Adeno-associated virus mutants and uses thereof

Abstract

The application provides an adeno-associated virus mutant and application thereof, and the coat protein of the adeno-associated virus mutant comprises an amino acid sequence shown in SEQ ID NO: 1-5, or an amino acid sequence with more than 98% identity with SEQ ID NO: 1-5 and having the same or similar biological function. The application constructs an adeno-associated virus library by splicing and recombining a coat protein coding gene of a wild type adeno-associated virus, and obtains the adeno-associated virus mutant by screening with neutralizing antibodies against AAV coat proteins, the adeno-associated virus mutant has strong infection ability on human liver cells and can avoid the neutralization of neutralizing antibodies, and thus the technical obstacles existing in the field of hemophilia treatment are solved in a targeted manner.

Description

[0001] This application is a divisional application of patent application No. 202010442092.4 (the original application has an application date of May 22, 2020 and the title of the invention is Adeno-Associated Virus Mutant and Application Thereof). TECHNICAL FIELD

[0002] The present application belongs to the field of genetic engineering and bioengineering, and relates to an adeno-associated virus mutant and application thereof. BACKGROUND

[0003] In recent years, adeno-associated virus (AAV) has been used as a gene therapy carrier in the clinical treatment of various genetic deficiency diseases, such as hemophilia B, DMD progressive muscle atrophy, SMA motor disorders, etc., and has achieved exciting results. In particular, the successful application of AAV in the treatment of hemophilia is expected to save thousands of patients who are ineffective for conventional treatment methods. It has been reported that after injection of AAV carrying the nine-factor gene, hemophilia patients did not show serious immune reactions, and the damage to the liver by AAV was also transient; after injection of AAV, the level of nine-factor in the peripheral blood of patients returned to about 10% of the normal level, and long-term stable expression, basically free from dependence on nine-factor recombinant protein. For hemophilia A caused by the absence of eight-factor, preliminary clinical experiments are being conducted. However, the gene encoding coagulation factor VIII is relatively long, about 4.5 kbp, plus the promoter and termination sequence, the total gene length has exceeded the packaging range of AAV, which is the main obstacle encountered by AAV gene therapy method in the treatment of hemophilia A, and is also the current research hotspot.

[0004] However, there are also some limitations in the application of AAV gene therapy method in the treatment of hemophilia. One of them is that there is a certain proportion of anti-AAV coat protein neutralizing antibodies in the peripheral blood of normal people and hemophilia patients, so before evaluating whether the patient can undergo AAV gene therapy, it is necessary to first detect whether there are neutralizing antibodies in the peripheral blood. If the patient has anti-AAV neutralizing antibodies in the body, it is not suitable for AAV gene therapy. Considering that the AAV gene therapy method is a hemophilia treatment method with broad prospects, it is particularly important to help AAV avoid the clearance of neutralizing antibodies in the body.

[0005] To solve this problem, researchers have proposed a variety of methods, including empty shell protein neutralization method, immunosuppressant pretreatment method, small fragment DNA neutralization method, AAV shell protein mutation method, etc. The empty shell protein neutralization method refers to mixing a large amount of AAV empty shell protein when injecting AAV, so as to offset the pressure of AAV being cleared by the body neutralizing antibody, thereby increasing the infection efficiency. However, studies have found that AAV empty shell protein is more easily presented by antigen presenting cells, triggering a strong T cell immune response, enhancing the T cell clearance effect of AAV, and ultimately leading to a lower AAV transduction efficiency. The immunosuppressant pretreatment method refers to injecting an appropriate amount of immunosuppressant, such as dexamethasone, into the patient before injecting AAV. Although this method can improve the transduction efficiency of AAV to a certain extent, the improvement is limited, because dexamethasone inhibits immunity in a broad manner and cannot specifically eliminate neutralizing antibodies against AAV and T / B cells that recognize AAV. The small fragment DNA neutralization method refers to using small fragment DNA that can specifically block AAV neutralizing antibodies, which has a good application prospect, but no related clinical application reports have been reported. The AAV shell protein mutation method refers to mutating some sites in the amino acid sequence of the AAV shell protein recognized by the neutralizing antibody, reducing the recognition ability of the neutralizing antibody to AAV, thereby avoiding the clearance effect of the neutralizing antibody. At present, there are a large number of research reports, but the reasons and ways to avoid neutralizing antibodies cannot be explained.

