A novel genome editing tool EbCas12a-D141R and its application in gene editing
By developing the EbCas12a-D141R variant, the problem of low editing efficiency of Cas12a system in eukaryotic cells was solved, a more efficient and simplified gene editing process was achieved, and the application scope of gene editing tools was expanded, which was suitable for basic scientific research and clinical treatment.
Patent Information
- Application Number
- CN202211369239.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-03
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2042-11-03
AI Technical Summary
The existing Cas12a system has shortcomings in gene editing efficiency and target recognition, especially in eukaryotic cells, which are not as good as the Cas9 system, and the processing complexity of guide RNA is high.
A variant of EbCas12a-D141R, a type II V-type CRISPR protein, was developed to improve its gene editing efficiency by introducing specific amino acid sequences into eukaryotic cells and simplifying the processing of guide RNA.
EbCas12a-D141R exhibits significantly improved gene editing efficiency in eukaryotic cells, expands the variety of gene editing tools, provides more efficient and safer gene editing options, suitable for basic scientific research and clinical treatment.
Smart Images

Figure CN115896070B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine, and particularly relates to a variant EbCas12a-D141R of class II type V CRISPR protein EbCas12a and its application in gene editing. Background Art
[0002] Since 2013, gene editing technology has made breakthrough progress, and this technology has caused new changes in many fields such as basic scientific research, medicine, clinical practice, and biotechnology. In addition to the representative Cas9 system, Cas12, also known as Cpf1, as another newly discovered member of the CRISPR system with gene editing effects, has greatly expanded the editable range of targets of the gene editing system. Compared with the Cas9 system, the function of Cas12a to process precursor RNA provides it with a more convenient and efficient editing ability for mediating multi-gene editing. In addition, compared with the guide RNA of Cas9, the guide RNA of Cas12a has a simpler composition and is more convenient to design.
[0003] In 2015, the Zhang Feng team first discovered another new member with gene editing ability besides the Cas9 system, Cas12a, also known as Cpf1, and classified it into class 2 type V of the CRISPR system. Compared with the Cas9 system, the editing efficiency of Cas12a is equivalent to that of Cas9, and is lower than Cas9 at some targets. The off-target rate of Cas12a is extremely low. Compared with the high off-target rate of Cas9, Cas12a is a safe gene editing tool. Cas12a forms sticky ends after cleavage, while Cas9 forms blunt ends. Existing studies have shown that the sticky ends formed after Cas12a cleavage are more likely to undergo homologous recombination repair than the blunt ends of Cas9, which also provides a better tool for site-directed insertion and repair of genes. In terms of the processing of guide RNA, Cas12a has obvious advantages. It only needs Cas12a itself to complete the processing of precursor RNA, while the Cas9 system requires the processing of RNaseIII, which greatly promotes the application of Cas12a in multi-gene editing. In the recognition of PAM, Cas12a recognizes 5’-TTTN-3’ or 5’-KYTV-3’, while Cas9 recognizes 5’-NGG-3’.
[0004] Therefore, as a new type of gene editing tool, Cas12a, together with the Cas9 system, provides a powerful tool for scientific research and disease treatment. Based on the existing research on Cas12a, it is of great significance to transform the smaller and more compact Cas12a system to improve the editing efficiency to cope with gene editing events in various future situations. Summary of the Invention
[0005] Aiming at the deficiencies of the prior art, the present invention aims to provide an application of a compact editing tool, namely a variant EbCas12a-D141R of the smaller Cas12a homologous protein EbCas12a, in gene editing.
[0006] To achieve the above-mentioned invention purpose, the technical solution adopted by the present invention is as follows:
[0007] A variant EbCas12a-D141R protein of the type II V CRISPR protein EbCas12a, whose amino acid sequence is shown in SED ID NO.1. Among them, EbCas12a comes from the Erysipelotrichia bacterium, and the PAM sequence recognized by EbCas12a is mainly TTTV, and it can also weakly recognize TCTA, TTCA or CTTA, where V represents A, C, or G; EbCas12a has DNA cleavage ability and can perform site-directed gene editing on in vitro DNA and in vivo genomes. And the gene editing efficiency of EbCas12a-D141R is significantly higher than that of EbCas12a.
