Engineered bacteria with high yield of beta-alanine and application thereof

Abstract

The application discloses an engineered bacterium with high yield of beta-alanine and application thereof, and the engineered bacterium is constructed by taking probiotic E.coli Nissle 1917 as a chassis bacterium, knocking out one or more of cycA genes, fumB1 genes, aspC genes or pyk genes in a genome, and / or overexpressing one or more of panD mutant genes, aspB genes, aspA genes or ppC genes. The application adopts the engineered bacterium to ferment and produce beta-alanine, and the fermentation production process is safe and pollution-free; the fermentation liquor can be used for preparing industrial and food-grade beta-alanine chemical raw materials, and can also be directly used for feeding of breeding animals.

Description

(1) Technical field

[0001] The present invention relates to an engineered bacterium with high beta-alanine production and high tolerance, a construction method and application of the engineered bacterium in preparing beta-alanine by microbial fermentation. (2) Background technology

[0002] β-Alanine is the only naturally occurring β-amino acid, found in certain plants and bacteria. It is also essential for the physiological functions and metabolism of animals. It is the limiting amino acid for the synthesis of endogenous imidazole dipeptides in humans and mammals. It has been shown to increase muscle imidazole dipeptide content, enhance antioxidant capacity, and combat fatigue. In animal husbandry, β-Alanine can improve animal performance, regulate muscle growth and myogenic peptide content, and enhance meat quality. In medicine, β-Alanine can be used to synthesize pantothenic acid, calcium pantothenate, carnosine, sodium pamidronate, and balsalazide. In the chemical industry, β-Alanine is used in electroplating, as an antidote for lead poisoning, and as a synthetic sweetener. In environmental applications, β-Alanine can be synthesized as a flocculant for water purification. β-Alanine is primarily synthesized chemically, enzymatically, and by fermentation. Chemical methods include the acrylonitrile method, the succinimide degradation method, and the β-aminopropionitrile method. However, these methods suffer from harsh process conditions, numerous byproducts, and environmentally unfriendly extraction processes. While enzymatic synthesis of β-alanine offers advantages such as mild conditions and a simple extraction process, this method is relatively expensive. Using readily available glucose as a starting material offers advantages such as low production costs, high specificity, and minimal environmental impact, suggesting broad industrial application prospects.

[0003] The probiotic Escherichia coli Nissle 1917 is a recognized safe strain. It not only modulates the composition and balance of the host's intestinal flora, improving the immune defenses of the intestinal mucosa in humans and animals and alleviating inflammatory responses following intestinal infections, but also offers intestinal protection, inhibits the growth of pathogens, and modulates immune function. Furthermore, Nissle 1917 exhibits rapid growth, meeting the requirements of industrial production microorganisms and making it suitable for industrial fermentation production. However, limited research has been conducted on metabolically engineering Nissle 1917 to produce industrial products.

[0004] The present invention develops a probiotic that produces high levels of β-alanine using Nissle 1917 as the base bacteria. First, a probiotic strain with extremely strong tolerance to high concentrations of β-alanine was screened and then further enhanced by knocking out the key β-alanine transporter gene, cycA. Secondly, Nissle 1917's ability to produce β-alanine was improved by expressing a self-screened β-alanine synthase mutant in Nissle 1917. Thirdly, the level of β-alanine synthesis by Nissle 1917 was further enhanced through metabolic pathway modification. Finally, a pilot fermentation production process for the engineered bacteria Nissle 1917 was developed through culture medium optimization and fed-batch fermentation conditions. (3) Summary of the invention

[0005] The present invention aims to provide an engineered bacterium that produces high β-alanine yields and its applications. The engineered bacterium not only exhibits strong tolerance to high β-alanine concentrations, but also achieves high β-alanine production through optimized culture medium formulation and batch feeding. The engineered bacterium can be safely used for microbial fermentation to produce β-alanine, and the fermentation broth can also be used as a probiotic nutrient in animal husbandry to improve the quality of animal meat.

[0006] The technical solution adopted in the present invention is:

[0007] The present invention provides an engineered bacterium with high beta-alanine production. The engineered bacterium is constructed by using E. coli Nissle 1917 as a base bacterium, knocking out one or more of the cycA gene, the fumB1 gene, the aspC gene, or the pyk gene in the genome, and / or overexpressing one or more of the panD mutant gene, the aspB gene, the aspA gene, or the ppC gene; the panD mutant gene is a coding gene obtained by mutating the 43rd lysine of the protein encoded by the panD gene to tyrosine.

[0008] Preferably, the nucleotide sequence of the cycA gene is shown as 1007-2419 bp in SEQ ID NO.4, the nucleotide sequence of the fumB1 gene is shown as 1004-2650 bp in SEQ ID NO.5, the nucleotide sequence of the aspC gene is shown as 1022-2212 bp in SEQ ID NO.6, the nucleotide sequence of the pyk gene is shown as 987-2429 bp in SEQ ID NO.7, the nucleotide sequence of the panD mutant gene is shown as SEQ ID NO.1, and the amino acid sequence of the protein encoded by the panD mutant gene is shown as SEQ ID NO.2; the nucleotide sequence of the aspB gene is shown as SEQ ID NO.8, the nucleotide sequence of the aspA gene is shown as SEQ ID NO.9; and the nucleotide sequence of the ppC gene is shown as SEQ ID NO.10.

[0009] Preferably, the panD mutant gene (panD K43Y ) is a mutant of the panD gene derived from Bacillus subtilis. The protein expressed by the panD mutant gene is a protein expressed by the panD gene derived from Bacillus subtilis in which lysine at position 43 is mutated to tyrosine. The sequence of the protein is shown in SEQ ID NO.2.

[0010] Preferably, the panD mutant gene, aspB gene, aspA gene or ppC gene adopts promoter P J23100 Expression, the promoter P J23100 The nucleotide sequence is shown in SEQ ID NO.3.

[0011] Preferably, the panD mutant gene and the aspB gene are overexpressed using plasmid pGLO; and the aspA gene or the ppC gene are overexpressed using plasmid pSU19.

[0012] Preferably, the engineered bacteria is one of the following: (1) using E. coli Nissle 1917 as the base bacteria, using plasmid pGLO and promoter P J23100 Overexpression of panD mutant gene, namely engineered bacteria ECN-1; (2) Using E. coli Nissle 1917 as the base bacteria, knocking out the cycA gene in the genome, using plasmid pGLO and promoter P J23100 Overexpression of panD mutant gene, namely engineered bacteria ECN-2; (3) Using E. coli Nissle 1917 as the base bacteria, knocking out the cycA gene and fumB1 gene in the genome, using plasmid pGLO and promoter P J23100 Overexpression of panD mutant gene was carried out by using plasmid pSU19 and promoter P J23100Overexpression of aspA gene, namely engineered bacteria ECN-3; (4) Using E. coli Nissle 1917 as the base bacteria, knocking out the cycA gene, fumB1 gene and aspC gene in the genome, using plasmid pGLO and promoter P J23100 Overexpression of panD mutant gene and aspB gene was carried out by plasmid pSU19 and promoter P J23100 Overexpression of aspA gene, namely the engineered bacteria ECN-4; (5) Using E. coli Nissle1917 as the base bacteria, knocking out the cycA gene, fumB1 gene, aspC gene and pyk gene in the genome, using plasmid pGLO and promoter P J23100 Overexpression of panD mutant gene and aspB gene was carried out using plasmid pSU19 and promoter P J23100 Overexpression of aspA gene, namely engineered bacteria ECN-5; (6) Using E. coli Nissle 1917 as the base bacteria, knocking out the cycA gene, fumB1 gene, aspC gene and pyk gene in the genome, using plasmid pGLO and promoter P J23100 Overexpression of panD mutant gene and aspB gene was carried out using plasmid pSU19 and promoter P J23100 Overexpression of aspA gene and ppC gene, namely engineered bacteria ECN-6.

[0013] The most preferred engineered bacterium ECN-6 for high β-alanine production of the present invention is constructed by the following method:

[0014] (1) The panD gene from Bacillus subtilis and the J23100 promoter were connected to the pGLO vector using a one-step cloning method to obtain pGLO-P J23100 -panD;

[0015] (2) The amino acid 43 encoded by the panD gene from Bacillus subtilis on the plasmid vector was mutated by PCR to obtain the plasmid pGLO-P which can express L-aspartate-α-decarboxylase with high enzyme activity. J2100 -panD K43Y ;

[0016] (3) Using the λ-RED recombination system, the cycA gene in the genome of E. coli Nissle 1917 was knocked out to obtain E. coli Nissle 1917ΔcycA with enhanced tolerance to intracellular β-alanine concentrations;

[0017] (4) Application of lambda-RED recombination system, knockout fumB1 gene, aspC gene and pyk gene in E. coli Nissle 1917 AcycA, obtain E. coli Nissle 1917 AcycA AfumB1 AaspC Apyk;

[0018] (5) The aspA gene from E. coli and J23100 promoter are connected with pSU19 vector by one-step cloning to obtain pSU19-P J23100 -aspA;

[0019] (6) The ppC gene from Corynebacterium glutamicum genome is connected with pSU19-P J23100 -aspA by one-step cloning to obtain pSU19-P J23100 -aspA-ppC;

[0020] (7) The aspB gene from Corynebacterium glutamicum genome is connected with vector pGLO-P J2100 -panD K43Y by one-step cloning to obtain pGLO-P J23100 -panD K43Y -aspB;

[0021] (8) The plasmid pGLO-P J2100 -panD K43Y- aspB and the plasmid pSU19-P J23100 -aspA-ppC are transformed into Nissle 1917 AcycA AfumB1 AaspC Apyk competent cells to obtain the engineering bacteria Nissle 1917 AcycA AfumB1 AaspC Apyk / pGLO-P J2100 -panD K43Y -aspB / pSU19-P J23100 -aspA-ppC, that is, the high-yield beta-alanine engineering bacteria.

[0022] The application also provides application of the high-beta-alanine yield engineering bacteria in fermentation of beta-alanine, which comprises inoculating the engineering bacteria into a fermentation medium, and performing shake flask fermentation culture at 37 DEG C and 200-220 rpm for more than 12 hours; and obtaining a fermentation liquor containing beta-alanine after the fermentation is completed; wherein the fermentation medium comprises 10 g / L of glycerol, 14 g / L of K2HPO4.3H2O, 5.2 g / L of KH2PO4, 0.3 g / L of MgSO4, 1 g / L of NH4Cl and 1 g / L of yeast powder, and the solvent is ddH2O with a pH value of 7.0.