[0006] Therefore, it is of great significance and broad application prospect to modify AAV to avoid the clearance of neutralizing antibodies in the body and improve the application range of AAV in the field of gene defect disease treatment. SUMMARY

[0007] In view of the deficiencies of the prior art and actual needs, the present application provides an adeno-associated virus mutant and its application, which has strong infection ability to human liver cells and can avoid the neutralization effect of neutralizing antibodies, and solves the problem of hemophilia patients with anti-AAV neutralizing antibodies who encounter obstacles when receiving gene therapy.

[0008] To achieve this purpose, the technical scheme adopted by the present application is as follows:

[0009] In a first aspect, the present application provides an adeno-associated virus mutant, wherein the shell protein of the adeno-associated virus mutant comprises the amino acid sequence shown in SEQ ID NO: 1-5.

[0010] SEQ ID NO: 1:

[0011] MAADGYLPDWLEDTLSEGIRQWWKLKPGAPKPKANQQKQDDGRGLVLPGYKYLGPFNGLDKGEPVNAADAAALEHDKAYDQQLKAGDNPYLRYNHADAEFQERLQEDTSFGGNLGRAVFQAKKRLLEPLGLVEEAAKTAPGKKRPVEQSPQEPDSSAGIGKSGAQPAKKRLNFGQTGGTESVPDPQPLGEPPAAPSGVGPNTMAAGGGAPMADNNEGADGVGSSSGNWHCDSTWLGDRVITTSTRTWALPTYNNHLYKQISSASTGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLSFKLFNIQVKEVTQNEGTKTIANNLTSTIQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMIPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFQFTYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTQTTGGTANTQTLGFSQGGPNTMANQAKNWLPGPCYRQQRVSTTTGQNNNSNFAWTAGTKYHLNGRNSLANPGIAMATHKDDKERFFPSNGILIFGKQNAARDNADYSDVMLTSEEEIKTTNPVATEEYGIVADNLQQQNTAPQIGTVNSQGALPGMVWQNRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGLKHPPPQILIKNTPVPADPPTTFNQSKLNSFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYYKSTSVDFAVNTEGVYSEPHPIGTRYLTRPL;

[0012] SEQ ID NO: 2:

[0013] MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEGAKTAPGKKRPVEQSPQEPDSSAGIGKSGAQPAKKRLNFGQTGDSESVPDPQPLGEPPAAPSGVGPNTMASGGGAPVADNNEGADGVGSSSGNWHCDSQWLGDRVITTSTRTWALPTYNNHLYKQISSASTGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTDNNGVKTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMIPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFQFTYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTQTTGGTANTQTLGFSQGGPNTMANQAKNWLPGPCYRQQRVSTTTGQNNNSNFAWTAGTKYNLNGRNSLANPGIAMASHKDDKERFFPSNGILIFGKQNAARDNADYSDVMLTSEEEIKTTNPVATEEYGIVADNLQQQNTAPQIGTVNSQGALPGMVWQNRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGLKHPPPQILIKNTPVPADPPTTFNQSKLNSFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYYKSTSVDFAVNTEGVYSEPHPIGTRYLTRPL;

[0014] SEQ ID NO:3:

[0015] MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNAADAAALEHDKAYDRQLKAGDNPYLRYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPFGLVEEGAKTAPGKKRPVEQSPQEPDSSSGIGKTGQQPAKKRLNFGQTGDTESVPDPQPIGEPPAAPSGVGSLTMASGGGAPVADNNEGADGVGSSSGNWHCDSQWLGDRVITTSTRTWALPTYNNHLYKQISSASTGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTDNNGVKTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMIPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFQFTYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTQTTGGTANTQTLGFSQGGPNTMANQAKNWLPGPCYRQQRVSTTTGQNNNSNFAWTAGTKYHLNGRNSLANPGIAMASHKDDKERFFPSNGILIFGKQNAARDNADYSDVMLTSEEEIKTTNPVATEEYGIVADNLQQQNTAPQIGTVNSQGALPGMVWQNRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGLKHPPPQILIKNTPVPADPPTTFNQSKLNSFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYYKSTSVDFAVNTEGVYSEPRPIGTRYLTRNL;

[0016] SEQ ID NO:4:

[0017] MAADGYLPDWLEDNLSEGIREWWDLKPGAPKPKANQQKQDDGRGLVLPGYKYLGPFNGLDKGEPVNAADAAALEHDKAYDQQLKAGDNPYLRYNHADAEFQERLQEDTSFGGNLGRAVFQAKKRVLEPFGLVEEGAKTAPGKKRPVEQSPQEPDSSSGIGKTGQQPAKKRLNFGQTGDTESVPDPQPIGEPPAAPSGVGSLTMASGGGAPVADNNEGADGVGSSSGNWHCDSQWLGDRVITTSTRTWALPTYNNHLYKQISSASTGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTDNNGVKTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMIPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFQFTYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTQTTGGTANTQTLGFSQGGPNTMANQAKNWLPGPCYRQQRVSTTTGQNNNSNFAWTAGTKYHLNGRNSLANPGIAMASHKDDKERFFPSNGILIFGKQNAARDNADYSDVMLTSEEEIKTTNPVATEEYGIVADNLQQQNTAPQIGTVNSQGALPGMVWQNRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGLKHPPPQILIKNTPVPADPPTTFNQSKLNSFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYYKSTSVDFAVNTEGVYSEPHPIGTRYLTRPL;

