A high-temperature resistant Bst DNA polymerase and its preparation method and application
By performing specific amino acid sequence mutations on Bst DNA polymerase, it improves its thermal stability, integrates thermal cleavage and nucleic acid amplification into a reaction tube, solving the problems of nucleic acid contamination and false positives in LAMP technology, and improving the reliability and efficiency of nucleic acid detection.
Patent Information
- Application Number
- CN202310075584.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-07
- Publication Date
- 2025-08-08
- Estimated Expiration
- 2043-02-07
AI Technical Summary
The existing LAMP technology has problems with the risk of nucleic acid contamination and false positive results caused by the separation of thermal cleavage and nucleic acid amplification operations in the field of nucleic acid POCT, and the thermal stability of Bst DNA polymerase is insufficient and cannot maintain enzyme activity at high temperatures.
By performing specific mutations on the amino acid sequence of Bst DNA polymerase, especially at positions 13, 94, 118, 158, 283, 446, and 461, the thermal stability is improved so that it still maintains good DNA polymerase activity at 90°C, and thermal cleavage and nucleic acid amplification are integrated into a reaction tube.
The thermal cleavage and nucleic acid amplification of samples are achieved in one reaction tube, reducing the risk and workload of nucleic acid contamination, improving the reliability and efficiency of LAMP reactions, and is especially suitable for nucleic acid detection and instant nucleic acid detection of complex structural templates.
Smart Images

Figure SMS_1 
Figure HDA0004066000100000011 
Figure HDA0004066000100000012
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and in particular relates to a high-temperature resistant Bst DNA polymerase and a preparation method and application thereof. Background Art
[0002] With the recent development of African swine fever, nucleic acid testing technology has become extremely popular. Nucleic acid testing is also widely used in a variety of other pathogen detection, genetic disease diagnosis, forensic identification, and food pathogen screening. Nucleic acid testing technology is primarily divided into two areas based on application scenarios: PCR, which focuses on laboratory-based confirmatory testing, and isothermal amplification, which is suitable for rapid on-site testing. PCR technology is sensitive and accurate, making it widely used for nucleic acid testing in hospitals, epidemic control centers, and third-party testing agencies. However, PCR requires expensive equipment, is difficult to port, and has high requirements for testing personnel and testing environments, making it unsuitable for rapid on-site testing, clinical bedside testing, and testing in environments with limited hardware. Currently, there is a growing demand for nucleic acid point-of-care (POCT) testing. Fields such as epidemic disease screening, environmental pathogen monitoring, and food pathogen identification require on-site, rapid, and highly sensitive nucleic acid testing technologies. Isothermal amplification technology has been widely adopted in nucleic acid POCT because it does not require large equipment or specialized laboratories and its detection time is only one-third to one-fifth of PCR.
[0003] Isothermal amplification techniques, depending on the principle of nucleic acid amplification, include: nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA), loop-mediated amplification (LAMP), rolling circle amplification (RCA), signal-mediated amplification of RNA technology (SMART), helicase-dependent amplification (HDA), recombinase polymerase amplification (RPA), nicking endonuclease signal amplification (NESA), and nicking endonuclease assisted nanoparticle activation (NENNA). Although multiple isothermal amplification technologies have been proven to be useful for nucleic acid testing, LAMP and RPA technologies are still the most widely used. LAMP technology occupies more than 90% of the nucleic acid POCT market due to its low cost and high amplification efficiency.
[0004] Although LAMP technology has been widely used in nucleic acid point-of-care (POC) testing, it still has certain technical shortcomings. Nucleic acid testing involves two key steps: sample preparation and nucleic acid amplification. However, due to environmental constraints, nucleic acid extraction instruments cannot be used for sample nucleic acid extraction in POC testing. Therefore, heat lysis of viruses or bacteria is typically used to release nucleic acids, which then serve as templates for nucleic acid amplification testing. This two-step process has two drawbacks: 1. Because POC testing environments lack negative pressure, the released nucleic acid molecules can easily form aerosols when the tube cap is opened after thermal lysis and template transfer occurs, resulting in false-positive results in nucleic acid testing; 2. This two-step process increases workload and the risk of contamination. Therefore, if thermal lysis and nucleic acid amplification can be performed in a single reaction tube without opening the cap, both of these issues could be addressed. However, the optimal reaction temperature for the Bst enzyme required for the LAMP reaction is currently 60-65°C; it rapidly inactivates above 70°C, making this goal unattainable. Therefore, significantly improving the thermal stability of the Bst enzyme would be beneficial.
[0005] Bst enzyme is a heat-resistant DNA polymerase from Geobacillus stearothermophilus (formerly known as Bacillus stearothermophilus). It is a critical component of the cellular machinery responsible for DNA replication and repair. Based on amino acid sequence comparisons and protein crystal structure analysis, the DNA polymerase superfamily is divided into seven families: A, B, C, D, X, Y, and RT. Bst enzyme belongs to the DNA polymerase family A and possesses 5'-3' exonuclease activity, DNA polymerase activity, and strand displacement activity. Because exonuclease activity can affect DNA polymerase efficiency, Bst used in LAMP reactions is a truncated fragment of Bst that removes the approximately 300 amino acid exonuclease region at its N-terminus, retaining only the DNA polymerase activity. To improve the amplification efficiency of LAMP reactions, multiple research institutions have attempted to modify Bst enzymes. Although significant progress has been made in modifying Bst DNA polymerase, no research has yet significantly improved its heat resistance. The current LAMP-based nucleic acid point-of-care (POCT) field still requires Bst DNA polymerases with higher temperature tolerance. Summary of the Invention
[0006] The purpose of the present invention is to provide a high-temperature resistant Bst DNA polymerase and a preparation method and application thereof.