[0023] Preferably, the fermentation is performed in a fermentation tank, the engineering bacteria are inoculated into the fermentation tank containing a fermentation tank medium, and the fermentation is performed at 37 DEG C, pH 6-8 and a dissolved oxygen value of 20%-50% for 10 hours; then a feed medium is added at a speed of 40-60 mL / min until the fermentation is completed, and a fermentation liquor containing beta-alanine is obtained.

[0024] The fermentation tank medium comprises 50 g / L of glucose, 28 g / L of K2HPO4.3H2O, 10.4 g / L of KH2PO4, 4 g / L of NH4Cl, 0.6 g / L of MgSO4, 2 g / L of tryptone and 4 g / L of YEAST EXTRACT (yeast powder), 1 mL of 10x metal ions and 1 mL / L of silicone antifoam agent, and the solvent is water; the 10x metal ion formula comprises 10 g of CaCl2, 10 g of FeSO4.7H2O, 1 g of ZnSO4.7H2O, 0.2 g of CuSO4 and 0.02 g of NiCl2.7H2O dissolved in 100 mL of ddH2O;

[0025] The feed medium comprises 250 g / L of glucose, 250 g / L of glycerol, 4 g / L of yeast extract, 14 g / L of KH2PO4, 10 g / L of NH4Cl, 0.3 g / L of MgSO4 and 1 mL / L of antifoam agent, and the solvent is water.

[0026] The addition amount of the feed medium is maintained at 3-4 g / L of residual glucose concentration in the fermentation liquor.

[0027] Preferably, the engineering bacteria are subjected to slope activation and seed amplification culture before fermentation, and then the seed liquid is inoculated into the fermentation medium at a volume concentration of 1-2%, and the specific inoculation is as follows:

[0028] (1) The engineered bacteria were inoculated on an LB plate containing 0.1 mg / mL ampicillin resistance and cultured in a 37°C incubator overnight; the LB plate culture medium consisted of: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, and 2 g / L agar, with water as the solvent and a natural pH value; (2) a single colony obtained in step (1) was inoculated into an LB liquid culture medium, and cultured in a 37°C incubator at a speed of 200 rpm overnight to obtain a seed solution; the LB liquid culture medium consisted of: 10 g / L peptone, 5 g / L yeast extract, and 10 g / L NaCl, with water as the solvent and a natural pH value; (3) the seed solution obtained in step (2) was inoculated into a fermentation medium at an inoculum concentration of 1-5% by volume, and cultured in a 37°C incubator at a speed of 200 rpm for 24 hours to obtain a fermentation broth containing β-alanine.

[0029] The present invention first clones a mutated panD gene onto the high-copy plasmid pGLO and transcribes it using the strong J23100 promoter, thereby increasing the amount of intracellular β-alanine. By knocking out the cycA gene, high tolerance to intracellular β-alanine concentrations is enhanced. By knocking out the fumB1 gene, fumaric acid is accumulated and aspA is overexpressed, thereby increasing the amount of L-aspartic acid. Overexpressing the ppC gene causes more PEP in the EMP pathway to flow to indirect precursors. To obtain more L-Asp, the aspC gene on the Nissle 1917 genome is knocked out and replaced with the aspB gene from Corynebacterium glutamicum. Overexpressing the ppC gene causes more phosphoenolpyruvate to flow to oxaloacetate. To reduce PEP consumption, the pyk gene, which directs PEP to the pyruvate pathway, is knocked out, causing more PEP to flow to OAA.

[0030] Compared with the prior art, the present invention has the following advantages: first, the ability of the E. coli Nissle 1917 used in the present invention to tolerate β-alanine during fermentation is higher than that of other conventional E. coli strains; second, the present invention expresses PanD K43Y The recombinant plasmid pGLO-P J2100 -panD K43Y The enzyme is introduced into the base bacteria and metabolically engineered (via the aspA and aspC pathways) to increase the supply of L-aspartic acid, a precursor of β-alanine, thereby increasing β-alanine production. Third, the present invention increases β-alanine production to approximately twice the original level by optimizing culture medium components and culture conditions, and establishes a pilot fermentation process for β-alanine production. Fourth, the present invention utilizes engineered bacteria to produce β-alanine, a safe and pollution-free fermentation process. The fermentation broth can be used not only to prepare industrial and food-grade β-alanine chemical raw materials, but also directly feed livestock. (iv) Sequence Listing

[0031] Figure 1 Figure 2 is a graph of the biomass of different hosts at different concentrations of beta-alanine (A) and the anabolic graph of beta-alanine synthesis in E. coli Nissle 1917 (B).

[0032] Figure 2 Figure 3 is an electrophoresis map of colony PCR detection before and after the EcN strain in Example 2 knocks out the cycA gene; A represents the colony PCR verification gel map of the EcN strain before and after knocking out the cycA gene, lane 1 represents 5K Marker, lane 2 represents the chassis strain EcN, lanes 3, 4, 5, and 6 represent the cycA gene knockout strain; B represents the gel map of the colony PCR elimination of the Kan resistance gene on the genome of the EcN strain, lane 1 represents 5K Marker, lanes 2, 3, and 4 represent the elimination of the Kan resistance on the genome of the cycA knockout strain; lane 5 represents the chassis strain EcN.

[0033] Figure 3 Figure 4 is a graph of the biomass comparison of different strains in Example 2; A represents the biomass of the chassis strain EcN before and after knocking out the cycA gene at high concentrations of beta-alanine; B represents the biomass and beta-alanine yield graph of the engineering strains EcN-1, EcN-2, and the chassis strain EcN.

[0034] Figure 4 Figure 5 is an electrophoresis map of the construction process of the engineering strain EcN-3 in Example 3 and a biomass and beta-alanine yield graph; A represents the colony PCR verification gel map of E. coli Nissle 1917 AcycA knockout fumB1 gene; lane 1 represents 5K Marker, lane 2 represents the chassis strain EcN, lanes 3, 4, and 5 represent the fumB1 gene knockout strain; B represents the gel map of the colony PCR elimination of the Kan resistance gene on the genome of E. coli Nissle 1917 AcycA AfumB1, lane 1 represents 5K Marker, lanes 2, 3, 4, and 5 represent the elimination of the Kan resistance on the genome of the fumB1 knockout strain; C represents the biomass and beta-alanine yield graph of the engineering strains EcN-2 and EcN-3.

[0035] Figure 5The electrophoresis diagram of the construction process of the engineered bacteria EcN-4 in Example 4 and the biomass and β-alanine production diagram; A represents the colony PCR verification gel image of E. coli Nissle 1917ΔcycAΔfumB1 knockout of the aspC gene, lane 1 represents 5K Marker, and lanes 2, 3, 4, 5, 6, and 7 represent the aspC gene knockout strain; B represents the colony PCR elimination gel image of the Kan resistance gene on the EcN genome, lane 1 represents 5K Marker, lane 2 represents the bottom plate bacteria EcN, and lanes 3, 4, and 5 represent the elimination of Kan resistance on the aspC knockout strain genome; C represents the recombinant plasmid pGLO-P J23100 -panD K43Y -aspB construction process and map, D represents the biomass and β-alanine production of engineered bacteria EcN-3 and EcN-4.

[0036] Figure 6 The electrophoresis diagram of the construction process of the engineered bacteria EcN-5 in Example 5 and the biomass and β-alanine production diagram; A represents the colony PCR verification gel map of the pyK gene knockout of E. coli Nissle 1917ΔcycAΔfumB1ΔaspC, lane 1 represents 5K Marker, and lanes 2, 3, 4, 5, and 6 represent the pyK gene knockout strain; B represents the colony PCR elimination gel map of the Kan resistance gene test on the EcN genome, lane 1 represents 5K Marker, lane 2 represents the chassis bacteria EcN, and lanes 3, 4, 5, and 6 represent the elimination of Kan resistance on the pyK knockout strain genome; C represents the biomass and β-alanine production diagram of the engineered bacteria EcN-4 and EcN-5.

[0037] Figure 7 Figure 6 shows the construction process of the engineered bacteria EcN-6 and the biomass and β-alanine production; A represents Psu19-P J23100 -aspA-ppC recombinant vector construction process and map; B represents the biomass and β-alanine production of engineered bacteria EcN-5 and EcN-6.

[0038] Figure 8Graphs showing biomass and β-alanine production under different strains and conditions in Example 7; A represents the biomass and β-alanine production of engineered bacteria EcN-1, EcN-2, EcN-3, EcN-4, EcN-5, and EcN-6 in basic salt M9 medium; B represents the β-alanine production of engineered bacteria EcN-6 in carbon source optimized medium; C represents the β-alanine production of engineered bacteria EcN-6 in nitrogen source optimized medium; D represents a high-performance liquid chromatogram of β-alanine standards at different concentrations; E represents a high-performance liquid chromatogram of the fermentation broth of engineered bacteria EcN-6; F represents the biomass and β-alanine production of chassis bacteria EcN and engineered bacteria EcN-6 in fermentation medium; G represents the biomass and β-alanine production of engineered bacteria EcN-6 before and after optimization of the fermentation medium.

[0039] Figure 9 This is a diagram of the production of β-alanine by fed-batch culture in a fermentation tank of the engineered bacteria EcN-6 in Example 8. (V) Specific implementation methods

[0040] The present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto:

[0041] The experimental methods in the examples are conventional methods unless otherwise specified. The experimental materials used in the examples are conventional biochemical reagents unless otherwise specified.

[0042] The E. coli Nissle 1917 strain used in the present invention was purchased from Hangzhou Fenghai Biotechnology Co., Ltd., and the strain was identified by Zhejiang Tianke High-tech Development Co., Ltd.

[0043] LB medium composition: peptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L, ddH2O, pH natural.

[0044] LB plate culture medium is prepared by adding agar to LB liquid medium at a final concentration of 2 g / L.

[0045] Minimal salts M9 medium composition: K2HPO4·3H2O 14 g / L, KH2PO4 5.2 g / L, (NH4)2SO4 2 g / L, MgSO4 0.3 g / L, tryptone 1 g / L, solvent is ddH2O, pH 7.0.