[0018] SEQ ID NO: 5:

[0019] MAADGYLPDWLEDNLSEGIREWWALKPGAPKPKANQQKQDDGRGLVLPGYKYLGPFNGLDKGEPVNAADAAALEHDKAYDQQLKAGDNPYLRYNHADAEFQERLQEDTSFGGNLGRAVFQAKKRVLEPLGLVEEGAKTAPGKKRPVEQSPQEPDSSSGIGKTGQQPAKKRLNFGQTGDSESVPDPQPLGEPPATPAAVGPTTMASGGGAPMADNNEGADGVGSSSGNWHCDSTWLGDRVITTSTRTWALPTYNNHLYKQISSASTGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTDNNGVKTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMIPQYGYLTLNDGSQAVGRSSFYCLEYFPSQMLRTGNNFQFTYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTQTTGGTANTQTLGFSQGGPNTMANQAKNWLPGPCYRQQRVSTTTGQNNNSNFAWTAGTKYHLNGRNSLANPGIAMATHKDDKERFFPSNGILIFGKQNAARDNADYSDVMLTSEEEIKTTNPVATEEYGIVADNLQQQNTAPQIGTVNSQGALPGMVWQNRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGLKHPPPQILIKNTPVPADPPTTFNQSKLNSFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYYKSTSVDFAVNTEGVYSEPRPIGTRYLTRNL.

[0020] In the present application, by splicing and recombining the wild type coat protein coding gene of adeno-associated virus, an adeno-associated virus library is constructed, five adeno-associated virus mutants are obtained by screening with neutralizing antibody against AAV coat protein, the coat protein of the adeno-associated virus mutants comprises the amino acid sequence shown in SEQ ID NO: 1-5, the obtained adeno-associated virus mutants have the ability to escape from the neutralizing antibody against AAV, and have high efficient and specific infectivity to human liver cells, and have wide application prospect in the field of hemophilia gene therapy.

[0021] The five adeno-associated virus mutants screened by the application have high sequence homology, and sequence alignment with wild type AAV9 shows that the amino acids from 100th to 200th in the N-terminal of the AAV coat protein amino acid sequence are likely to be the high-frequency recognition region of anti-AAV neutralizing antibodies.

[0022] Preferably, the coat protein of the adeno-associated virus mutant further comprises an amino acid sequence having more than 98% identity with SEQ ID NO: 1-5 and having the same or similar biological function, for example, the coat protein of the adeno-associated virus mutant can have 98% identity with SEQ ID NO: 1-5 and have the ability to evade anti-AAV neutralizing antibodies.

[0023] In a second aspect, the application provides a nucleic acid molecule encoding the adeno-associated virus mutant of the first aspect, or encoding a protein having the same or similar biological function as the adeno-associated virus mutant of the first aspect.

[0024] Preferably, the nucleic acid molecule comprises the nucleic acid sequence shown in SEQ ID NO: 6-10 and / or the complementary sequence of SEQ ID NO: 6-10.

[0025] SEQ ID NO: 6:

[0026]

[0027] SEQ ID NO: 7:

[0028]

[0029] SEQ ID NO:8:

[0030]

[0031] SEQ ID NO: 9:

[0032]

[0033] SEQ ID NO: 10:

[0034]

[0035] In the present application, the nucleic acid sequence shown in SEQ ID NO: 6 is the coding sequence of the amino acid sequence shown in SEQ ID NO: 1, the nucleic acid sequence shown in SEQ ID NO: 7 is the coding sequence of the amino acid sequence shown in SEQ ID NO: 2, the nucleic acid sequence shown in SEQ ID NO: 8 is the coding sequence of the amino acid sequence shown in SEQ ID NO: 3, the nucleic acid sequence shown in SEQ ID NO: 9 is the coding sequence of the amino acid sequence shown in SEQ ID NO: 4, and the nucleic acid sequence shown in SEQ ID NO: 10 is the coding sequence of the amino acid sequence shown in SEQ ID NO: 5.