[0008] The sequence used by EbCas12a-D141R in eukaryotic cells is shown in SED ID NO.2.
[0009] The above-mentioned EbCas12a-D141R has DNA cleavage ability and can perform site-directed gene editing on in vitro DNA and in vivo genomes.
[0010] The application of the above-mentioned EbCas12a-D141R in gene editing. The gene editing includes in vitro gene editing, prokaryotic gene editing, and eukaryotic gene editing. In prokaryotic gene editing, the amino acid sequence of EbCas12a-D141R is shown in SED ID NO.1; in eukaryotic gene editing, the amino acid sequence of EbCas12a-D141R is shown in SED ID NO.2.
[0011] The amino acid sequence of the protein EbCas12a-D141R of the present invention is as follows:
[0012] The protein sequence of EbCas12a-D141R itself (SED ID NO.1):
[0013]
[0014] The sequence used by EbCas12a-D141R in eukaryotic cells (SED ID NO.2):
[0015]
[0016] For the sequences used in eukaryotic cells, the KRPAATKKAGQAKKKK sequence (this sequence is the C-terminal NLS nuclear localization sequence) is added to the C-terminus of the amino acid sequence of the EbCas12a-D141R protein, and then the YPYDVPDYAYPYDVPDYAYPYDVPDYA sequence (this sequence is the 3HA sequence) is linked with the GS sequence.
[0017] Advantages of the present invention: Based on the smaller class II type V CRISPR protein EbCas12a (1158 AA), the present invention obtains a variant EbCas12a-D141R with higher editing efficiency; the gene editing efficiency of the variant EbCas12a-D141R in eukaryotic cells is significantly higher than that of EbCas12a. The discovery of EbCas12a-D141R further expands the types of gene editing tools, and also provides an important alternative tool for gene editing in various subsequent situations, which has a very important role in basic scientific research and clinical treatment. Description of the Drawings
[0018] Figure 1 It is a diagram of the CRISPR array and crRNA direct repeat of the Erysipelotrichia bacterium strain.
[0019] Figure 2 It is an in vitro cleavage experiment after prokaryotic expression of EbCas12a, where S represents substrate and P represents product.
[0020] Figure 3 It is to verify the PAM of EbCas12a in vitro experiments.
[0021] Figure 4 It is to verify the gene editing of EbCas12a in vivo.
[0022] Figure 5 It is the editing efficiency of EbCas12a-D141R and EbCas12a on the exogenous gene EGFP in cells. In the figure, con is the control group.
[0023] Figure 6 It is the editing efficiency of EbCas12a-D141R and EbCas12a on endogenous genes in cells.
[0024] Figure 7 It is the deep sequencing after editing of the endogenous gene editing target of EbCas12a-D141R and EbCas12a in cells. Detailed Embodiments
[0025] To better understand the present invention, the content of the present invention will be further clarified below in conjunction with embodiments. However, the content of the present invention is not limited to the following embodiments only.
[0026] Example 1
[0027] In vitro different time gradient and different PAM cleavage experiments of EbCas12a, including the following experimental steps:
[0028] (1) Expression and purification of EbCas12a protein: The EbCas12a gene sequence (as follows) was synthesized into the pet28a expression vector (restriction enzyme sites NcoI and XhoI), with a 6His tag at the C-terminus. Subsequently, the synthesized plasmid was transformed into the E. Coli Rosseta 2(DE3) expression strain. Single colonies were picked, and after small-scale expression detection to confirm protein expression, large-scale expression and purification of the protein were carried out. The recombinant protein was successively purified by Ni column affinity chromatography, heparin column chromatography, and superdex 200 molecular sieve, and then stored in buffer (10 mM Tris-HCl, 200 mM NaCl, 1 mM MgCl) and frozen at -80 °C for later use.