[0046] Example 1: Construction of recombinant plasmid pGLO-P for enhancing β-alanine synthesis metabolic pathway J23100 -PanD K43Y and the corresponding engineered bacteria EcN-1

[0047] 1. Recombinant plasmid pGLO-P J23100 -PanDK43Y Construction

[0048] The enzyme encoded by the panD gene is L-aspartate-α-decarboxylase, which is a key enzyme in the synthesis of β-alanine. Site-directed mutagenesis is used to enhance the expression of the panD gene and the activity of L-aspartate-α-decarboxylase.

[0049] The panD gene (GeneID: 939033) from Bacillus subtilis in GenBank was artificially synthesized and connected with the pGLO vector using a one-step cloning kit (purchased from Novozymes) to obtain the recombinant plasmid pGLO-P J23100 -panD, with the recombinant plasmid pGLO-P J23100 -panD was used as a template, and PCR amplification was performed using the primers in Table 1. The PCR product was detected by 1.0% agarose gel electrophoresis, treated with DpnI at 37°C for 2 h to eliminate the template, and the fragment was purified to obtain the recombinant plasmid pGLO-P J23100 -panD K43Y (the nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2) and P J23100 Promoter (nucleotide sequence is shown in SEQ ID NO.3).

[0050] SEQ ID NO.1:

[0051] ATGTATCGAACAATGATGAGCGGCAAACTTCACAGGGCAACTGTTACGGAAGCAAACCTGAACTATGTGGGAAGCATTACAATTGATGAAGATCTCATTGATGCTGTGGGAATGCTTCCTAATGAA TAC GTACAAATTGTGAATAATAATAATGGAGCACGTCTTGAAACGTATATTATTCCTGGTAAACGGGGAAGCGGCGTCATATGCTTAAACGGTGCAGCCGCACGCCTTGTGCAGGAAGGAGATAAGGTCATTATTATTTC CTACAAAATGATGTCTGATCAAGAAGCGGCAAGCCATGAGCCGAAAGTGGCTGTTCTGAATGATCAAAACAAAATTGAACAAATGCTGGGGAACGAACCAGCCCGTACAATTTTGCACCACCACCACCACCACTGA.

[0052] SEQ ID NO. 3: TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC.

[0053] Table 1: Primer sequences

[0054] Site-directed mutagenesis F GAATGCTTCCTAATGAATACGTAC Site-directed mutagenesis CACAATTTGTACGTATTCATTAGG

[0055] The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 30 s, 57°C for 30 s, and 72°C for 240 s, repeated for 30 cycles; and further extension at 72°C for 10 min.

[0056] 2. Engineered bacteria EcN-1

[0057] (1) Screening of host bacteria

[0058] E. coli Nissle 1917 was streaked onto an LB plate and cultured overnight in a 37°C incubator. A single colony was picked and inoculated into 5 ml of LB liquid medium and cultured overnight in a 37°C incubator at 200 rpm to obtain a seed solution. 1 ml of the seed solution was inoculated into a 250 ml shake flask containing 50 ml of Gene Salts M9 medium. 0 or 100 g / L of β-alanine was also added to the shake flask. The shake flask was then cultured in a 37°C incubator at 200 rpm for 24 hours. 1 ml of the liquid was taken from the shake flask every 2 hours to measure the OD value. 600 .

[0059] Under the same conditions, E. coli BL21 (purchased from Quanshijin Company), E. coli BW25113 (gift from Kirill A. Datsenko & Barry L. Wanner), E. coli MC4100 (gift from Regine Hengge-Aronis), E. coli ZK126 (gift from Steven Finkel), and E. coli W3110 (gift from Dr. Ma Zhi) were used to replace E. coli Nissle 1917, and OD was detected. 600 Value, the result is Figure 1 As shown in A, it shows that under the condition of no addition of β-alanine, the growth condition of E. coli Nissle 1917 in the logarithmic period is better than that of other hosts; under the condition of adding 100 g / L β-alanine, the growth condition of E. coli Nissle 1917 is also better than that of other hosts. Therefore, the probiotic E. coli Nissle 1917 was selected as the base strain and recorded as strain EcN.

[0060] (2) Construction of engineered bacteria EcN-1:

[0061] The recombinant plasmid pGLO-P prepared in step 1 J23100 -panD K43Y , introduce E. coli DH5α competent cells (purchased from Quanshijin Company), place on ice for 30 minutes, heat shock for 90 seconds, and draw 1 mL of LB liquid and incubate at 37°C, 220 rpm for 2 hours.

[0062] The incubation solution was spread onto LB plates containing 0.1 mg / mL ampicillin and incubated overnight at 37°C. A single colony was selected for sequencing. BLAST sequence alignment confirmed that the site-directed mutation in the panD gene was successful, indicating that the original lysine at amino acid position 43 had been mutated to tyrosine, as shown in SEQ ID NO. 2.

[0063] The recombinant plasmid pGLO-P J23100 -PanD K43Y Introduced into E. coli Nissle 1917 to obtain the strain E. coli Nissle 1917 / pGLO-P J23100 -PanD K43Y , recorded as engineered bacteria EcN-1.

[0064] Example 2: Knockout of the cycA gene in the wild-type EcN genome

[0065] Reference Figure 1 In Figure B, to enhance the tolerance of E. coli Nissle 1917 to β-alanine, the cycA gene encoding the β-alanine transporter in the genome of E. coli Nissle 1917 was deleted using the λ-RED recombination system to obtain a strain tolerant to high concentrations of β-alanine. The specific steps are as follows:

[0066] (1) Amplification of target gene and homology arms: Using the genome of E. coli Nissle 1917 strain as a template, primers cycA-UP-F and cycA-Down-R in Table 2 were used to PCR amplify a fragment of the E. coli Nissle 1917 genome including the cycA target gene and the upstream and downstream homology arms. The nucleotide sequence is shown in SEQ ID NO. 4 (1-1006 bp is the upstream homology arm, 1007-2419 bp is the cycA target gene, and 2420-3212 bp is the downstream homology arm). The PCR product was cloned using a TA cloning kit (purchased from Takara) and detected by agarose gel electrophoresis to obtain a recombinant plasmid containing the cycA target gene and the upstream and downstream homology arms.

[0067] cycA target gene:

[0068]

[0069] The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 15 s, 57°C for 15 s, and 72°C for 4 min, repeated for 30 cycles; and further extension at 72°C for 10 min.

[0070] (2) Resistance fragment amplification: Using the pKD4 plasmid (gift from Kirill A. Datsenko & Barry L. Wanner) as a template, primers cycA-Kan-F and cycA-Kan-R in Table 2 were used to PCR amplify the kanamycin resistance fragment carrying FRT on the pKD4 plasmid. The nucleotide sequence is shown in SEQ ID NO.11, wherein the FRT resistance nucleotide sequence is 27-60 bp and 1420-1453 bp in SEQ ID NO.11; the Kan resistance nucleotide sequence is 435-1229 bp in SEQ ID NO.11.

[0071] The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 15 s, 57°C for 15 s, and 72°C for 4 min, repeated for 30 cycles; and further extension at 72°C for 10 min.

[0072] (3) Replacing the target gene with the resistance fragment: Using a one-step cloning kit (purchased from Novagen), the cycA gene on the recombinant plasmid obtained in step (1) was replaced with the kanamycin resistance fragment with FRT shown in SEQ ID NO.11 in step (2) to obtain a new recombinant plasmid; using the new recombinant plasmid as a template, PCR was performed using primers cycA-UP-F and primer cycA-Down-R to finally obtain a Kan resistance gene fragment containing upstream and downstream homology arms.

[0073] (4) Competent cells: pKD46 plasmid (gift from Kirill A. Datsenko & Barry L. Wanner) was transformed into E. coli Nissle 1917 strain by electroporation to obtain E. coli Nissle 1917 strain containing pKD46 plasmid. The strain was inoculated into LB medium containing 0.1 mg / mL ampicillin and 30 mM L-arabinose and cultured at 30°C until OD 600 When the concentration reached 0.6, the bacterial solution was centrifuged at 9000 rpm for 5 min, and the precipitate was washed four times with sterile distilled water to obtain competent cells.

[0074] (5) Knockout strain of target gene: The Kan resistance gene fragment containing upstream and downstream homology arms in step (3) was electrotransformed into the competent cells in step (4) at 1.8KV. The electrotransformed bacterial solution was incubated at 37°C for 2h. After centrifugation at 9000rpm for 1min per 1mL of bacterial solution, 900μL of supernatant was discarded. 50μL of the precipitate was spread on an LB plate containing 0.05mg / mL kanamycin and 0.1mg / mL ampicillin resistance and cultured at 30°C overnight. A single colony was picked as a template and PCR was performed using primers cycA-detect-F and primer Kan-R-detect. Under the same conditions, agarose gel electrophoresis analysis was performed using wild-type E. coli Nissle 1917 as a control. The results are shown in Figure 2A. DNA bands were observed in the knockout strain in the 1.0% agarose gel, while no bands were observed in the starting strain, confirming the deletion of the cycA gene. The cycA gene knockout strain E. coli Nissle1917ΔcycA was screened and obtained.

[0075] (6) Elimination of plasmid: The strain E. coli Nissle 1917ΔcycA in which the cycA gene was knocked out in step (5) was inoculated into LB liquid medium containing 0.05 mg / mL kanamycin resistance, cultured at 37°C for 12 h to eliminate pKD46, diluted and spread onto LB plates containing 0.05 mg / mL kanamycin resistance, and cultured at 37°C for 12 h. The knockout strain that eliminated the pKD46 plasmid was screened, and competent cells were prepared using the method of step (4).