[0036] In a third aspect, the present application provides an expression vector, wherein the expression vector comprises a wild type adeno-associated virus vector into which the nucleic acid molecule of the second aspect is inserted.

[0037] Preferably, the wild type adeno-associated virus vector comprises any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or AAV10, preferably AAV2.

[0038] In a fourth aspect, the present application provides an adeno-associated virus library, wherein the adeno-associated virus library comprises the adeno-associated virus mutant of the first aspect.

[0039] Preferably, the adeno-associated virus library further comprises wild type and / or mutant adeno-associated viruses without the ability to evade neutralizing antibodies against adeno-associated virus coat proteins.

[0040] In a fifth aspect, the present application provides a method for constructing the adeno-associated virus library of the fourth aspect, wherein the method comprises:

[0041] (1) PCR amplifying the coat protein coding gene of the wild type adeno-associated virus;

[0042] (2) after the amplification product is digested with DNAase, selecting a DNA fragment with a length of 100-300 bp for re-ligation;

[0043] (3) inserting the ligation product into the wild type adeno-associated virus vector to obtain the adeno-associated virus vector library;

[0044] (4) co-transfecting the adeno-associated virus vector library and the helper plasmid into mammalian cells to prepare the adeno-associated virus library.

[0045] Preferably, the PCR primers of step (1) comprise the nucleic acid sequences shown in SEQ ID NO: 11-12.

[0046] SEQ ID NO: 11: 5'-ATAAAGCGAGTAGTC-3';

[0047] SEQ ID NO: 12: 5'-GAGGGTATGCGACAT-3'.

[0048] Preferably, the splicing method of step (2) is to mix DNA fragments with a length of 100-300 bp with DNA polymerase, and perform gradient cooling in the range of 96-41℃, to obtain splicing products by Shuffling PCR.

[0049] In the present application, the DNA fragments with a length of 100-300 bp are selected as splicing fragments, which not only enriches the sequence diversity of the splicing products, improves the virus amount in the adeno-associated virus library, but also ensures the splicing efficiency of Shuffling PCR, improves the splicing success rate of the splicing products, and is helpful for efficient screening of adeno-associated virus mutants capable of avoiding the neutralizing effect of neutralizing antibodies.

[0050] Preferably, the wild-type adeno-associated virus vector of step (3) comprises any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or AAV10, preferably AAV2.

[0051] In a sixth aspect, the present application provides a screening method of the adeno-associated virus mutant of the first aspect, which comprises:

[0052] The adeno-associated virus library of the fourth aspect is mixed with human intravenous human immunoglobulin for incubation, and then introduced into a liver cell humanized mouse;

[0053] Adenovirus is introduced, and after a period of feeding, human cells in the mouse liver are isolated, and DNA is extracted;

[0054] PCR amplification is performed using the primer pair shown in SEQ ID NO: 13-14, the amplification product is inserted into a wild-type adeno-associated virus vector, and a helper plasmid is co-transfected into a mammalian cell; after culture, the mammalian cell is lysed to obtain the adeno-associated virus mutant;

[0055] SEQ ID NO: 13: CAACTCCATCACTAGGGGTTC;

[0056] SEQ ID NO: 14: CATGGGAAAGGTGCCAGA.

[0057] In the present application, the upstream primer SEQ ID NO: 13 is designed according to the AAV2-rep gene, and the downstream primer SEQ ID NO: 14 is designed according to the downstream consensus sequence of the AAV2-ITR plasmid.

[0058] In a seventh aspect, the present application provides a method for preparing an adeno-associated virus mutant, which comprises co-transfecting a mammalian cell with the expression vector of the third aspect and the helper plasmid; and lysing the mammalian cell after culture to obtain the adeno-associated virus mutant.

[0059] In an eighth aspect, the present application provides a pharmaceutical composition comprising any one of the adeno-associated virus mutants of the first aspect, the nucleic acid molecules of the second aspect, the expression vectors of the third aspect, or the combination of at least two of the adeno-associated virus banks of the fourth aspect.

[0060] Preferably, the pharmaceutical composition further comprises any one of or the combination of at least two of a pharmaceutically acceptable carrier, excipient or diluent.

[0061] In a ninth aspect, the present application provides the use of the adeno-associated virus mutant of the first aspect, the nucleic acid molecule of the second aspect, the expression vector of the third aspect, the adeno-associated virus bank of the fourth aspect, or the pharmaceutical composition of the eighth aspect in the preparation of a medicament for treating a genetic deficiency disease.

[0062] Preferably, the genetic deficiency disease comprises hemophilia.