[0007] To achieve the above object, the present invention first provides a protein, wherein the protein is obtained by mutating the methionine at position 13 of the Bst DNA polymerase amino acid sequence to leucine, the phenylalanine at position 94 to leucine, the methionine at position 118 to leucine, the alanine at position 158 to proline, the glycine at position 283 to aspartic acid, the proline at position 446 to serine, and the glutamine at position 461 to lysine, while keeping the other amino acid sequences of the Bst DNA polymerase unchanged. The amino acid sequence of the Bst DNA polymerase is shown in Sequence 2 in the sequence table.
[0008] The above protein may be any one of the following proteins (a1) to (a3):
[0009] (a1) a protein consisting of the amino acid sequence shown in Sequence No. 6 in the Sequence Listing;
[0010] (a2) a protein having the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues other than amino acid residues 13, 94, 118, 158, 283, 446 and 461 of the amino acid sequence shown in (a1);
[0011] (a3) A fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in (a1) or (a2).
[0012] In the above (a2), the substitution and / or deletion and / or addition of one or several amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues, or a substitution and / or deletion and / or addition of no more than 9 amino acid residues, or a substitution and / or deletion and / or addition of no more than 8 amino acid residues, or a substitution and / or deletion and / or addition of no more than 7 amino acid residues, or a substitution and / or deletion and / or addition of no more than 6 amino acid residues, or a substitution and / or deletion and / or addition of no more than 5 amino acid residues, or a substitution and / or deletion and / or addition of no more than 4 amino acid residues, or a substitution and / or deletion and / or addition of no more than 3 amino acid residues, or a substitution and / or deletion and / or addition of no more than 2 amino acid residues, or a substitution and / or deletion and / or addition of no more than 1 amino acid residue.
[0013] In (a3) above, the tag refers to a polypeptide or protein that is fused and expressed with the target protein using in vitro DNA recombination technology to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag can be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.
[0014] The protein in (a2) or (a3) above can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically.
[0015] Among any of the aforementioned proteins, the thermal stability of the protein is higher than that of the Bst DNA polymerase (SEQ ID NO: 2), specifically, the protein still has good DNA polymerase activity after being heat-treated at 90° C. for 5 minutes.
[0016] In order to achieve the above object, the present invention further provides a nucleic acid molecule encoding the above protein.
[0017] The nucleic acid molecule encoding the above protein provided by the present invention is a DNA molecule described in any one of the following (b1) to (b3):
[0018] (b1) The nucleotide sequence is the DNA molecule shown in Sequence 5 in the Sequence Listing;
[0019] (b2) a DNA molecule having 75% or more identity with the nucleotide sequence defined in (b1) and encoding the above-mentioned protein;
[0020] (b3) A DNA molecule that hybridizes under stringent conditions to the nucleotide sequence defined in (b1) or (b2) and encodes the above-mentioned protein.
[0021] The nucleic acid molecule may be DNA, such as recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA. The nucleic acid molecule may be a nucleic acid molecule formed by a gene encoding the protein and its regulatory sequence.
[0022] Those skilled in the art can readily mutate the nucleotide sequences encoding the proteins of the present invention using known methods, such as directed evolution and point mutagenesis. Artificially modified nucleotide sequences that share 75% or greater identity with the nucleotide sequences encoding the proteins are derived from and are equivalent to the nucleotide sequences of the present invention, as long as they encode the proteins and have the same function.
[0023] In (b2) above, the identity refers to sequence similarity with a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or greater, 80% or greater, 85% or greater, 90% or greater, or 95% or greater identity to the nucleotide sequence of the protein consisting of the amino acid sequence shown in the coding sequence 6 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.
[0024] The aforementioned 75% or greater identity may be at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 98%, 99% or 100% identity.
[0025] In the above (b3), the stringent conditions may be hybridization in a solution of 2×SSC, 0.1% SDS at 68°C and washing the membrane twice for 5 minutes each time; or hybridization in a solution of 0.5×SSC, 0.1% SDS at 68°C and washing the membrane twice for 15 minutes each time.
[0026] In order to achieve the above object, the present invention further provides a biomaterial as described in any one of the following (c1) to (c3):
[0027] (c1) an expression cassette containing the above nucleic acid molecule;
[0028] (c2) a recombinant vector containing the above nucleic acid molecule;
[0029] (c3) A recombinant bacterium containing the above nucleic acid molecule.
[0030] In (c1) above, the expression cassette refers to DNA capable of expressing the protein in a host cell. The DNA may include not only a promoter for initiating transcription of the protein-encoding gene sequence, but also a terminator for terminating transcription of the protein-encoding gene sequence. Furthermore, the expression cassette may also include an enhancer sequence.
[0031] In (c2) above, the vector may be a plasmid, cosmid, phage or viral vector. The recombinant vector is specifically a vector obtained by replacing the DNA molecule between the NcoI and XhoI restriction sites of the pET26b vector with a nucleic acid molecule encoding the above protein.
[0032] In the above (c3), the recombinant bacteria may be fungi or bacteria containing the above nucleic acid molecule.
[0033] Furthermore, the bacteria may be Escherichia coli. The recombinant bacteria are obtained by introducing a nucleic acid molecule encoding the above protein into Escherichia coli.