[0076] (7) Elimination of kanamycin resistance: The pCP20 plasmid (purchased from Kirill A. Datsenko & Barry L. Wanner) was introduced into the competent cells in step (6) by electroporation and cultured on LB plates containing 0.025 mg / mL chloramphenicol resistance at 30°C for 12 h to screen for transformants. The transformants were cultured in LB liquid medium containing 0.025 mg / mL chloramphenicol resistance at 42°C for 12 h to eliminate the kanamycin resistance on the E. coli Nissle 1917 genome. The cultured bacterial solution was diluted 10 4After doubling, spread it on an LB plate containing 0.025 mg / mL chloramphenicol resistance and culture it at 30°C for 12 hours. The obtained single colony was first streaked on an LB double-antibody plate containing 0.05 mg / mL kanamycin resistance and 0.025 mg / mL chloramphenicol resistance, and cultured at 37°C for 12 hours; then the single colony on the double-antibody plate was picked and streaked on an LB plate containing 0.025 mg / mL chloramphenicol resistance, and cultured at 30°C for 12 hours. Pick the colonies that do not grow on the double-antibody plate but grow on the single antibody plate, and perform colony PCR using primers cycA-UP-F and primers cycA-Down-R. The PCR products were detected by agarose gel electrophoresis, and the results are as follows. Figure 2 As shown in B. In a 1.0% agarose gel, it was observed that the DNA band of the cycA knockout strain was exactly the size of the wild-type band lacking the target gene cycA, indicating that the kanamycin resistance on the Nissle1917 genome was eliminated.

[0077] (8) Elimination of pCP20 plasmid (gift from Kirill A. Datsenko & Barry L. Wanner): The colonies that did not grow on the double-stranded antibody but grew on the monoclonal antibody in step (7) were inoculated onto LB plates containing 0.025 mg / mL chloramphenicol resistance and LB plates without 0.025 mg / mL chloramphenicol resistance, respectively, and cultured at 37°C for 12 h. The knockout strain that did not grow on the LB plate containing 0.025 mg / mL chloramphenicol resistance but grew on the LB plate without chloramphenicol resistance was selected, namely the E. coli Nissle 1917ΔcycA strain. The knockout strain was prepared as competent, and the recombinant plasmid pGLO-P was transformed into the competent strain by electroporation. J23100 -PanD K43Y Introduced into the knockout strain to obtain the engineered bacteria E. coli Nissle 1917ΔcycA / pGLO-P J23100 -PanD K43Y , recorded as engineered bacteria EcN-2.

[0078] (9) Biomass determination and β-alanine production

[0079] Biomass: E. coli Nissle 1917 and E. coli Nissle 1917ΔcycA were streaked onto LB plates and cultured overnight in a 37°C incubator. A single colony was picked and inoculated into 5 ml of LB liquid medium and cultured overnight at 200 rpm in a 37°C incubator to obtain seed liquid. 1 ml of seed liquid was inoculated into a 250 ml shake flask containing 50 ml of minimal salt M9 medium and 0 or 100 g / L of β-alanine. The shake flask was then cultured at 200 rpm in a 37°C incubator for 24 hours. 1 ml of liquid was taken from the shake flask every 2 hours to measure the OD value.600 , the results are as follows Figure 3 As shown in A.

[0080] β-Alanine production: The engineered bacteria EcN-2 was streaked onto an LB plate and cultured in a 37°C incubator overnight. A single colony was picked and inoculated into 5 ml of LB liquid medium, which was cultured in a 37°C incubator at 200 rpm overnight to obtain a seed solution. 1 ml of the seed solution was inoculated into a 250 ml shake flask containing 50 ml of minimal salt M9 medium and 100 g / L of β-alanine. After fermentation and culture in a 37°C incubator at 200 rpm for 24 hours, samples were taken and the OD was measured. 600 At the same time, 1 ml of liquid was taken from the shake flask and centrifuged at 9000 rpm for 1 min. The supernatant was taken and derivatized. After filtering through an organic membrane with a pore size of 45 μm, the filtrate was analyzed by HPLC for the content of β-alanine in the fermentation broth. Under the same conditions, the engineered bacteria EcN-2 was replaced by E. coli Nissle 1917 and the engineered bacteria EcN-1 constructed in Example 1. The results are shown in Figure 3 As shown in B. The results showed that knocking out the cycA gene, which is responsible for β-alanine tolerance in EcN-1, could further increase β-alanine production, which was 1.17 times higher than that of EcN-1, reaching a yield of 0.499 g / L.

[0081] HPLC conditions: Wanyi High Performance Liquid Chromatography (HPLC); XB-C18 column (250 mm × 4.6 nm); mobile phase: methanol: 0.05 mol / L acetic acid / sodium acetate solution (55:45); flow rate: 1.0 mL / min; column temperature: room temperature. Sample derivatization: 100 μL of sample was added to 100 μL of 0.5 mol / L aqueous NaHCO₃ and 0.1 mL of 1% aqueous 2,4-dinitrofluorobenzene in acetonitrile. After reacting at 60°C in the dark for 30 min, 700 μL of 0.2 mol / L pH 7 phosphate buffer was added.

[0082] Table 2: Primer sequences

[0083] cycA-detect-F AGCCAGATATCGACCCATTG cycA-UP-F GGATTTGTCATCATTCCCGCGA cycA-UP-R GCTCCAGCCTACACAATCGGTACCTGTCTGTGTTGTTCAGG cycA-Down-F TTCCCATGTCAGCCGTTAAGGCAATGCCATCCAGCTTTT cycA-Down-R ACACGCTGGCAGTGAGTTA cycA-Kan-F CCTGAACAACACAGACAGGTACCGATTGTGTAGGCTGGAGC cycA-Kan-R AAAAGCTGGATGGCATTGCCTTAACGGCTGACATGGGAA Kan-R-test GCTTCCATCCGAGTACGTG

[0084] Example 3: Knockout of the fumB1 gene and overexpression of the aspA gene in the engineered bacteria EcN-2

[0085] The fumB1 gene in the E. coli Nissle 1917ΔcycA strain was knocked out using the λ-RED recombination system, blocking the flow of fumarate to malate, thereby further facilitating the accumulation of β-alanine. The β-alanine-producing probiotic engineered strain EcN-3 was constructed, which enhances the fumarate-to-L-aspartate pathway. The specific steps are as follows:

[0086] (1) Amplification of target fragment: Using the E. coli Nissle 1917 genome as a template, primers fumB1-UP-F and fumB1-down-R were used for PCR amplification to obtain a fragment containing the fumB1 gene and upstream and downstream homology arms. The nucleotide sequence is shown in SEQ ID NO.5 (1-1003bp is the upstream homology arm, 1004-2650bp is the fumB1 gene, and 2651-3669bp is the downstream homology arm). The PCR reaction conditions are as follows: 95℃ for 5min; 95℃ for 15s, 57℃ for 15s, 72℃ for 4min, repeated for 30 cycles; 72℃ for further extension for 10min. The PCR product was cloned using a TA cloning kit (purchased from Takara) and detected by agarose gel electrophoresis to obtain a recombinant plasmid containing the fumB1 target gene and upstream and downstream homology arm fragments;

[0087] fumB1 gene:

[0088] ATGTCAAACAAACCCTTTCATTATCAGGCTCCTTTTCCACTCAAAAAAGATGATACTGAGTATTACCTGCTAACCAGCGAACACGTTAGCGTATCTGAATTTGAAGGGCAGGAGATTTTGAAAGTCGCACCCGAAGCGTTAACTCTGTTGGCGCGTCAGGCGTTTCATGATGCGTCATTTATGCTGCGTCCGGCTCACCAACAACAGGTGGCCGACATTCTGCGTGACCCGGAGGCCAGCGAAAATGATAAATATGTGGCGCTGCAATTCCTGCGTAACTCCGACATCGCGGCAAAAGGCGTTCTGCCAACCTGTCAGGATACCGGCACCGCGATTATTGTTGGTAAAAAAGGGCAGCGTGTATGGACCGGTGGCGGTGATGAAGCGGCGCTGGCGCGCGGTGTCTATAACACTTATATCGAGGATAATCTGCGCTACTCGCAAAACGCGCCGCTGGATATGTATAAAGAGGTGAATACCGGCACCAACTTGCCAGCGCAGATCGATCTTTATGCCGTTGATGGCGACGAGTACAAATTCCTCTGTATCGCCAAAGGTGGCGGTTCGGCAAACAAGACGTATCTCTATCAGGAAACCAAAGCGTTACTGACGCCGGGAAAACTGAAAAATTACCTGGTTGAGAAGATGCGCACGCTGGGTACGGCGGCCTGTCCTCCGTATCATATTGCGTTCGTTATTGGTGGAACTTCTGCAGAAACGAATCTTAAAACGGTGAAACTCGCTTCCGCTAAATACTATGATGAACTGCCAACGGAAGGGAATGAGCACGGTCAGGCGTTCCGCGATGTGGAACTGGAAAAAGAATTGCTGATCGAAGCGCAAAATCTTGGTCTGGGTGCGCAGTTTGGTGGTAAATACTTCGCTCATGACATCCGCGTGATTCGCCTGCCACGTCACGGCGCATCCTGCCCGGTCGGTATGGGCGTCTCCTGTTCTGCTGACCGTAATATCAAAGCGAAGATCAACCGT.

[0089] (2) Amplification of the resistance fragment: As in Example 2, PCR amplification was performed using the pKD4 plasmid as a template and primers fumB1-Kan-F and fumB1-Kan-R to obtain the kanamycin-resistant fragment with FRT. The PCR reaction conditions were the same as in step (1).

[0090] (3) Replacing the target gene with the resistance fragment: Using a one-step cloning kit (purchased from Novagen), the fumB1 gene on the recombinant plasmid obtained in step (1) was replaced with the kanamycin resistance fragment with FRT in step (2) to obtain a new recombinant plasmid; using the new recombinant plasmid as a template, PCR was performed using primers fumB1-UP-F and primer fumB1-Down-R to finally obtain a Kan resistance gene fragment containing upstream and downstream homologous arms.

[0091] (4) Competent cells: The pKD46 plasmid was transformed into the E. coli Nissle 1917 AcycA strain using the method of Example 2, and competent cells were prepared.