[0063] Compared with the prior art, the present application has the following beneficial effects:

[0064] (1) The present application constructs an adeno-associated virus bank by splicing and recombining the capsid protein coding gene of the wild-type adeno-associated virus, and five adeno-associated virus mutants are screened using neutralizing antibodies against AAV capsid proteins, which have the ability to evade anti-AAV neutralizing antibodies and have high and specific infectivity to human liver cells.

[0065] (2) The five adeno-associated virus mutants screened in the present application have high sequence homology, and after sequence alignment with the wild-type AAV9, it is found that the amino acids located at the 100th to 200th amino acids of the N-terminal of the AAV capsid protein amino acid sequence are likely to be the high-frequency recognition region of the anti-AAV neutralizing antibody.

[0066] (3) The adeno-associated virus mutants of the present application have wide application prospects and great market value in the field of hemophilia gene therapy. BRIEF DESCRIPTION OF DRAWINGS

[0067] Figure 1 The AAV mutants are the source of the capsid protein gene sequence and the point mutations present in the sequence.

[0068] Figure 2 Evolutionary relationship of AAV mutants and wild type;

[0069] Figure 3 Packaging efficiency of AAV wild type and mutants in HEK293 cell line;

[0070] Figure 4 In vitro infection efficiency of AAV wild type and mutants on Huh7 cells;

[0071] Figure 5 In vitro evading ability of AAV wild type and mutants to IVIG neutralizing antibodies;

[0072] Figure 6(A) is the in vitro evading ability of AAV wild type and mutants to neutralizing antibodies in normal human peripheral blood serum, and Figure 6(B) is the in vitro evading ability of AAV wild type and mutants to neutralizing antibodies in peripheral blood serum of hemophilia patients;

[0073] Figure 7 In vivo infection efficiency of mutant 2-10 on human liver cells;

[0074] Figure 8(A) is a schematic diagram of gene therapy, and Figure 8(B) is the treatment effect. DETAILED DESCRIPTION

[0075] To further illustrate the technical means adopted by the present application and its effects, the present application is further described below in conjunction with the examples and drawings. It can be understood that the specific embodiments described herein are merely used to explain the present application, but not to limit the present application.

[0076] Unless otherwise specified in the examples, the techniques or conditions are carried out according to the techniques or conditions described in the literature in the art, or according to the product instructions. Unless otherwise specified, the reagents or instruments used are all conventional products that can be commercially available through regular channels.

[0077] Example 1 Obtaining of Adeno-Associated Virus Mutants

[0078] In this example, first, PCR primers (SEQ ID NO: 11-12) containing specific sequences and enzyme cutting sites are used for ordinary PCR to amplify the purchased wild type adeno-associated virus (AAV) 1-10 shell protein coding genes from BioAsk Company in the United States, so that the quality of the PCR product is more than 1 μg; then the obtained PCR products are mixed and treated with a Shuffling PCR kit to obtain an AAV shell protein mutant library, and the specific steps are as follows:

[0079] 10 μg of the amplified mixture of wild-type AAV coat protein gene was incubated with 1 U of DNase at 37 °C for 5 min, and the reaction was terminated with 1 μL of 100 mM EDTA and inactivated at 75 °C for 10 min; the fragments of 100-300 bp in length in the DNase-digested product were purified using a DNA purification kit; the purified DNA fragments were reassembled using high-fidelity PFU enzyme, and the specific assembly conditions are shown in Table 1; the obtained assembly product was recombined into an AAV2-ITR plasmid to obtain an AAV library.

[0080] Table 1 Shuffling PCR conditions

[0081]

[0082]

[0083] The helper plasmid pXX6-80 and the AAV library were transfected into the HEK293 cell line at a ratio of 1:2; 48 h later, the cells were collected, repeatedly freeze-thawed and ultrasonically lysed; ultracentrifugation was performed in a certain density of cesium chloride solution overnight, and the cesium chloride solution at different levels in the centrifuge tube was collected; the cesium chloride solution containing AAV was placed in a dialysis bag and dialyzed in PBS to obtain a PBS solution containing AAV, i.e., an AAV library.

[0084] 100 μL of the AAV library containing 1 x 10 13 virus was incubated with 100 μL of 1 mg / mL human intravenous immunoglobulin (IVIG) at 4 °C for 2 h, and then the AAV and IVIG mixture was injected into the liver cells of the humanized mouse by the method of internal angular vein injection; on the third day, 1 x 10 7 μg of adenovirus dl309 was injected by the method of internal angular vein injection; on the fifth day, the human cells in the mouse liver were isolated, and DNA was extracted; the coat protein gene was amplified using primers F1 (SEQ ID NO: 13): CAACTCCATCACTAGGGGTTC and R1 (SEQ ID NO: 14): CATGGGAAAGGTGCCAGA and high-fidelity PFU enzyme, and recombined and integrated into the AAV rep-cap packaging plasmid.