[0034] Furthermore, the recombinant bacteria are obtained by introducing the above-mentioned recombinant vector into Escherichia coli.
[0035] The Escherichia coli is Escherichia coli BL21 (DE3).
[0036] In order to achieve the above object, the present invention also provides a method for preparing the above protein.
[0037] The method for preparing the above protein provided by the present invention comprises the following steps: expressing the above nucleic acid molecule in a host bacterium to obtain the above protein.
[0038] Furthermore, the method includes the following steps: fermenting and culturing the above-mentioned recombinant bacteria to obtain the protein.
[0039] Furthermore, the fermentation culture method can be carried out according to the following steps: inoculating the above recombinant bacteria into the culture medium and culturing until the OD 600nm =0.7-0.8, and then IPTG is added for induction culture to obtain a fermentation broth containing the above protein.
[0040] Specifically, the seed culture medium can be LB liquid culture medium containing ampicillin.
[0041] The final concentration of IPTG in the fermentation culture system can be 1 mM.
[0042] The induction culture conditions may be 37° C., 200 rpm (rotation radius of 13 mm) and shaking for 5 hours.
[0043] In order to achieve the above object, the present invention also provides a kit.
[0044] The kit provided by the present invention comprises the above protein.
[0045] Furthermore, the kit may also include other reagents for performing LAMP reaction in addition to DNA polymerase, such as one or more of reaction buffer, dNTPs, water, fluorescent dye, and LAMP primers.
[0046] In order to achieve the above object, the present invention further provides the use of any one of the following (d1) to (d4):
[0047] (d1) Use of the above protein as Bst DNA polymerase;
[0048] (d2) Use of the above nucleic acid molecules or the above biological materials in the preparation of Bst DNA polymerase;
[0049] (d3) Use of the above protein, nucleic acid molecule, biological material, method, or kit in a LAMP reaction;
[0050] (d4) Use of the above protein, nucleic acid molecule, biological material, method or kit in nucleic acid detection.
[0051] In order to achieve the above object, the present invention finally provides the method described in (e1) or (e2):
[0052] (e1) A method for performing a LAMP reaction, comprising the steps of performing a LAMP reaction (such as a fluorescent LAMP reaction or a chromogenic LAMP reaction) using the above protein as a Bst DNA polymerase;
[0053] (e2) A method for nucleic acid detection, comprising the step of performing a LAMP reaction (such as a fluorescent LAMP reaction or a colorimetric LAMP reaction) using the above protein as a Bst DNA polymerase.
[0054] Furthermore, in the method, sample thermal lysis and nucleic acid amplification are completed in one reaction tube.
[0055] Furthermore, the method further comprises the step of thermally cracking the LAMP detection system containing the above protein at 90° C. for 5 minutes and then performing the LAMP reaction.
[0056] Furthermore, the concentration of the above protein in the LAMP detection system can be 1 μg / 25 μL.
[0057] In any of the above applications or methods, the sample in the LAMP reaction or nucleic acid detection may be a bacterial sample (such as an Escherichia coli sample) or a viral sample (such as a hepatitis B virus sample or an African swine fever virus sample).
[0058] The present invention randomly mutated the Bst DNA polymerase gene and screened for a highly thermostable Bst DNA polymerase. Finally, a Bst DNA polymerase mutant strain was successfully screened, whose enzyme activity was consistent with that of natural Bst DNA polymerase and commercial Bst DNA polymerase, but whose thermostable property was greatly improved. The Bst DNA polymerase mutant strain was sequenced to obtain the Bst DNA polymerase mutant Bst-M2. Compared with natural Bst DNA polymerase and commercial Bst DNA polymerase, Bst-M2 has better thermostable properties and still has good DNA polymerase activity after heat treatment at 90°C. It can be used for conventional LAMP reactions, and sample thermal lysis and nucleic acid amplification can be integrated into one reaction tube to achieve a highly integrated one-step LAMP reaction, thereby significantly reducing the risk and workload of nucleic acid contamination. It is particularly suitable for nucleic acid detection of complex structure templates and nucleic acid point-of-care testing (POCT), solving the technical shortcomings of false positives caused by nucleic acid contamination in current nucleic acid POCT. The present invention effectively improves the thermostable properties of Bst DNA polymerase and the performance of Bst DNA polymerase products by optimizing and modifying Bst DNA polymerase. BRIEF DESCRIPTION OF THE DRAWINGS
[0059] Figure 1 Agarose electrophoresis was used to detect the LAMP amplification products of native Bst DNA polymerase and different Bst DNA polymerase mutants.
[0060] Figure 2 To verify the differences in amplification efficiency of commercial Bst DNA polymerase, natural Bst DNA polymerase and three Bst DNA polymerase mutants after pretreatment at different temperatures for fluorescent LAMP.
[0061] Figure 3 To verify the differences in nucleic acid detection sensitivity among commercial Bst DNA polymerase, natural Bst DNA polymerase, and three Bst DNA polymerase mutants for fluorescent LAMP.
[0062] Figure 4 To validate the performance of commercial Bst DNA polymerase and Bst DNA polymerase mutant Bst-M2 for chromogenic LAMP.
[0063] Figure 5 The detection efficiency of commercial Bst DNA polymerase and Bst DNA polymerase mutant Bst-M2 against bacteria was detected by fluorescent LAMP.