[0092] (5) Knockout strain of the target gene: The Kan-resistant gene fragment of step (3) was electroporated into the competent cells of step (4) at 1.8 KV, and the electroporated bacterial solution was incubated at 30°C for 2 h. After centrifugation of 1 mL of the bacterial solution at 9000 rpm for 1 min, 900 μL of supernatant was discarded, and 50 μL of the precipitate was spread on an LB plate containing 0.05 mg / mL kanamycin and 0.1 mg / mL ampicillin resistance, and incubated at 30°C overnight. A single colony was picked as a template for PCR using primer fumBl -detect-F and primer Kan-R-detect. The same conditions were used to analyze the E. coli Nissle 1917 as a control, and agarose gel electrophoresis was performed, the results of which are shown in Fig. A. A DNA band was observed in the knockout strain in a 1.0% agarose gel, and no band was observed in the chassis strain, confirming the deletion of the fumBl gene. Strains in which the fumBl gene and the cycA gene were knocked out were selected. Figure 4

[0093] (6) Elimination of plasmid: The strain of step (5) was inoculated in 0.05 mg / mL kanamycin-resistant LB liquid medium and incubated at 37°C for 12 h to eliminate pKD46, and then inoculated in 0.05 mg / mL kanamycin-resistant 0.1 mg / L ampicillin 0.05 mg / L kanamycin-resistant LB plate and incubated at 37°C for 12 h to select the knockout strain in which pKD46 plasmid was eliminated. The method of Example 1 was used to prepare competent cells.

[0094] (7) Elimination of resistance: The pCP20 plasmid was introduced into the competent cells of step (6), and transformants were selected by incubation on a 0.025 mg / mL chloramphenicol-resistant LB plate at 30°C. The transformants were incubated in 0.025 mg / mL chloramphenicol-resistant LB liquid medium at 42°C for 12 h to eliminate the kanamycin resistance on the Nissle 1917 genome. The bacterial solution was diluted 10 times with LB liquid medium, spread on a 0.025 mg / mL chloramphenicol-resistant LB plate, and incubated at 30°C for 12 h. The obtained single colonies were first streaked on a 0.05 mg / mL kanamycin-resistant and 0.025 mg / mL chloramphenicol-resistant LB plate, and incubated at 30°C for 12 h. The colonies on the double-antibiotic plate were picked and streaked on a 0.025 mg / mL chloramphenicol-resistant LB plate, and incubated at 30°C for 12 h. The colonies that did not grow on the double-antibiotic plate but grew on the single-antibiotic plate were used for colony PCR using primer fumBl -UP-F and primer fumBl -down-R, and the results are shown in Fig. B. 4 Figure 4 ​​As shown in B. The DNA band of the knockout strain in a 1.0% agarose gel was found to be the same size as the band of the base strain, which is the size of the target gene fumB1, indicating that the kanamycin resistance in the Nissle 1917 genome has been eliminated.

[0095] (8) Elimination of pCP20 plasmid: The pCP20 plasmid was eliminated in the same manner as in Example 2 to obtain the non-resistant knockout strain E. coli Nissle 1917ΔcycAΔfumB1.

[0096] (9) Recombinant plasmid pSU19-P J23100 -aspA

[0097] Using the EcN genome as a template, PCR amplification was performed using primers aspA-F and aspA-R to obtain the aspA gene amplification product. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was digested with DpnI to obtain a purified PCR product fragment of the aspA gene. The nucleotide sequence is shown in SEQ ID NO. 9. PCR reaction conditions included initial denaturation at 95°C for 5 minutes, followed by 30 cycles of 95°C for 30 seconds, 57°C for 30 seconds, and 72°C for 3 minutes, with a final extension at 72°C for 10 minutes.

[0098] SEQ ID NO.9

[0099]

[0100] PCR amplification was performed using the pSU19 vector (a gift from Rosemary Redfield) as a template using primers pSU19-vector-R and pSU19-vector-F listed in Table 3. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was digested with DpnI. The PCR product fragment was purified to obtain the linearized pSU19 vector.

[0101] The pSU19 vector was connected to the purified PCR product fragment of the aspA gene using a one-step cloning kit to obtain the cloned recombinant plasmid pSU19-P J23100 -aspA. The above recombinant plasmids were verified to be correct plasmids by sequencing.

[0102] (10) Recombinant bacteria: The knockout strain in step (8) was prepared into competent state, and the recombinant plasmid pGLO-P was transformed into competent state by electroporation. J23100 -PanD K43Y and pSU19-P J23100 -aspA was introduced into the knockout strain E. coli Nissle 1917ΔcycAΔfumB1 to obtain the engineered strain E. coli Nissle 1917ΔcycAΔfumB1 / pGLO-P J23100 -PanD K43Y / pSU19-P J23100 -aspA, denoted as strain EcN-3.

[0103] The biomass and β-alanine production of strains EcN-2 and EcN-3 were determined using the method of Example 2. Figure 4 As shown in C. The results showed that knocking out the fumB1 gene in EcN-2 to accumulate fumaric acid and overexpressing the aspA gene could increase the production of β-alanine, which was 1.2 times higher than that of the EcN-2 strain, reaching 0.595 g / L.

[0104] Table 3: Primer sequences

[0105]

[0106]

[0107] Example 4: Knockout of the aspC gene and overexpression of the aspB gene in the engineered bacterium EcN-3

[0108] To accumulate L-aspartate, more OAA needs to be converted into L-Asp. Therefore, the aspC gene in the E. coli Nissle 1917ΔcycAΔfumB1 strain was knocked out using the λ-RED recombination system, and aspB from Corynebacterium glutamicum was overexpressed to construct an engineered strain EcN-4 that produces β-alanine by enhancing the oxaloacetate-to-L-aspartate pathway. The specific steps are as follows:

[0109] (1) Target gene amplification: Using the E. coli Nissle 1917 genome as a template, primers aspC-UP-F and primers aspC-down-R were used for PCR amplification to obtain a fragment containing the target gene aspC and upstream and downstream homology arms. The nucleotide sequence is shown in SEQ ID NO.6 (1-1021 bp is the upstream homology arm, 1022-2212 bp is the target gene aspC, and 2213-3236 bp is the downstream homology arm); the PCR product was purified and TA cloned using a one-step cloning kit (purchased from Norvegian) to obtain a recombinant plasmid; the PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 15 s, 57°C for 15 s, and 72°C for 4 min, repeated for 30 cycles; and continued extension at 72°C for 10 min.

[0110] Gene aspC:

[0111]

[0112] (2) FRT-carrying Kan resistance fragment: using the method of Example 2, using the pKD4 plasmid as a template, and using the aspC-Kan-F and primer aspC-Kan-R primers to perform PCR amplification, a FRT-carrying Kan resistance fragment was obtained. The PCR reaction conditions were the same as step (1).

[0113] (3) Replacement of the target gene with a resistance fragment: using a one-step cloning kit (purchased from Novagen), a one-step cloning method was used to replace the aspC gene on the recombinant plasmid obtained in step (1) with the FRT-carrying Kan resistance fragment of step (2), to obtain a new recombinant plasmid; using the new recombinant plasmid as a template, and using the primers aspC-UP-F and primer aspC-Down-R to perform PCR, a Kan resistance gene fragment containing the upstream and downstream homologous arms was finally obtained.

[0114] (4) Competent cells: using the method of Example 2, the plasmid pKD46 was transformed into E. coli Nissle 1917 AcycA AfumB1, and competent cells were prepared.

[0115] (5) Strain with the target gene knocked out: the Kan resistance gene fragment of step (3) was electroporated into the competent cells of step (4) at 1.8KV, and the bacteria after electroporation were incubated at 37°C for 2h. 9000rpm centrifugation was performed on 1mL of bacterial solution for 1min, 900μL of supernatant was discarded, and 50μL of the precipitate was spread on an LB plate containing 0.05mg / mL kanamycin and 0.1mg / mL ampicillin resistance, and incubated at 30°C overnight. A single colony was picked as a template, and primers aspC-detection-F and primer Kan-R-detection were used to perform PCR. Under the same conditions, the chassis bacteria E. coli Nissle 1917 were used as controls, and agarose gel electrophoresis analysis was performed, the results of which are shown in Figure 5A. It was observed that the knockout strain had a DNA band in the 1.0% agarose gel, and the chassis bacteria had no band, confirming the deletion of the aspC gene. Strains with cycA, fumB1 and aspC knocked out were selected.

[0116] (6) Elimination of plasmid: the strain of step (5) was inoculated in LB liquid medium containing 0.05mg / mL kanamycin and incubated at 37°C for 12h to eliminate pKD46, and then inoculated in LB plate containing 0.05mg / mL kanamycin and 0.1mg / mL ampicillin and 0.05mg / mL kanamycin double resistance, and incubated at 37°C for 12h, to select the knockout strain with pKD46 plasmid eliminated. The competent cells were prepared according to the method of Example 2.

[0117] (7) Elimination of resistance: The pCP20 plasmid was introduced into the competent cells of step (6), and the transformants were screened by culturing on 0.025 mg / mL chloramphenicol-resistant LB plates at 30°C for 12 h. The transformants were cultured in 0.025 mg / mL chloramphenicol-resistant LB liquid medium at 42°C for 12 h to eliminate the kanamycin resistance on the Nissle 1917 genome. The cultured bacterial solution was diluted 10 4 Spread the resulting colony onto a 0.025 mg / mL chloramphenicol-resistant LB plate and incubate at 30°C for 12 hours. The resulting single colony was first streaked onto an LB plate containing both 0.05 mg / mL kanamycin-resistant and 0.025 mg / mL chloramphenicol-resistant strains and incubated at 30°C for 12 hours. Colonies from the dual-resistant plate were streaked onto a 0.025 mg / mL chloramphenicol-resistant LB plate and incubated at 30°C for another 12 hours. Colonies that did not grow on the dual-resistant plate but did grow on the single-resistant plate were selected for colony PCR using primers aspC-UP-F and aspC-DOWN-R. Under the same conditions, agarose gel electrophoresis analysis was performed using E. coli Nissle 1917 as a control. The results are shown in Figure 5B. The DNA band of the knockout strain was observed in a 1.0% agarose gel. The size of the band was exactly the same as that of the wild type, which means that the kanamycin resistance in the Nissle 1917 genome was eliminated.

[0118] (8) Elimination of pCP20 plasmid: The strain selected in step (7) was subjected to elimination of pCP20 plasmid according to the method of Example 2, and the non-resistant knockout strain E. coli Nissle 1917ΔcycAΔfumB1ΔaspC was obtained by screening.

[0119] (9) Recombinant plasmid pGLO-P J23100 -panD K43Y -aspB

[0120] Using the genome of Corynebacterium glutamicum (a gift from Zhang Bo) as a template, PCR amplification was performed using primers aspB-F and aspB-R to obtain the aspB gene amplification product (nucleotide sequence shown in SEQ ID NO. 8). The PCR product was detected by 1.0% agarose gel electrophoresis and the template was digested with DpnI. The aspB gene PCR product fragment was purified. PCR reaction conditions included initial denaturation at 95°C for 5 minutes, followed by 30 cycles of 95°C for 30 seconds, 57°C for 30 seconds, and 72°C for 3 minutes, with a final extension at 72°C for 10 minutes.