[0085] The above steps were repeated three times to obtain an adeno-associated virus mutant that can escape the neutralization of neutralizing antibodies against the AAV coat protein in vivo; the amino acid sequences of the mutant coat proteins are shown in SEQ ID NOs: 1-5, and the nucleic acid sequences are shown in SEQ ID NOs: 6-10.

[0086] Figure 1The source of the coat protein gene sequence in each mutant and the point mutations present in the sequence are shown; further, the evolutionary relationship between each mutant AAV and wild-type AAV was calculated using the Clustral W evolutionary analysis method, and the results are shown in Figure 2. Figure 2 As shown, the mutants 2-10 (SEQ ID NO: 1), 2-19 (SEQ ID NO: 2), 4-24 (SEQ ID NO: 3), 1-1 (SEQ ID NO: 4), 1-18 (SEQ ID NO: 5) were analyzed using the Alignment of the DNAMAN software, and the homology matrix of the 5 sequences is shown in Table 2, and it was found that the homology of SEQ ID NO: 1-5 was 98.02%, and thus it was concluded that the sequence with more than 98% homology with SEQ ID NO: 1-5 has the ability to evade neutralizing antibodies.

[0087] Table 2

[0088] LP1-1.seq 100％ LP1-11.seq 96.7％ 100％ LP2-10.seq 97.0％ 96.5％ 100％ LP3-19.seq 95.2％ 97.0％ 94.8％ 100％ LP4-24.seq 97.8％ 98.4％ 95.7％ 97.1％ 100％

[0089] Example 2 Packaging of Adeno-associated virus mutants

[0090] The Cap-Rep plasmid of each mutant, the luciferase plasmid pTR-CBh-luc and the helper plasmid pXX6-80 were obtained by large-scale plasmid extraction, wherein the pTR-CBh-luc needs to be digested by Sma1 to detect whether the palindromic sequence ITR at both ends of the AAV genome is complete, and all plasmids are previously detected by DNA agarose gel electrophoresis to ensure that the band is single and has a supercoiled structure, and to ensure that the plasmid solution is not contaminated by a large amount of soluble protein;

[0091] The cultured bacteria-, virus- and pathogen-free HEK293 was passaged into a new culture dish (15 cm in diameter) 16 hours in advance, with a density of about 70% of the saturation density, and the culture medium was 10% FBS + DMEM;

[0092] The transfection solution was prepared, and each 15 cm culture dish of cells required 9 μg of pTR-CBh-luc plasmid, 12 μg of mutant Cap-Rep plasmid, and 15 μg of pXX6-80 plasmid, which were added to 500 μL of DMEM culture medium and mixed, followed by the dropwise addition of 150 μL of 1 μg / μL PEI while shaking, and the mixture was added dropwise to the cell culture supernatant and incubated at room temperature for 10 min;

[0093] After 48 hours, the HEK293 was blown into a suspended state, centrifuged at 2000 rpm for 5 min to collect the cell precipitate, resuspended with 8.7 mL of ultrapure water, and repeatedly frozen and thawed between dry ice and warm water three times, and the cells were lysed by ultrasonication for 2 min, 5 g of cesium chloride was added, and the mixture was ultrasonicated for 2 min and placed on ice;

[0094] 4°C, 12000 rpm for 20 min, the insoluble cell debris suspended on the surface of the cesium chloride solution, the lower transparent cesium chloride solution was carefully transferred to the ultracentrifuge tube, using Sorvall WX 80 + Ultracentrifuge ultracentrifuge at 65000 rpm, 15 for 18 hours, brake to 5;

[0095] The centrifugation of cesium chloride solution was taken out layer by layer, the volume of each layer was about 1 mL, and the refractometer was used for measurement. The refractive index of the cesium chloride solution containing AAV was about 1.37.

[0096] The cesium chloride solution containing AAV was transferred to the dialysis bag and placed in the pre-cooled PBS for dialysis. The dialysis was performed three times, and the PBS solution containing AAV was finally collected.

[0097] The obtained AAV was measured for concentration. 90 μL of the PBS solution containing AAV was taken, 10 μL of DNA enzyme was added, and the digestion was carried out at 37°C for 1 hour. 6 μL of 0.5M EDTA was added to terminate the reaction. Then 100 μL of protease digestion solution was added, and the digestion was carried out at 55°C for 2 hours, and then inactivated at 95°C for 5 min. The AAV solution was diluted 1000 times with ultrapure water as a template for real-time quantitative PCR, and quantitative PCR analysis was carried out to calculate the concentration of AAV.