[0064] Figure 6Fluorescent LAMP assay was used to detect the virus detection efficiency of commercial Bst DNA polymerase and Bst DNA polymerase mutant Bst-M2. DETAILED DESCRIPTION
[0065] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0066] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0067] Example 1. Screening and obtaining of Bst DNA polymerase mutant genes
[0068] 1. Preparation of Bst DNA polymerase mutant expression strains
[0069] 1. Nanjing GenScript Biotechnology Co., Ltd. synthesized the gene encoding the large fragment of the natural Bst DNA polymerase, minus the exonuclease domain. This gene was optimized to E. coli-adapted codons, and NcoI and XhoI restriction endonuclease sites were added at both ends. The sequence of the gene encoding the large fragment of the synthetic natural Bst DNA polymerase is shown as Sequence 1 in the sequence listing, and the amino acid sequence of the encoded protein is shown as Sequence 2 in the sequence listing.
[0070] 2. Use staggered PCR to introduce random mutations into the gene encoding a large synthetic fragment of natural Bst DNA polymerase to generate a Bst random mutation gene library. This was accomplished using the GeneMorph II Random Mutagenesis Kit (Agilent, Cat. No. 200550). Refer to the kit instructions for the procedure.
[0071] 3. The Bst enzyme random mutation gene library was cloned into the NcoI and XhoI restriction sites of the pET26b vector (Novagen, catalog number TB071) to obtain the pET26b recombinant plasmid cloned with the Bst random mutation gene.
[0072] 4. Transform BL21(DE3) competent E. coli (Full Gold, Catalog No. CD601-02) with the recombinant plasmid containing the randomly mutated Bst gene cloned into the pET26b plasmid. Plate the plates with LB medium containing 50 μg / mL ampicillin (Merck, Catalog No. 69-52-3) and 3.0 g / L lactose (Merck, Catalog No. 63-42-3). Incubate at 30°C for 72 hours. The lactose in the LB medium induces the pET26b recombinant plasmid to express the Bst enzyme mutant protein (recombinant protein). The expressed recombinant protein is initially secreted into the periplasm of the E. coli via the pelB signal peptide in the vector. As the induction time increases, the recombinant protein in the periplasm appears around the colonies.
[0073] 2. Primary screening of thermostable Bst enzyme
[0074] By detecting the Bst enzyme activity around the colonies, the target mutant Bst enzyme expression strain can be screened. The specific steps are as follows:
[0075] 1. Bst DNA polymerase activity assay: Bst DNA polymerase synthesizes DNA using DNA as a template. This assay uses activated calf thymus DNA (MCE, product number 91080-16-9) as a template. α-[ 32 P] labeled dATP (Shanghai Hengyuan Biotechnology, catalog number PN102), during DNA synthesis, α-[ 32 P]-labeled dATP will be incorporated into newly synthesized DNA, and the activity of Bst DNA polymerase can be determined by detecting the radioactivity of the DNA.
[0076] 2. Prepare the reaction system: 20 mM Tris pH 9.0, 10 mM KCl, 10 mM (NH4)2SO4, 2 mM MgCl2, 100 μg / mL calf thymus DNA, 0.2 mM dNTP and 0.5 μCi α-[ 32 P]dATP.
[0077] 3. Cut DE81 filter paper (Whatman, catalog number 3658-917) of the same size as the bacterial culture plate and soak it in the reaction solution prepared in step 2 for 1 hour.
[0078] 4. Take out the soaked filter paper and spread it flat on the E. coli culture dish containing the transformed recombinant plasmid, mark the corresponding positions of the filter paper and the culture dish, and let it stand for 5 minutes.
[0079] 5. Gently remove the filter paper and spread it flat on a glass dish preheated to 90°C. Seal the dish with sealing film to retain moisture in the filter paper and let it sit for 5 minutes. Mutated Bst enzymes with poor thermal stability will lose their enzymatic activity due to high temperatures. Only mutant Bst enzymes with good thermal stability will retain their enzymatic activity. Continue to test their Bst DNA polymerase activity to screen for thermostable mutant Bst enzymes.
[0080] 6. Place the plate in a 65°C water bath and react for 1 hour.
[0081] 7. Open the plate containing the filter paper and place it in a 55°C oven until it is completely dry.
[0082] 8. Rinse the dried filter paper twice with 2×SSC buffer (Merck, catalog number S6630) and air dry.
[0083] 9. Overlap the dried filter paper with Kodak X-OMATBT film, press the film overnight using a film pressing cassette, and process the X-ray film using a developing and fixing kit (Yubo Biological, product number YB0020).
[0084] 10. Find the corresponding bacterial colony according to the luminescent point of the X-ray film, pick the bacterial colony and inoculate it into a 96-well culture plate containing LB medium containing 50 μg / mL ampicillin (Merck, product number 69-52-3), and culture at 37°C until the bacterial solution concentration reaches OD 600nm =0.7-0.8.
[0085] 11. Add isopropyl-β-D-thiogalactoside (IPTG, Merck, Cat. No. 16758) to a final concentration of 0.5 mM and induce at 30°C, 200 rpm (rotation radius of 13 mm) for 24 hours.
[0086] 12. Centrifuge the 96-well culture plate at 5000 g for 10 minutes and collect the supernatant for further screening and identification.
[0087] The results showed that after the recombinant plasmid was transformed into BL21 (DE3) Escherichia coli, an average of about 500 colonies grew in each culture dish. A total of 6,000 culture dishes were transformed, generating approximately 3 million single colonies. Through this round of screening, a total of 67 high-temperature-resistant Bst enzyme mutant strains were obtained.
