recombinant vector, recombinant bacteria or protein expression host cell containing the gene according to claim 2, wherein the host cell is a non-animal or plant species.

4. The recombinant vector, recombinant bacteria or protein expression host cell according to claim 3, characterized in that: The recombinant vector is obtained by subjecting a vector containing a codon-optimized Luc gene having a nucleotide sequence as shown in SEQ ID NO.2 to site-directed mutagenesis, wherein the site-directed mutagenesis is performed by inverse PCR to change the threonine codons at positions 214 and 290 on the codon-optimized North American firefly luciferase P. Pyralis luciferase gene into codons for asparagine and proline, respectively, the threonine and lysine codons at positions 214 and 28 into codons for asparagine and arginine, respectively, or the threonine and alanine codons at positions 214 and 532 into codons for asparagine and arginine, respectively; The recombinant bacteria are obtained by transforming the above-mentioned recombinant vector into Escherichia coli stbl3; The protein expression host cell is obtained by transferring the above recombinant vector into 293 cells.

5. Use of the mutant according to claim 1, the gene according to claim 2, the recombinant vector, recombinant bacteria or protein expression host cell according to claim 3 in the preparation of a luciferase detection reagent.

Images