[0098] The results are shown in Figure 3 AAV2 and AAV3 have high packaging efficiency (Packaging efficiency), and the packaging efficiency of other wild type and mutant AAVs is acceptable.

[0099] Example 3 In vitro infection efficiency of adeno-associated virus mutants

[0100] The concentrations of wild type and mutant AAVs obtained in Example 2 were adjusted to the same concentration, and the in vitro infection efficiency of AAV was detected by using human liver tumor cell line Huh7.

[0101] First, Huh7 was evenly divided into 96-well plates, and after 16 hours of culture, a total of 1 x 10 8 μg of AAV was added to each well, and 3 replicate wells were set;

[0102] After 48 hours of continuous culture of Huh7, the expression level of luciferase in each well was detected using Promega luciferase detection kit.

[0103] The results are shown in Figure 4As shown, wild-type AAV1, AAV2, AAV3, AAV6 and mutants 2-10 and 2-20 had high infection efficiency in Huh7 cells (AAV expression efficiency in huh7_48hour).

[0104] Example 4: Efficiency of adeno-associated virus mutants in evading IVIG neutralizing antibodies

[0105] Previous experiments revealed the presence of neutralizing antibodies against all wild-type AAVs in human IVIG. In this embodiment, IVIG at an initial concentration of 50 μg / μL was first serially diluted at a ratio of 1:2, with a maximum dilution ratio of 1:8192, resulting in a final IVIG dilution volume of 20 μL. Wild-type and mutant AAVs were then adjusted to contain 1 × 10⁻⁶ AAVs per 20 μL. 8 μg virus;

[0106] IVIG gradient dilutions were incubated with different wild-type and mutant AAVs at 4°C for 30 min. After incubation, the mixture was added to Huh7 cells (serum-free culture) pre-cultured in 96-well plates and cultured for another 48 hours. After 48 hours, the expression level of luciferase was detected using the Promega luciferase assay kit.

[0107] like Figure 5 As shown, wild-type AAV1, 2, 3, 6, and 8 are relatively easily neutralized by the natural neutralizing antibodies present in IVIG, while wild-type AAV9 exhibits strong resistance to neutralizing antibodies. Mutants 1-1, 1-18, 3-19, and 4-24 show strong resistance to neutralizing antibodies, while mutant 2-10 almost completely evades the neutralizing effect of IVIG. This indicates that mutant AAVs capable of evading neutralizing antibodies in IVIG have been successfully screened from the mutant library.

[0108] Example 5: Efficiency of adeno-associated virus mutants in evading peripheral blood neutralizing antibodies

[0109] In this embodiment, the approximate range of AAV antibody concentrations in peripheral blood serum from 19 healthy individuals and 26 hemophilia patients was first determined. Subsequently, eight serial dilutions were performed at a ratio of 1:2, and a PBS control group without neutralizing antibodies was set up.

[0110] Mix 20 μL of serum diluent with 20 μL (1×10) 8 Different wild-type and mutant AAVs (μg) were incubated at 4°C for 30 min. After incubation, the mixture was added to Huh7 cells (serum-free culture) pre-cultured in 96-well plates and cultured for another 48 hours. After 48 hours, the expression level of luciferase was detected using the Promega luciferase assay kit, and the titer of AAV neutralizing antibody in serum samples was calculated.

[0111] The titers of anti-AAV neutralizing antibodies in healthy serum samples and patient serum samples are shown in Figure 6(A) and Figure 6(B), respectively. The data were visualized, with the scale bar indicating the serum dilution factor; a higher dilution factor and a darker color indicate a higher concentration of neutralizing antibodies in the serum. Analysis of the results revealed that the positive rate of anti-AAV neutralizing antibodies in peripheral blood serum of hemophilia patients was lower than that of healthy individuals, although nearly one-third of hemophilia patients still had anti-AAV neutralizing antibodies in their peripheral blood serum. The mutant 2-10 significantly evaded the neutralizing effect of neutralizing antibodies, reducing the positive rate of wild-type AAV neutralizing antibodies in serum from one-third to one-eighth. The use of the mutant 2-10 is expected to enable more hemophilia patients to receive AAV gene therapy.

[0112] Since mutant 2-10 can effectively evade AAV neutralizing antibodies, a comparison of the antibody expression profiles of wild-type and mutant AAV revealed that the antibody expression profiles of AAV9 and 2-10 are quite similar. Figure 1 Analysis of the origins of various mutants suggests that amino acids 100 to 200 from the N-terminus of the outer shell protein amino acid sequence may be the high-frequency recognition region for anti-AAV neutralizing antibodies.