[0088] 3. Secondary screening and confirmation of thermostable Bst enzyme
[0089] 1. Fluorescent LAMP was used to characterize the enzymatic activity and thermostability of Bst DNA polymerase mutants expressed by 67 thermostable Bst enzyme mutant strains screened. Using African swine fever nucleic acid quality control product (Weiye Measurement, lot number BDS-IQC-1085) as template, a fluorescent LAMP reaction was performed to verify the presence of an amplification curve. African swine fever-specific primers were selected from the local standard "Rapid Detection Method for Isothermal Amplification of African Swine Fever Virus" (standardization: DB21 / T3256-2020). The primer sequences are shown in Table 1. Native Bst enzyme was used as a positive control. Specific reaction systems and conditions are shown in Tables 2 and 3.
[0090] Table 1. LAMP primer sequences
[0091] Primer name Sequence (5′-3′) ASFVF3 ATAGGTAATGCGATCGGATACA ASFVB3 CCAACAATAACCGCCACGC ASFVFIP TAACGCCACTATGCAGCCCACGGAAGAGCTGAATCTCTATCCT ASFVBIP CAACATGTGCGAACTTGTGCCACATACCTGGAACGTCTCC ASFVLF TCGCCACGCAAAGATAAGC ASFVLR AGCCTCGGTGTTGATGCGGATT
[0092] Table 2. Fluorescent LAMP reaction system
[0093] Components Volume (μL) 10× buffer (NEB, catalog number M0538) 2.5 <![CDATA[MgSO4(100mM)]]> 1.5 dNTP (10mM) 3.5 Natural or mutant Bst enzyme 5 Outer primer F3 / B3 (5 μM) 1 Internal primer FIP / BIP (40 μM) 1 Loop primer LF / LB (10 μM) 1 DNA template 5 Fluorescent dye (NEB, product number B1700S) 0.5 pure water 4 Total volume 25
[0094] Table 3. Fluorescence LAMP amplification conditions
[0095] Temperature (℃) time Fluorescence collection 65℃ 25 minutes Fluorescence was collected once every 20 seconds, for a total of 75 times
[0096] Mutants that formed an amplification S-curve in fluorescent PCR and exhibited low LAMP Ct values and high peak heights were selected as candidate variants. The results showed that native Bst enzymes formed an amplification S-curve as determined by fluorescent LAMP, confirming that the Bst expression preparation process was correct. Eight of the 67 Bst mutants formed an amplification S-curve, suggesting that they likely underwent a LAMP reaction.
[0097] Since LAMP reaction will form special ladder-like DNA bands, in order to confirm whether LAMP reaction occurs, agarose electrophoresis was further performed on the amplification products of the natural Bst enzyme control group and 8 mutant Bst groups that can form amplification S curves. Figure 1 As shown in the figure, where M is a molecular weight standard, lane 1 is the native Bst control, and lanes 2-9 are the amplification products of eight mutants. The native Bst formed a ladder-like DNA band, while three of the mutant Bst groups also showed obvious ladder-like DNA bands, indicating that these three mutants can undergo LAMP reactions. They were named Bst-M1, Bst-M2, and Bst-M3, respectively.
[0098] Further gene sequencing analysis of the three Bst mutants revealed multiple point mutations in all three by comparison with the native Bst gene sequence. After removing nonsense mutations, the amino acid mutation sites that led to the Bst-M1 mutant were A15S, F47L, F94L, A158P, G413V, and A489G; the amino acid mutation sites that led to the Bst-M2 mutant were M13L, F94L, M118L, A158P, G283D, P446S, and Q461K; and the amino acid mutation sites that led to the Bst-M3 mutant were E23K, G36C, V93G, A158P, V296M, P446S, and S501C.
[0099] The gene sequence of the Bst-M1 mutant is shown as Sequence 3 in the sequence listing, and the amino acid sequence of the Bst-M1 mutant encoded by it is shown as Sequence 4 in the sequence listing; the gene sequence of the Bst-M2 mutant is shown as Sequence 5 in the sequence listing, and the amino acid sequence of the Bst-M2 mutant encoded by it is shown as Sequence 6 in the sequence listing; the gene sequence of the Bst-M3 mutant is shown as Sequence 7 in the sequence listing, and the amino acid sequence of the Bst-M3 mutant encoded by it is shown as Sequence 8 in the sequence listing.
[0100] Example 2. Preparation and purification of Bst DNA polymerase mutants
[0101] 1. Protein Expression
[0102] 1. Transform BL21(DE3) competent cells with the recombinant plasmids pET26b-Bst, pET26b-Bst-M1, pET26b-Bst-M2, and pET26b-Bst-M3, containing native Bst DNA polymerase and three Bst DNA polymerase mutants, Bst-M1, Bst-M2, and Bst-M3, respectively. Spread the plasmids on LB plates containing 50 μg / mL ampicillin and incubate at 37°C for 15 hours.
[0103] The recombinant plasmid pET26b-Bst is obtained by replacing the DNA molecule between the NcoI and XhoI restriction sites of the pET26b vector with the DNA molecule shown in sequence 1 in the sequence table, while keeping the other sequences of the pET26b vector unchanged.
[0104] The recombinant plasmid pET26b-Bst-M1 is obtained by replacing the DNA molecule between the NcoI and XhoI restriction sites of the pET26b vector with the DNA molecule shown in sequence 3 in the sequence table, while keeping the other sequences of the pET26b vector unchanged.
[0105] The recombinant plasmid pET26b-Bst-M2 is obtained by replacing the DNA molecule between the NcoI and XhoI restriction sites of the pET26b vector with the DNA molecule shown in sequence 5 in the sequence table, while keeping the other sequences of the pET26b vector unchanged.