[0029] Gene sequence of EbCas12a (SED ID NO.3):
[0030]
[0031] (2) The crRNA direct repeat sequence used is: 5’-AATTTCTACTGTTGTAGAT-3’, and crRNA targeting the EGFP gene is obtained by in vitro transcription; the EbCas12a protein obtained in step (1) and the crRNA are mixed at a molar ratio of 1:1 to obtain an EbCas12a-crRNA complex.
[0032] (3) Take 100 nM of the EbCas12a-crRNA complex and mix it with 300 ng of the linearized substrate (the PAM is TTTA, and the fragment uses the ptriEx-EGFP plasmid (constructed with the EGFP gene using the ptriEx vector as the backbone) as a template, and upstream and downstream primers are designed for PCR to amplify a 1.1 kb substrate fragment. There is a PAM sequence of TTTA on this fragment, and the target sequence of the spacer is CGTCGCCGTCCAGCTCGACCAGG. The Cas12a-crRNA binary complex can recognize this target and cleave the 1.1 kb substrate into products with lengths of 0.4 kb and 0.7 kb respectively.) After mixing and incubating at 37°C for 0, 2.5, 5, 8, 10, 15 min respectively, add an appropriate amount of proteinase K, digest at 58°C for 60 min, and run a 2% agarose gel. Select some different PAMs (the PAM sequences are shown in Figure 2 , and the substrate is the same as above, only the four bases at the PAM are different) and perform the above cleavage experiments respectively. The results are as Figure 2 shown, and EbCas12a has good in vitro cleavage ability.
[0033] Example 2
[0034] Determination of the PAM recognized by EbCas12a
[0035] (1) Design upstream and downstream primers with random combinations at four positions of NNNN (N represents A, G, C, T), use the ptriEx-EGFP plasmid as a template, and perform PCR by the overlap PCR method to obtain 256 linearized substrates with different PAM sequences but the same spacer sequence and a length of 300 bp.
[0036] (2) Take 100 nM of the EbCas12a-crRNA complex in Example 1 and mix it with 300 ng of the linearized substrate. After incubating at 37°C for 10 min respectively, perform PCR amplification on the uncleaved substrate for second-generation sequencing. The results are as Figure 3 shown, and EbCas12a can recognize different PAMs: TTTV, TCTA, TTCA, CTTA, but the optimal PAM is TTTV (V represents A, C, or G).
[0037] Example 3
[0038] Editing of different genes by EbCas12a in mammalian cells:
[0039] (1) Construction of eukaryotic expression plasmid of EbCas12a: The EbCas12a gene sequence used in eukaryotic cells was constructed onto the eukaryotic expression plasmid pcDNA3.1. The EbCas12a gene sequence used in eukaryotic cells is as follows (SED ID NO.4):
[0040]
[0041]
[0042] The sequence marked with "_" is the C-terminal nuclear localization sequence NLS, the sequence marked is the GS link, and the sequence marked is the 3HA tag.
[0043] (2) In mammalian cells, taking 293T cells as an example, seven gene targets of CLIC-4, VEGFA-2, PD1, DNMT1-4, TRAC, TRBC, and TAX1BP3 were selected. Taking these seven genes as targets respectively, 7 eukaryotic expression plasmids of U6-crRNA spacer transcribed by the U6 promoter (the vector backbone is pU6-As-crRNA, Addgene: #78956) were constructed. The crRNA transcription sequences of the seven gene targets (where AATTTCTACTGTTGTAGAT is the direct repeat) are as follows respectively:
[0044] AATTTCTACTGTTGTAGAT CCCTGGCTACCTCCCCTACC (targeting CLIC-4),
[0045] AATTTCTACTGTTGTAGAT GGAGGTCAGAAATAGGGGGTCCA (targeting VEGFA-2),
[0046] AATTTCTACTGTTGTAGAT GCACGAAGCTCTCCGATGTGTTG (targeting PD1),
[0047] AATTTCTACTGTTGTAGAT GCTCAGCAGGCACCTGCCTCAGC (targeting DNMT1-4),
[0048] AATTTCTACTGTTGTAGAT TTGCTCCAGGCCACAGCACTGTT (targeting TRAC),
[0049] AATTTCTACTGTTGTAGAT AGCCATCAGAAGCAGAGATCTCC (targeting TRBC),
[0050] AATTTCTACTGTTGTAGAT CACATAGGCCATTCAGAAAC (targeting TAX1BP3).