[0121] The pGLO-P constructed in Example 1 J23100 -panD K43YThe vector as a template, using primer aspB-vector-R, primer aspB-vector-F PCR amplification, obtained pGLO-P J23100 -panD K43Y Vector.

[0122] Using one-step cloning kit, using one-step cloning pGLO-P J23100 -panD K43Y Vector and aspB gene purification PCR product fragment, get cloned recombinant plasmid pGLO-P J23100 -panD K43Y -aspB (construction process and map see Figure 5 The above recombinant plasmid is correct by sequencing test plasmid.

[0123] (10) Recombinant bacteria: recombinant plasmid pGLO-P J23100 -panD K43Y -aspB and pSU19-P J23100 -aspA into E. coli Nissle1917ΔcycAΔfumB1ΔaspC, obtain strain E. coli Nissle 1917ΔcycAΔfumB1ΔaspC / pGLO-P J23100 -panD K43Y -aspB / pSU19-P J23100 -aspA, referred to as engineering bacteria EcN-4.

[0124] The method of Example 2 was used to determine the biomass and β-alanine production of engineering bacteria EcN-3 and EcN-4, and the results are shown in Figure 5 D. The results show that knocking out the aspC gene on the EcN genome and overexpressing the aspB gene from the Corynebacterium glutamicum source can further improve the production of β-alanine. Compared with the EcN-3 strain, the yield is increased by 1.59 times, reaching 0.924 g / L.

[0125] Table 4: Primer sequences

[0126] Detect-F ACGATCCGGGATATCTCGA aspC-UP-F TCGACCCAGGATTATTCGAC aspC-UP-R GCTCCAGCCTACACAATCGGTTAAAACCGATGAAGCCCG aspC-Kan-F CGGGCTTCATCGGTTTTAACCGATTGTGTAGGCTGGAGC aspC-Kan-R GGACTTCCCTTCTTGTAACCAACTTAACGGCTGACATGGGA aspC-Down-F TCCCATGTCAGCCGTTAAGTTGGTTACAGAAGGGAAGTCC aspC-Down-R CGGTTATGGTCAGTGGGAATA aspB vector-F GTGAATACAGCGGAGACAGAGAGTAGGGAACTGCCAG aspB vector-R TCTCCTTCTTAAAGTTAAACAAACCTGCAGGTCGACTCTAGA aspB fragment-F TTTGTTTAACTTTAAGAAGGAGAAGAGTAGTGGCTTGAGGTCA aspB fragment-R CTGTCTCCGCTGTATTCAC

[0127] Example 5: Knocking out pyk gene in engineering bacteria EcN-4

[0128] In order to make more oxaloacetate flow to L-aspartate, through λ-RED recombination system to E. coli Nissle1917ΔcycAΔfumB1ΔaspC / pGLO-P J23100 -panD K43YThe pyk gene, which is involved in the PEP flow to the pyruvate pathway, was knocked out in the -aspB strain to enhance the metabolic pathway from phosphoenolpyruvate to oxaloacetate. The β-alanine-producing engineered strain EcN-5 with enhanced phosphoenolpyruvate to oxaloacetate pathway was constructed. The specific steps are as follows:

[0129] (1) Using the E. coli Nissle 1917 genome as a template, primers pyk-UP-F and primers pyk-down-R were used for PCR amplification to obtain the target gene pyk and the upstream and downstream homology arms. The nucleotide sequence is shown in SEQ ID NO.7 (1-986 bp is the upstream homology arm, 987-2429 bp is the target gene pyk, and 2430-3553 bp is the downstream homology arm); the PCR product was purified and TA cloned using a TA cloning kit to obtain the recombinant plasmid; the PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 15 s, 57℃ for 15 s, and 72℃ for 4 min, repeated for 30 cycles; and continued extension at 72℃ for 10 min.

[0130] Gene pyk:

[0131] ATGTCCAGAAGGCTTCGCAGAACTAAAATCGTTACCACGTTAGGCCCGGCAACAGATCGCGATAATAACCTTGAAAAAGTTATCGCGGCGGGTGCCAACGTTGTACGTATGAATTTTTCTCACGGCTCGCCTGAAGATCACAAAATGCGCGCGGATAAAGTTCGTGAGATTGCCGCAAAACTGGGGCGTCATGTGGCTATTCTGGGTGACCTCCAGGGGCCCAAAATCCGTGTATCCACCTTTAAAGAAGGCAAAGTTTTCCTCAATATTGGGGATAAATTCCTGCTCGACGCCAACCTGGGTAAAGGTGAAGGCGACAAAGAAAAAGTCGGTATCGACTACAAAGGCCTGCCTGCTGACGTTGTGCCTGGTGACATCCTGCTGCTGGACGATGGTCGCGTCCAGTTAAAAGTACTGGAAGTCCAGGGCATGAAAGTGTTCACCGAAGTGACCGTCGGTGGTCCCCTCTCCAACAATAAAGGTATCAACAAACTTGGCGGCGGTTTGTCAGCTGAAGCGCTGACCGAAAAAGACAAAGCAGACATTAAGACTGCGGCGTTGATTGGCGTAGATTACCTGGCTGTCTCCTTCCCACGCTGCGGCGAAGATCTGAACTATGCCCGTCGTCTGGCACGCGATGCAGGATGTGATGCGAAAATTGTTGCCAAGGTTGAACGTGCGGAAGCCGTTTGCAGCCAGGAGGCAATGGATGACATCATCCTCGCCTCTGACGTGGTAATGGTTGCTCGCGGCGACCTCGGTGTGGAAATTGGCGATCCGGAACTGGTCGGCATTCAGAAAGCGTTGATCCGTCGTGCGCGTCAGCTTAACCGCGCGGTAATCACGGCGACCCAGATGATGGAGTCAATGATTACTAACCCGATGCCGACGCGTGCAGAAGTCATGGACGTAGCAAACGCCGTTCTGGATGGTACTGACGCTGTGATGCTGTCGGCAGAAACTGCTGCTGGTCAATACCCGTCAGAAACTGTTGCAGCCATGGCGCGCGTTTGCCTGGGGGCGGAAAAAATCCCGAGCATCAACGTTTCTAAACACCGTCTGGACGTTCAGTTCGACAATGTGGAAGAAGCTATTGCCATGTCAGCAATGTACGCGGCTAACCACCTGAAAGGCGTTACGGCGATCATCACCATGACCGAATCGGGTCGTACCGCGCTGATGACCTCCCGTATCAGCTCTGGTCTGCCAATTTTCGCCATGTCACGCCATGAACGTACGCTGAACCTGACTGCTCTCTATCGCGGCGTTACGCCGGTGCACTTTGATAGCGCTAATGACGGTGTAGCAGCTGCCAGCGAAGCGGTTAATCTGCTGCGTGATAAAGGTTACTTGATGTCTGGTGACCTGGTGATTGTCACCCAGGGCGACGTGATGAGTACCGTGGGTTCTACTAATACCACGCGTATTTTAACGGTAGAGTAA.

[0132] (2) Kan resistance fragment with FRT: using the method of Example 2, using the pKD4 plasmid as a template, using the pyk-Kan-F primer and the pyk-Kan-R primer to perform PCR amplification, a Kan resistance fragment with FRT was obtained. The PCR reaction conditions are the same as step (1).

[0133] (3) Replacement of the target gene with a resistance fragment: using the one-step cloning kit, using one-step cloning to replace the pyk gene on the recombinant plasmid obtained in step (1) with the Kan resistance fragment with FRT obtained in step (2), a new recombinant plasmid was obtained; using the new recombinant plasmid as a template, using the primer pyk-UP-F and the primer pyk-Down-R to perform PCR, finally obtaining a Kan resistance gene fragment containing upstream and downstream homologous arms.

[0134] (4) Competent cells: using the method of Example 2, the plasmid pKD46 was transformed into E. coli Nissle 1917 AcycA AfumB1 AaspC, and competent cells were prepared.

[0135] (5) Strains with knockout of target gene: The Kan resistance gene fragment from step (3) was electrotransformed into competent cells from step (4) at 1.8KV. The electrotransformed bacterial solution was incubated at 30°C for 2h. After centrifugation at 9000rpm for 1min, 900μL of supernatant was discarded for each 1mL of bacterial solution. 50μL of the precipitate was spread on an LB plate containing 0.05mg / mL kanamycin and 0.1mg / mL ampicillin resistance and cultured at 30°C overnight. A single colony was picked as a template and PCR was performed using primers pyk-detect-F and primer Kan-R-detect. Under the same conditions, agarose gel electrophoresis analysis was performed using the base plate bacteria E. coli Nissle 1917 as a control. The results are shown in Figure 6A. DNA bands were observed in the knockout strain on a 1.0% agarose gel, while no bands were observed in the wild type, confirming the deletion of the pyk gene. Strains with knockout of cycA, fumB1, aspC, and pyk were obtained by screening.

[0136] (6) Plasmid Elimination: The strain from step (5) was inoculated into LB liquid medium containing 0.05 mg / mL kanamycin resistance and cultured at 37°C for 12 h to eliminate pKD46. The strain was then inoculated onto an LB plate containing 0.05 mg / mL kanamycin resistance and 0.1 mg / mL ampicillin and 0.05 mg / mL kanamycin resistance, and cultured at 37°C for 12 h to screen for a knockout strain that eliminated the pKD46 plasmid. Competent strains were prepared according to the method in Example 1.