[0106] The recombinant plasmid pET26b-Bst-M3 is obtained by replacing the DNA molecule between the NcoI and XhoI restriction sites of the pET26b vector with the DNA molecule shown in sequence 7 in the sequence table, while keeping the other sequences of the pET26b vector unchanged.
[0107] 2. Pick a single colony and inoculate it into LB liquid medium containing 50 μg / mL ampicillin, and shake and culture at 37°C, 100 rpm (rotation radius is 13 mm) until the bacterial liquid OD reaches 600nm =0.7-0.8, add IPTG to a final concentration of 1 mM, and induce with shaking at 37°C and 200 rpm (rotation radius of 13 mm) for 5 hours.
[0108] 3. Centrifuge the culture at 5000 g for 10 min, collect the bacterial pellet (induced bacterial cells), suspend it in 30 mM Tris HCl pH 8.0, 20% sucrose, 1 mM EDTA (80 mL per gram of bacterial cells), place it in an ice bath, and gently shake for 10 minutes.
[0109] 4. Centrifuge at 8000g for 10 minutes, collect the cells, remove the supernatant, resuspend the precipitated cells with 5mM MgSO4, place in an ice bath, and shake gently for 10 minutes.
[0110] 5. Centrifuge at 12000g for 15 minutes. The supernatant is the protein solution expressed in the bacterial periplasm (recombinant Bst DNA polymerase protein solution).
[0111] 2. Protein Purification
[0112] Each protein solution prepared in step 1 was purified respectively, and finally four Bst DNA polymerase recombinant proteins were obtained, namely natural Bst DNA polymerase and three Bst DNA polymerase mutants Bst-M1, Bst-M2, and Bst-M3. The specific purification steps are as follows: the prepared bacterial periplasmic space protein solution was diluted 5 times with binding buffer (20mM Tris, 500mM NaCl, 20mM imidazole, pH8.0), and then filtered with a 0.22μm filter (Corning, catalog number CLS431229); an affinity chromatography column HisTrap FF (GELife, catalog number 17-5286-01) was selected for purification, the sample was added to the chromatography column at a rate of 0.3mL / min, and the impurities were washed with washing buffer (20mM Tris, 500mM NaCl, 60mM imidazole, pH8.0); the target protein was eluted with elution buffer (20mM Tris, 500mM NaCl, 200mM imidazole, pH8.0); the target elution peak was collected, and the collected elution peak was passed through HiLoad Superdex The target protein was separated using a 200 molecular sieve chromatography column (GELife, Catalog No. 17-1071-01) at 0.4 mL / min using glycerol-free enzyme storage buffer (10 mM Tris, 50 mM KCl, 0.1 mM EDTA, 0.1% Triton X-100, 1 mM DTT, pH 7.5). The target elution peak was collected and filtered through a 0.22 μm syringe filter (Corning, Catalog No. CLS431229) to obtain the purified recombinant Bst DNA polymerase protein solution. The purified Bst DNA polymerase protein solution was quantified using the BCA assay (ThermoFisher, Catalog No. A53225), mixed with an equal volume of sterile glycerol, and stored at -20°C.
[0113] Example 3, Identification of Bst DNA polymerase mutants
[0114] 1. Enzyme activity determination at different treatment temperatures
[0115] Using African swine fever nucleic acid quality control product (Weiye Measurement, batch number BDS-IQC-1085) as a template, the fluorescent LAMP reaction was used to verify the stability of the natural Bst DNA polymerase prepared in Example 2 (hereinafter referred to as natural Bst enzyme) and three Bst DNA polymerase mutants Bst-M1, Bst-M2, and Bst-M3 (hereinafter referred to as Bst-M1 enzyme, Bst-M2 enzyme, and Bst-M3 enzyme) at different temperatures. Each Bst was set up in 4 groups according to different treatment methods, namely a control group that was not heated, and a test group that was heat-treated at 70°C, 80°C, and 90°C for 5 minutes. The sequences of African swine fever-specific primers are shown in Table 1, and commercial Bst DNA polymerase (NEB, product number M0538, hereinafter referred to as commercial Bst enzyme) was used as a control. The specific reaction system is shown in Table 2, the only difference being that the amount of recombinant Bst enzyme added was modified to 1 μg / reaction. The prepared reaction system was first placed in three different temperature baths for 5 minutes, and then placed in a fluorescent PCR to initiate the LAMP reaction. The reaction conditions are shown in Table 3.
[0116] The results are as follows Figure 2 As shown, the dark blue curve represents Bst-M1, the red curve represents Bst-M2, the green curve represents Bst-M3, the purple curve represents the commercial Bst enzyme, and the light blue curve represents the natural Bst enzyme. As can be seen from the figure, the commercial Bst enzyme, the natural Bst enzyme, and the three Bst enzyme mutants all form distinct S-shaped amplification curves without heat treatment, with similar Ct values and peak heights. The Ct values of the Bst-M2 and Bst-M3 enzymes are the smallest, while those of the commercial Bst enzyme and the natural Bst enzyme are similar. The Ct value of the Bst-M1 enzyme is the largest.
[0117] After heat treatment at 70°C, the five Bst enzymes were still able to achieve LAMP amplification. However, the Ct values of the commercial Bst enzyme, the natural Bst enzyme, and the Bst-M1 enzyme increased significantly, and the peak height of the natural Bst enzyme began to decrease. This suggests that the activity of these three Bst enzymes was affected, with some enzyme activity loss. However, the Ct values of the Bst-M2 and Bst-M3 enzymes did not change significantly, indicating that they have better thermal stability.