[0051] (3) Design surveyor primers near the cleavage targets of these seven genes respectively, and verify the specificity of the PCR primers.
[0052] (4) Digest 293T cells, seed them in a 24-well plate at an appropriate concentration, 500 μL per well.
[0053] (5) Co-transfect the eukaryotic expression plasmid of EbCas12a (700 ng) and the eukaryotic expression plasmid of U6-crRNA spacer (300 ng) into the 24-well plate. After 48 h, lyse the cells, take 1 μL of the lysate as a template, and perform PCR with the surveyor primers designed in step (3), and purify the PCR products.
[0054] (6) Mix 300 ng of the PCR product with 1 μL of 10×T7EI buffer, and perform the following PCR program for renaturation: 95°C for 10 min, from 95°C to 85°C at -2°C for 2 s, from 85°C to 25°C at -0.25°C for 2 s, hold at 25°C for 1 min. After renaturation, add 1 μL of T7EI to the product, digest at 37°C for 20 min, and run on a 2% agarose gel. The results are as Figure 4 shown that gene editing can be performed on CLIC-4, VEGFA-2, PD1, DNMT1-4, TRAC, TRBC, TAX1BP3, and the editing efficiencies are 9%, 17%, 32%, 16%, 8%, 7%, 6% respectively (the seven genes in this example are only listed as representatives).
[0055] Example 4
[0056] Cleavage of the exogenous gene EGFP in cells by EbCas12a-D141R and EbCas12a, including the following experimental steps:
[0057] Select the EGFP gene for intracellular cleavage of exogenous genes, and the selected target sequence is TTTACGTCGCCGTCCAGCTCGACCAGG, in the form of co - transfection of the EGFP expression plasmid (pcDNA3.1 - EGFP) and the Cas12a expression plasmids pcDNA3.1 - Cas12a (EbCas12a - D141R and EbCas12a) expression plasmids. In 293T cells, the Cas12a expression plasmid, the crRNA expression plasmid (vector backbone is pU6 - As - crRNA, Addgene:#78956; transcription sequence is AATTTCTACTGTTGTAGAT CGTCGCCGTCCAGCTCGACCAGG) and the EGFP expression plasmid (pcDNA3.1 - EGFP) were co - transfected simultaneously. The 96 - well plate was selected as the culture dish, and in the control group, only the Cas12a expression plasmid and the EGFP expression plasmid were transfected. 48 hours after cell transfection, the cells were digested with trypsin and collected, and the cells were resuspended with 200 μL of PBS for flow cytometry analysis. The results are as Figure 5 shown, and the efficiency of EbCas12a - D141R in cleaving foreign genes is significantly higher than that of EbCas12a.
[0058] Among them, the gene sequence of EbCas12a is the same as that in Example 3; compared with EbCas12a, EbCas12a - D141R only mutates D at position 141 to R, that is, changes GAC encoding D in the sequence to CGC encoding R.
[0059] Example 5
[0060] Comparison of the gene editing efficiency of EbCas12a - D141R and EbCas12a on endogenous genes in cells:
[0061] (1) The eukaryotic expression plasmids of EbCas12a - D141R and EbCas12a are the same as in Example 4, and the vector is pcDNA3.1.