[0137] (7) Elimination of resistance: The pCP20 plasmid was introduced into the competent cells of step (6) and cultured on LB plates containing 0.025 mg / mL chloramphenicol resistance at 30°C for 12 h to screen transformants. The transformants were cultured in LB liquid medium containing 0.025 mg / mL chloramphenicol resistance at 37°C for 12 h to eliminate the kanamycin resistance on the Nissle 1917 genome. The cultured bacterial solution was diluted 10 4The resulting single colony was streaked onto a 0.025 mg / mL chloramphenicol-resistant LB plate and incubated at 30°C for 12 hours. The resulting single colony was first streaked onto an LB plate containing both 0.05 mg / mL kanamycin-resistant and 0.025 mg / mL chloramphenicol-resistant strains and incubated at 30°C for 12 hours. Colonies from the dual-resistant plate were streaked onto a 0.025 mg / mL chloramphenicol-resistant LB plate and incubated at 30°C for 12 hours. Colonies that did not grow on the dual-resistant plate but did grow on the single-resistant plate were selected for colony PCR using primers pyk-UP-F and pyk-DOWN-R. Agarose gel electrophoresis was performed under the same conditions, using E. coli Nissle 1917 as a control. The results are shown in Figure 6B. The DNA band of the knockout strain was observed in a 1.0% agarose gel. The size of the band was exactly the same as that of the wild type, which means that the kanamycin resistance in the Nissle 1917 genome was eliminated.

[0138] (8) Elimination of pCP20 plasmid: The strains picked in step (7) were subjected to elimination of pCP20 plasmid according to the method of Example 2, and the non-resistant knockout strain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk was screened to obtain the strain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk. The recombinant plasmid pGLO-P J23100 -panD K43Y -aspB and pSU19-P J23100 -aspA was introduced into E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk to obtain the engineered bacteria E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk / pGLO-P J23100 -panD K43Y -aspB / pSU19-P J23100 -aspA, denoted as engineered bacteria EcN-5.

[0139] The biomass and β-alanine production of the engineered bacteria EcN-4 and EcN-5 were determined using the method of Example 2. Figure 6 As shown in C. The results showed that under the premise of blocking the flow of PEP to pyruvate, overexpression of the ppC gene from Corynebacterium glutamicum can increase the production of β-alanine. Compared with the EcN-4 strain, the yield increased by 1.14 times and reached 1.0 g / L.

[0140] Table 5: Primer sequences

[0141] Detect-F GATCAATGGTGCGATTGTCC pyk-UP-F TCCAGTCTCAGCTGGAACAT pyk-UP-R GCTCCAGCCTACACAATCGCTGGACATGTAATACTCCGTTG pyk-down-F TCCCATGTCAGCCGTTAAGTAGTAAGTACGTTGCCGGATG pyk-down-R CCGAAACTGGAAAAGCATGG pyk-Kan-F CAACGGAGTATTACATGTCCAGCGATTGTGTAGGCTGGAGC pyk-kan-R CATCCGGCAACGTACTTACTACTTAACGGCTGACATGGGA

[0142] Example 6: Construction of a recombinant plasmid expressing the aspartate ammonia lyase encoding gene (aspA) and the phosphoenolpyruvate carboxylase encoding gene (ppC) and the corresponding engineered bacteria EcN-6.

[0143] (1) PCR amplification was performed using the E. coli Nissle 1917 genome as a template using primers aspA-F and aspA-R listed in Table 6. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was digested with DpnI. The PCR product fragment was purified to obtain the target gene aspA fragment (nucleotide sequence shown in SEQ ID NO. 9).

[0144] PCR reaction conditions: pre-denaturation at 95°C for 5 min, 95°C for 30 s, 57°C for 30 s, and 72°C for 3 min, for a total of 30 cycles, and a final extension at 72°C for 10 min.

[0145] (2) PCR amplification was performed using the Corynebacterium glutamicum genome as a template using primers pSU19-vector-F and pSU19-vector-R listed in Table 6. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was digested with DpnI. The PCR product fragment was purified to obtain the target gene ppC fragment (nucleotide sequence shown in SEQ ID NO. 10).

[0146] SEQ ID NO.10

[0147]

[0148] The PCR reaction conditions were the same as in step (1).

[0149] (3) PCR amplification was performed using the pSU19 vector (a gift from Rosemary Redfield) as a template using primers pSU19-vector-R and pSU19-vector-F listed in Table 6. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was digested with DpnI. The PCR product fragment was purified to obtain the linearized pSU19 vector.

[0150] (4) Using a one-step cloning kit, the pSU19 vector from step (3) was connected to the target gene ppC fragment from step (2) to obtain the cloned recombinant plasmid pSU19-P lac -ppC (construction process and map see Figure 7 Middle A).

[0151] (5) Using the recombinant plasmid pSU19-P lac -ppC was used as a template, and PCR amplification was performed using primers pSU19-ppC-F and primers pSU19-ppc-R in Table 6. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was eliminated with DpnI. The PCR product fragment was purified to obtain the linearized vector pSU19-P lac -ppC.

[0152] PCR reaction conditions: pre-denaturation at 95°C for 5 min, 95°C for 30 s, 57°C for 30 s, and 72°C for 4 min, for a total of 30 cycles, and a final extension at 72°C for 10 min.

[0153] (6) Using a one-step cloning kit, the fragment of step (5) was connected with the target gene aspA fragment of step (1) by one-step cloning to obtain the recombinant plasmid pSU19-P lac -ppC-aspA (construction process and map see Figure 7 (as shown in A in the figure).

[0154] (7) Using recombinant plasmid pSU19-P lac -ppC-aspA was used as a template, and PCR amplification was performed using primers J23100-aspA+ppC-F and primers J23100-aspA+ppC-R. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was eliminated with DpnI. The PCR product fragment was purified to obtain the cloned recombinant plasmid pSU19-P J23100 -ppC-aspA.

[0155] PCR reaction conditions: initial denaturation at 95°C for 5 min, 95°C for 30 s, 57°C for 30 s, and 72°C for 4 min for 30 cycles, with a final extension at 72°C for 10 min. The above recombinant plasmids were verified to be correct by sequencing.

[0156] (8) The recombinant plasmid pSU19-P J23100 -ppC-aspA introduced into strain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk / pGLO-P J23100 -panD K43Y -aspB, obtained strain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk / pGLO-P J23100 -panD K43Y -aspB / pSU19-P J23100 -ppC-aspA, denoted as engineered bacteria EcN-6.

[0157] The biomass and β-alanine production of the engineered bacteria EcN-5 and EcN-6 were detected using the method of Example 2. The results are as follows: Figure 7 As shown in B. The results showed that enhancing the PEP to OAA pathway could further increase the production of β-alanine, which increased by 1.2 times compared with the EcN-5 strain, reaching 1.19 g / L.

[0158] Table 6: Primer sequences

[0159]

[0160] Example 7: Optimization of carbon and nitrogen sources in shake flask culture of engineered bacteria EcN-6 and fermentation process for producing β-alanine.

[0161] 1. The ability of different engineered bacteria to produce β-alanine

[0162] The base strain E. coli Nissle 1917 (EcN) and the engineered strains EcN-1, EcN-2, EcN-3, EcN-4, EcN-5, and EcN-6 constructed in Examples 1-6 were subjected to fermentation experiments in shake flasks to compare the β-alanine production capabilities of the strains of each genotype. The shake flask fermentation experiments were conducted according to the following protocol:

[0163] Each strain was streaked onto an LB plate containing 0.1 mg / mL ampicillin resistance and cultured overnight in a 37°C incubator. A single colony was picked and inoculated into 5 ml of LB liquid medium and cultured overnight at 200 rpm in a 37°C incubator to obtain a seed solution. LB plate medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 2 g / L agar, water as solvent, natural pH. LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, water as solvent, natural pH.

[0164] 50 ml of minimal salts M9 medium was added to a 250 ml shake flask, and 1 ml of seed solution was inoculated into the minimal salts M9 medium in the shake flask. The shake flask was then incubated at 200 rpm in a 37°C incubator for 24 hours. 1 ml of liquid was collected from the shake flask and centrifuged at 9000 rpm for 1 minute. The supernatant was collected and derivatized. After filtration through an organic membrane with a pore size of 0.45 μm, the filtrate was analyzed for β-alanine content in the fermentation broth by HPLC as described in Example 2. Finally, the amount of β-alanine obtained by each plasmid-carrying strain was compared. The results are shown in Table 2. Figure 8 Middle A.

[0165] Minimal salts M9 medium composition: K2HPO4·3H2O 14 g / L, KH2PO4 5.2 g / L, (NH4)2SO4 2 g / L, MgSO4 0.3 g / L, tryptone 1 g / L, solvent is ddH2O, pH 7.0.

[0166] After fermentation, with the exception of the Nissle 1917 strain, which showed no detectable production, all other modified strains were capable of producing β-alanine. Furthermore, modifications to the β-alanine transport system significantly improved the strains' tolerance to high β-alanine concentrations. The modified strains all achieved varying degrees of improvement in β-alanine production compared to the original strain.

[0167] 2. Carbon source optimization

[0168] Carbon source optimized culture medium: 10 g / L carbon source, K2HPO4·3H2O 14 g / L, KH2PO4 5.2 g / L, (NH4)2SO4 2 g / L, MgSO4 0.3 g / L, tryptone 1 g / L, solvent is ddH2O, pH 7.0.

[0169] Select dextrin, sucrose, starch, glycerol, fructose, lactose, and glucose as carbon sources, and add 50 ml of carbon source optimized medium to a 250 ml shake flask. Inoculate 1 ml of the seed solution prepared in step 1 into the shake flask containing the carbon source optimized medium, and culture it in an incubator at 37°C at a speed of 200 rpm for 24 hours. Take 1 ml of liquid from the shake flask, centrifuge it at 9000 rpm for 1 minute, take the supernatant, and analyze the content of β-alanine in the fermentation broth using the method in step 1. The results are as follows: Figure 8 As shown in B, the results show that the optimal carbon source is 10 g / L glycerol.

[0170] 3. Nitrogen source optimization

[0171] Nitrogen source optimized culture medium: 2 g / L nitrogen source, 10 g / L glucose, 14 g / L K2HPO4·3H2O, 5.2 g / L KH2PO4, 0.3 g / L MgSO4, solvent is ddH2O, pH 7.0.

[0172] Select 2g / L urea, 2g / L ammonium chloride, 2g / L ammonium sulfate, 2g / L peptone, 2g / L yeast powder, 1g / L urea and 1g / L peptone, 1g / L ammonium chloride + 1g / L peptone, 1g / L ammonium sulfate + 1g / L peptone, 1g / L urea + 1g / L yeast powder, 1g / L ammonium chloride + 1g / L yeast powder, 1g / L ammonium sulfate + 1g / L yeast powder as nitrogen sources. Add 50ml of nitrogen source optimized culture medium to a 250ml shake flask. Inoculate 1ml of seed liquid into the shake flask, culture at a speed of 200rpm in an incubator at 37℃ for 24 hours, take 1ml of liquid from the shake flask, centrifuge at 9000rpm for 1min, take the supernatant, and use the step 1 method to analyze the content of β-alanine in the fermentation broth. The results are as follows: Figure 8 As shown in C, the optimal nitrogen source is the combination of NH4Cl and yeast powder.