[0118] After heat treatment at 80°C, the five groups of Bst enzymes were still able to achieve LAMP amplification, but the Ct values of the commercial Bst enzyme and the natural Bst enzyme increased further, and the peak heights of both became significantly shorter. This suggests that the activity of these two Bst enzymes was severely affected, and most of the enzyme activity was lost. Moreover, the Ct values of the Bst-M1 enzyme and the Bst-M3 enzyme also increased further, and the peak heights began to decrease, suggesting that the enzyme activity of these two Bst enzyme mutants was also significantly affected, while the Bst-M2 enzyme was still able to achieve a good LAMP reaction, with a slightly reduced Ct value (32 to 37) and no change in peak height.
[0119] After heat treatment at 90°C, only three of the five Bst enzyme mutants were able to achieve LAMP amplification. The commercial and natural Bst enzymes no longer had Ct values, indicating that these two Bst enzymes were completely inactivated. Furthermore, although the Bst-M1 and Bst-M3 enzymes amplified, their Ct values were significantly delayed and their peak heights were significantly shorter, suggesting that the enzymatic activity of these two Bst enzyme mutants had also been significantly reduced. However, the Bst-M2 enzyme still achieved a good LAMP reaction, with its Ct value only decreasing from 37 to 45 and its peak height remaining unchanged.
[0120] Therefore, it can be concluded that compared with commercial Bst enzyme, natural Bst enzyme and two other Bst enzyme mutants, Bst-M2 exhibited good thermal stability and still retained most of the enzyme activity after treatment at 90°C for 5 minutes.
[0121] 2. Identification of the Detection Sensitivity of Bst-M2 Mutants
[0122] To confirm whether Bst-M2 enzyme can be used for highly sensitive nucleic acid detection, African swine fever nucleic acid quality control product (Weiye Measurement, batch number BDS-IQC-1085) was used as a template and diluted 10-fold with pure water to obtain concentrations of 10 6 copies / mL, 10 5 copies / mL, 10 4 copies / mL, 10 3 copies / mL, 10 2 The template was expressed at 100 copies / mL. A fluorescent LAMP reaction system was then established using commercial Bst enzyme (NEB, Catalog No. M0538) and Bst-M2 enzyme, respectively. The specific reaction system is shown in Table 2, except that the amount of recombinant Bst-M2 enzyme added was modified to 1 μg / reaction.
[0123] The results are as follows Figure 3 As shown in Figure 2, the minimum detection limits of commercial Bst enzyme and Bst-M2 enzyme both reached 10 3 There was no difference in detection sensitivity between the two enzymes, which proved that Bst-M2 enzyme can be used for high-sensitivity nucleic acid detection based on LAMP technology.
[0124] 3. LAMP colorimetric assay for enzyme activity
[0125] During the LAMP reaction, Bst DNA polymerase polymerizes, changing the number of protons in the system and, consequently, the pH. By adding a pH indicator, nucleic acid amplification results can be identified by observing the color change of the reaction solution. Chromogenic LAMP nucleic acid detection reagents are currently commercially available. To confirm the suitability of the screened Bst-M2 enzyme for the chromogenic LAMP reaction, the enzyme was tested using two different chromogens (red-green and red-yellow) in low-buffer (Magic Vick, Catalog Nos. MV3121 and MV3122). A commercial Bst enzyme (NEB, Catalog No. M0538) was also used as a control. African swine fever nucleic acid quality control (Weiye Measurement, Lot No. BDS-IQC-1085) was used as a template. The sequences of the ASF-specific primers are shown in Table 1, and the reaction system is shown in Table 4. After preparing the reaction system, incubate at 65°C for 30 minutes, observing the color change of the reaction solution in the tube.
[0126] Table 4. Fluorescent LAMP reaction system
[0127] Components Volume (μL) 2 × Low-buffer (article number MV3121 or MV3122) 12.5 Commercial Bst or mutant Bst-M2 enzyme (1 mg / mL) 1 Outer primer F3 / B3 (5 μM) 1 Internal primer FIP / BIP (40 μM) 1 Loop primer LF / LB (10 μM) 1 DNA template 5 pure water 3.5 Total volume 25
[0128] The results are as follows Figure 4 As shown, after amplification, both the commercial Bst enzyme and the Bst-M2 enzyme showed the expected color change, and there was no difference between the two, proving that the Bst-M2 enzyme can be used for colorimetric LAMP reaction.
[0129] Example 4, Application of Bst-M2 DNA Polymerase
[0130] To further confirm whether the screened Bst-M2 enzyme can complete the two reactions of sample thermal lysis and nucleic acid amplification in a single reaction tube, bacteria (Escherichia coli) and viruses (hepatitis B virus) were selected as test samples, and the detection sensitivity differences between the two-step method (separate thermal lysis and nucleic acid amplification) and the one-step method (combined thermal lysis and nucleic acid amplification) were compared. Escherichia coli standard material (Weiye Measurement, catalog number BNCC353719) and hepatitis B virus standard material (Weiye Measurement, catalog number GBW(E)090139) were diluted 10-fold in a 0.9% saline solution, with dilution factors of 10, 100, 1000, 10,000, 100,000, and 1,000,000, respectively. The samples were then divided equally into three groups. The first group was pyrolyzed at 90°C for 5 minutes and then used as templates for the LAMP reaction (two-step method). The second group was used directly as templates for the LAMP reaction, except that the prepared LAMP detection system was pyrolyzed at 90°C for 5 minutes before the LAMP reaction (one-step method). The third group served as a one-step control without pyrolysis. The primer sequences required for the LAMP reaction are shown in Table 5, the reaction system is shown in Table 6, and the reaction conditions are shown in Table 7.