[0062] (2) In mammalian cells, taking 293T cells as an example, three gene targets of TAX1BP3, site5, and TRAC were selected. Taking these three genes as targets respectively, three eukaryotic expression plasmids of U6 - crRNA spacer transcribed by the U6 promoter (vector backbone is pU6 - As - crRNA, Addgene:#78956) were constructed. The crRNA transcription sequences of the three gene targets (where AATTTCTACTGTTGTAGAT is direct repeat) are as follows:
[0063] AATTTCTACTGTTGTAGAT CACATAGGCCATTCAGAAAC (targeting TAX1BP3),
[0064] AATTTCTACTGTTGTAGATTGATGGTCCATACCTGTTAC (targeting site5),
[0065] AATTTCTACTGTTGTAGAT TTGCTCCAGGCCACAGCACTGTT (targeting TRAC).
[0066] (3) Design surveyor primers near the cleavage targets of these three genes respectively, and verify the specificity of the PCR primers.
[0067] (4) Digest 293T cells, seed them in a 24-well plate at an appropriate concentration, 500 μL per well.
[0068] (5) Co-transfect the eukaryotic expression plasmids of EbCas12a-D141R and EbCas12a (700 ng) and the eukaryotic expression plasmid of U6-crRNA spacer (300 ng) into the 24-well plate respectively. After 48 h, lyse the cells, take 1 μL of the lysate as a template, and perform PCR with the surveyor primers designed in step (3), and purify the PCR products.
[0069] (6) Mix 300 ng of the PCR product with 1 μL of 10×T7EI buffer, and perform renaturation according to the following PCR program: 95°C for 10 min, from 95°C to 85°C at -2°C for 2 s, from 85°C to 25°C at -0.25°C for 2 s, hold at 25°C for 1 min. After renaturation, add 1 μL of T7EI to the product, digest at 37°C for 20 min, and run on a 2% agarose gel. The results are as Figure 6 shown. The editing efficiency of EbCas12a-D141R at the three gene targets of TAX1BP3, site5, and TRAC is significantly higher than that of EbCas12a (the three genes in this example are only listed as representatives).
[0070] Example 6
[0071] Deep sequencing of EbCas12a-D141R and EbCas12a after editing at the endogenous gene editing targets in cells:
[0072] Targeted deep sequencing is one of the main methods to verify gene editing efficiency currently. After co-transfecting 293T cells with pcDNA3.1-Cas12a (EbCas12a-D141R and EbCas12a) expression plasmid and U6-crRNA spacer eukaryotic expression plasmid for 48 h, cells were collected and genomic DNA was extracted. Fragments within 300 bp upstream and downstream of the target sites (B2M, CTLA4) were amplified by PCR, and then the samples were sent to the company for library construction and sequencing. The editing efficiency of EbCas12a-D141R and EbCas12a target sites was determined by analyzing the insertion and deletion conditions of the target sites. The results are as Figure 7 shown. The editing efficiency of EbCas12a-D141R at two gene target sites was significantly higher than that of EbCas12a (the two genes in this example are only listed as representatives).
Claims
1. A variant EbCas12a-D141R of class II type V CRISPR protein EbCas12a, characterized in that, The amino acid sequence of the said EbCas12a-D141R is shown in SED ID NO.
1.
2. The variant EbCas12a-D141R according to claim 1, characterized in that, The sequence used by the said EbCas12a-D141R in eukaryotic cells is shown in SED ID NO.
2.
3. Use of the variant EbCas12a-D141R according to claim 1 or 2 in gene editing, characterized in that: The said gene editing includes in vitro gene editing, prokaryotic gene editing, and eukaryotic gene editing.
4. The application according to claim 3, wherein: In prokaryotic gene editing, the amino acid sequence of EbCas12a-D141R is shown in SED ID NO.
1.
5. The application according to claim 3, wherein: In eukaryotic gene editing, the amino acid sequence of EbCas12a-D141R is shown in SED ID NO. 2.
Citation Information
Patent Citations
Class II V-type CRISPR protein BfCas12a and application thereof in gene editing
CN110878290A
Class II type V CRISPR protein CeCas12a and application thereof in gene editing
CN111235130A
Class II V-type CRISPR protein Lb2Cas12a and application thereof in gene editing
CN111394337A
Application of compact editing tool EbCas12a in gene editing
CN115786305A