[0173] Therefore, the optimized fermentation medium composition was: glycerol 10 g / L, K2HPO4·3H2O 14 g / L, KH2PO4 5.2 g / L, MgSO4 0.3 g / L, NH4Cl 1 g / L, yeast powder 1 g / L, solvent was ddH2O, and pH value was 7.0.

[0174] 4. Comparison of optimized culture media

[0175] 1 ml of the seed solution of EcN and EcN-6 prepared in step 1 was inoculated into a shake flask containing the optimized fermentation medium, and cultured at 200 rpm in a 37°C incubator for 24 hours. 1 ml of the liquid was taken from the shake flask, centrifuged at 9000 rpm for 1 minute, and the supernatant was taken. The β-alanine content in the fermentation broth was analyzed using the method in step 1. The HPLC chart of the EcN-6 fermentation broth is shown in FIG. Figure 8As shown in Figure 8E, the HPLC chromatograms of β-alanine standards at different concentrations are shown in Figure 8D.

[0176] Under the same conditions, the optimized fermentation medium was replaced with the basic M9 medium in step 1, and the content of β-alanine was detected. The results were as follows: Figure 8 As shown in G.

[0177] After the transformation, the strain EcN-6 with the best performance produced β-alanine at a level of 2.14±0.1 g / L in the optimized fermentation medium, which was lower than the detection limit of the bottom plate bacteria (see Figure 8 Middle F).

[0178] Example 8: Fed-batch fermentation of the engineered bacteria EcN-6 in a 5 L fermenter.

[0179] (1) Activation culture:

[0180] E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk / pGLO-P stored in glycerol at -80℃ J23100 -panD K43Y -aspB / pSU19-P J23100 The -aspA-ppC strain was streaked onto LB plate culture medium and activated and cultured overnight in an incubator at 37°C to obtain activated bacteria; LB plate culture medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 2 g / L agar, solvent is water, and pH is natural.

[0181] (2) Seed culture: freshly activated bacteria from step (1) were selected and inoculated into a LB liquid culture medium test tube. The culture was cultured overnight at 37°C and a shaker speed of 220 r / min. The culture was then transferred to a 250 mL Erlenmeyer flask containing 50 mL of LB liquid culture medium at an inoculum concentration of 1% by volume. The culture was cultured overnight at 37°C and a shaker speed of 220 r / min to obtain a seed solution. LB liquid culture medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, the solvent was water, and the pH value was natural.

[0182] (3) Fed-batch fermentation culture:

[0183] According to the inoculum concentration of 5% by volume, the seed solution of step (2) was inoculated into a 5L fermenter containing 2L of fermenter medium. The culture temperature was 37°C, pH 7.0, and the dissolved oxygen value was maintained at 20%. After 10 hours of fermentation, the feed medium was added at a rate of 50mL / min to maintain the residual glucose concentration in the fermenter at 3-4g / L until the end of fermentation. The total fermentation time was 60 hours, and a total of 1L of feed medium was consumed. During the feeding process, samples were taken every 3 hours to measure the cell growth OD600 , glucose residual sugar content (residual sugar analyzer) and β-alanine concentration (same as Example 2 HPLC). Figure 9 As shown, OD 600 When the plant grows to about 16.6, the production of β-alanine reaches 12g / L.

[0184] Fermenter medium: 50 g / L glucose, K2HPO4·3H2O 28 g / L, KH2PO4 10.4 g / L, NH4Cl 4 g / L, MgSO4 0.6 g / L, tryptone 2 g / L, YEAST EXTRACT (yeast powder) 4 g / L, 1 mL 10× metal ion, 1 mL / L organic silica gel defoamer, solvent is water.

[0185] 10× metal ion formula: Weigh 10 g CaCl2, 10 g FeSO4·7H2O, 1 g ZnSO4·7H2O, 0.2 g CuSO4 and 0.02 g NiCl2·7H2O and dissolve in 100 mL ddH2O.

[0186] The composition of the feed medium was as follows: glucose 250 g / L, glycerol 250 g / L, yeast extract 4 g / L, KH2PO4 14 g / L, NH4Cl 10 g / L, MgSO4 0.3 g / L, defoamer 1 mL / L, the defoamer was an organic silica defoamer, and the solvent was water.

Claims

1. An engineered bacterium for high β-alanine production, characterized in that: The engineered bacteria are one of the following: (1) using E. coli Nissle 1917 as the base bacteria, using plasmid pGLO and promoter P J23100 Overexpression of panD mutant gene, namely engineered bacteria ECN-1; (2) Using E. coli Nissle1917 as the chassis bacteria, knocking out the cycA gene in the genome, using plasmid pGLO and promoter P J23100 Overexpression of panD mutant gene, namely engineered bacteria ECN-2; (3) Using E. coli Nissle 1917 as the base bacteria, knocking out the cycA gene and fumB1 gene in the genome, using plasmid pGLO and promoter P J23100 Overexpression of panD mutant gene was carried out by using plasmid pSU19 and promoter P J23100 Overexpression of aspA gene, namely engineered bacteria ECN-3; (4) Using E. coli Nissle1917 as the base bacteria, knocking out the cycA gene, fumB1 gene and aspC gene in the genome, using plasmid pGLO and promoter P J23100 Overexpression of panD mutant gene and aspB gene was carried out by plasmid pSU19 and promoter P J23100 Overexpression of aspA gene, namely the engineered bacteria ECN-4; (5) Using E. coli Nissle 1917 as the base bacteria, knocking out the cycA gene, fumB1 gene, aspC gene and pyk gene in the genome, using plasmid pGLO and promoter P J23100 Overexpression of panD mutant gene and aspB gene was carried out using plasmid pSU19 and promoter P J23100 Overexpression of aspA gene, namely engineered bacteria ECN-5; (6) Using E. coli Nissle1917 as the base bacteria, knocking out the cycA gene, fumB1 gene, aspC gene and pyk gene in the genome, using plasmid pGLO and promoter P J23100 Overexpression of panD mutant gene and aspB gene was carried out using plasmid pSU19 and promoter P J23100 The aspA gene and the ppC gene are overexpressed, namely the engineered strain ECN-6; the nucleotide sequences of the above panD mutant genes are all shown in SEQ ID NO.

1.

2. The engineered bacterium for high β-alanine production according to claim 1, wherein The nucleotide sequence of the cycA gene is shown as 1007-2419 bp in SEQ ID NO.4, the nucleotide sequence of the fumB1 gene is shown as 1004-2650 bp in SEQ ID NO.5, the nucleotide sequence of the aspC gene is shown as 1022-2212 bp in SEQ ID NO.6, and the nucleotide sequence of the pyk gene is shown as 987-2429 bp in SEQ ID NO.7; the nucleotide sequence of the aspB gene is shown as SEQ ID NO.8, the nucleotide sequence of the aspA gene is shown as SEQ ID NO.9; and the nucleotide sequence of the ppC gene is shown as SEQ ID NO.

10.

3. The engineered bacterium for high β-alanine production according to claim 1, wherein The promoter P J23100 The nucleotide sequence is shown in SEQ ID NO.

3.

4. Use of the engineered bacteria with high β-alanine production according to claim 1 in fermentation to produce β-alanine.

5. The use according to claim 4, characterized in that The application comprises the following steps: inoculating the engineered bacteria with high β-alanine production into a fermentation medium, performing shake flask fermentation at 37° C. and 200-220 rpm for more than 12 hours, and obtaining a fermentation liquid containing β-alanine after the fermentation is completed; the fermentation medium comprises: 10 g / L glycerol, 14 g / L K2HPO4·3H2O, 5.2 g / L KH2PO4, 0.3 g / L MgSO4, 1 g / L NH4Cl, 1 g / L yeast powder, the solvent is ddH2O, and the pH value is 7.

0.

6. The use according to claim 5, characterized in that The fermentation is carried out in a fermentor. The engineered bacteria with high β-alanine production are first inoculated into a fermentor medium. After fermentation for 10 hours at 37° C., pH 6-8, and a dissolved oxygen value of 20%-50%, feed medium is added at a rate of 40-60 mL / min until the fermentation is completed, thereby obtaining a fermentation broth containing β-alanine. The fermentation tank culture medium includes: 50 g / L glucose, 28 g / L K2HPO4·3H2O, 10.4 g / L KH2PO4, 4 g / L NH4Cl, 0.6 g / L MgSO4, 2 g / L tryptone, 4 g / L yeast extract, 1 mL / L 10× metal ion, and 1 mL / L organic silica gel defoamer, with water as the solvent; the 10× metal ion formula includes: 10 g CaCl2, 10 g FeSO4·7H2O, 1 g ZnSO4·7H2O, 0.2 g CuSO4, and 0.02 g NiCl2·7H2O dissolved in 100 mL ddH2O; The feed medium consists of 250 g / L glucose, 250 g / L glycerol, 4 g / L yeast extract, 14 g / L KH2PO4, 10 g / L NH4Cl, 0.3 g / L MgSO4, and 1 mL / L defoamer, wherein the defoamer is an organic silica gel defoamer, and the solvent is water.

7. The use according to claim 6, characterized in that The amount of feed medium added is such that the residual glucose concentration in the fermentation broth is maintained at 3-4 g / L.

8. The use according to claim 6 or 7, characterized in that The engineered bacteria are first activated on a slant and cultured for seed expansion before fermentation, and then the seed solution is inoculated into the fermentation medium at a volume concentration of 1-2%. (1) The engineered bacteria were inoculated on an LB plate containing 0.1 mg / mL ampicillin resistance and cultured in a 37°C incubator overnight; the LB plate medium consisted of 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, and 2 g / L agar, with water as the solvent and a natural pH value; (2) A single colony from step (1) was inoculated into LB liquid culture medium and cultured overnight at 200 rpm in a 37°C incubator to obtain a seed solution; the LB liquid culture medium consisted of 10 g / L peptone, 5 g / L yeast extract, and 10 g / L NaCl, with water as the solvent and a natural pH value.

Images