[0113] Example 6: In vivo infection efficiency of adeno-associated virus mutants 2-10

[0114] This embodiment uses humanized hepatocyte mice for in vivo validation experiments. Humanized hepatocyte mice can represent the complex in vivo environment and directly detect the infection and expression efficiency of AAV in human hepatocytes. AAV8, as an AAV gene therapy vector, has been successfully applied in multiple clinical trials. In this embodiment, AAV8-GFP is used as a control to detect the infection and expression efficiency of mutant 2-10GFP in humanized hepatocyte mice.

[0115] 1×10 11 μg AAV8-GFP and 2-10GFP were intravenously injected into humanized mice with liver cells. Seven days later, the livers of the mice were isolated and immunofluorescence stained. The staining was performed using TRITC-labeled anti-human albumin antibody, and the livers were observed and photographed using a confocal fluorescence microscope.

[0116] like Figure 7 As shown, there was no significant difference in the ability of AAV8 and 2-10 to infect human liver cells in humanized mice, indicating that while 2-10 has evolved the ability to evade AAV neutralizing antibodies, it has not weakened its specific ability to infect human liver cells in vivo.

[0117] Example 7 Gene therapy effect of adenovirus mutant LP2-10 on hemophilia factor 9 gene-deficient mice positive for AAV neutralizing antibodies

[0118] In this embodiment, we simulate the gene therapy process of hemophilia patients with AAV neutralizing antibodies in vivo, as shown in Figure 8(A), first subcutaneously inject AAVs (AAV1 / 2 / 3 / 6 / 8 / 9 mixture) to immunize F9 KO mice, take peripheral blood on day 13, and use the AAV neutralizing antibody detection system to detect whether neutralizing antibodies against AAV are successfully induced, the results show that AAVs as antigens can induce neutralizing antibodies against AAV1 / 2 / 3 / 6 / 8; intravenously inject AAV8 / F9 and LP2-10-F9 on day 14, take peripheral blood on days 28 and 42, and detect the level of hF9, as shown in Figure 8(B), in mice with neutralizing antibodies, the level of hF9 in mice treated with LP2-10 as a vector is significantly higher than that in the AAV8 group, and in mice without immunization, the gene therapy effect of LP2-10 is slightly lower than that of AAV8 but has no significant difference.

[0119] In summary, the present application constructs an adenovirus library by splicing and recombining the wild-type adenovirus coat protein encoding gene, and five adenovirus mutants are screened using neutralizing antibodies against AAV coat proteins, which have the ability to evade anti-AAV neutralizing antibodies and have high and specific infectivity to human liver cells, and have wide application prospects and great market value in the field of hemophilia gene therapy.

[0120] The applicant declares that the above embodiments illustrate the detailed methods of the present application, but the present application is not limited to the above detailed methods, that is, it does not mean that the present application must rely on the above detailed methods to be implemented. It should be understood by those skilled in the art that any improvement of the present application, equivalent replacement of each raw material of the product of the present application, addition of auxiliary ingredients, selection of specific methods, etc. fall within the protection scope and disclosure scope of the present application.

Claims

1. An adeno-associated virus mutant, characterized in that, The amino acid sequence of the capsid protein of the adeno-associated virus mutant is shown in SEQ ID NO:

4.

2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the outer shell protein of the adeno-associated virus mutant according to claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that, The nucleic acid sequence of the nucleic acid molecule is shown in SEQ ID NO:

9.

4. An expression carrier, characterized in that, The expression vector is a wild-type adeno-associated virus vector containing the nucleic acid molecule described in claim 2.

5. The expression vector according to claim 4, characterized in that, The wild-type adeno-associated virus vector is any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV10.

6. The expression vector according to claim 5, characterized in that, The wild-type adeno-associated virus vector is AAV2.

7. A method for preparing an adeno-associated virus mutant, characterized in that, The method includes co-transfecting mammalian cells with the expression vector and helper plasmid as described in claim 4; lysing the mammalian cells after culture to obtain the adeno-associated virus mutant.

8. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the adeno-associated virus mutant of claim 1 and / or the expression vector of claim 4.

9. The pharmaceutical composition according to claim 8, characterized in that, The pharmaceutical composition also includes a pharmaceutically acceptable carrier.

10. The use of the adeno-associated virus mutant of claim 1, the expression vector of claim 4, or the pharmaceutical composition of claim 8 in the preparation of a drug vector for treating gene defects; The genetic defect is hemophilia.

Images