[0131] Table 5. LAMP primer sequences
[0132]
[0133] Table 6. Fluorescence LAMP reaction system
[0134] Components Volume (μL) 10× buffer (NEB, catalog number M0538) 2.5 <![CDATA[MgSO4(100mM)]]> 1.5 dNTP (10mM) 3.5 Bst-M2 enzyme 1 Outer primer F3 / B3 (5 μM) 1 Internal primer FIP / BIP (40 μM) 1 Loop primer LF / LB (10 μM) 1 Bacteria or virus template 5 Fluorescent dye (NEB, product number B1700S) 0.5 pure water 8 Total volume 25
[0135] Table 7. Fluorescence LAMP amplification conditions
[0136] Temperature (℃) time Fluorescence collection 65℃ 25 minutes Fluorescence was collected once every 20 seconds, for a total of 75 times
[0137] The results are as follows Figure 5 and Figure 6 As shown, the one-step and two-step LAMP methods based on the Bst-M2 enzyme achieved consistent minimum detection limits for bacterial and viral samples, with no significant difference in detection sensitivity. However, the one-step method without heat treatment showed a significant decrease in detection efficiency, suggesting that heat treatment effectively cleaves and releases nucleic acids from samples in the one-step reaction tube. These results demonstrate that the Bst-M2 enzyme can be used to establish one-step LAMP technology.
[0138] The above results show that the DNA polymerase mutant Bst-M2 obtained by screening in the present invention has better thermal stability than the natural Bst enzyme and the commercial Bst enzyme, and still has good DNA polymerase activity after heat treatment at 90°C. It can be used for conventional LAMP reactions. At the same time, the sample thermal lysis and nucleic acid amplification can be integrated into one reaction tube to achieve a highly integrated one-step LAMP reaction, thereby greatly reducing the risk of nucleic acid contamination and workload. It is particularly suitable for nucleic acid POCT detection, solving the technical shortcomings of false positives caused by nucleic acid contamination in current nucleic acid POCT.
[0139] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In short, according to the principles of the present invention, this application precludes any variations, uses, or improvements to the present invention, including modifications made by conventional techniques known in the art that depart from the scope disclosed herein. Applications of the essential features may be made within the scope of the following claims.
Claims
1. A protein, wherein the methionine at position 13 of the amino acid sequence of Bst DNA polymerase is mutated to leucine, the phenylalanine at position 94 is mutated to leucine, the methionine at position 118 is mutated to leucine, the alanine at position 158 is mutated to proline, the glycine at position 283 is mutated to aspartic acid, the proline at position 446 is mutated to serine, and the glutamine at position 461 is mutated to lysine, while keeping the other amino acid sequences of the Bst DNA polymerase unchanged; The protein is as follows (a1) or (a2): (a1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 6 in the sequence listing; (a2) A fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in (a1).
2. A nucleic acid molecule encoding the protein of claim 1.
3. The nucleic acid molecule according to claim 2, characterized in that: The nucleic acid molecule is a DNA molecule whose nucleotide sequence is shown as Sequence 5 in the sequence table.
4. The biomaterial described in any one of the following (c1) to (c3): (c1) an expression cassette containing the nucleic acid molecule according to claim 2 or 3; (c2) a recombinant vector containing the nucleic acid molecule according to claim 2 or 3; (c3) A recombinant bacterium containing the nucleic acid molecule according to claim 2 or 3.
5. The biomaterial according to claim 4, characterized in that: The recombinant vector is a vector obtained by replacing the DNA molecule between the NcoI and XhoI restriction sites of the pET26b vector with a nucleic acid molecule encoding the protein according to claim 1.
6. A method for preparing the protein of claim 1, comprising the steps of expressing the nucleic acid molecule of claim 2 or 3 in a host bacterium to obtain the protein of claim 1.
7. A kit comprising the protein of claim 1.
8. The use of any one of the following (d1) to (d4): (d1) Use of the protein according to claim 1 as Bst DNA polymerase; (d2) Use of the nucleic acid molecule according to claim 2 or 3 or the biological material according to claim 4 or 5 in the preparation of Bst DNA polymerase; (d3) Use of the protein according to claim 1, the nucleic acid molecule according to claim 2 or 3, the biological material according to claim 4 or 5, the method according to claim 6, or the kit according to claim 7 in performing a LAMP reaction; (d4) Use of the protein according to claim 1, the nucleic acid molecule according to claim 2 or 3, the biological material according to claim 3 or 4, the method according to claim 6, or the kit according to claim 7 in nucleic acid detection; The applications are not for the purpose of disease diagnosis and treatment.
9. The method described in (e1) or (e2) below: (e1) A method for performing a LAMP reaction, comprising the step of performing a LAMP reaction using the protein of claim 1 as a BstDNA polymerase; (e2) A method for nucleic acid detection, comprising the step of performing a LAMP reaction using the protein of claim 1 as a Bst DNA polymerase; The method is not intended for disease diagnosis or treatment.
Citation Information
Patent Citations
Fusion DNA polymerase mutant and application thereof in isothermal amplification
CN113637085A
DNA polymerases
US8993298B1