Application of Fatty Acid Anabolic Pathway Inhibitor in the Differentiation of Definitive Endoderm Cells

Abstract

The present invention discloses the application of fatty acid synthesis metabolic pathway inhibitors in the differentiation of definitive endoderm cells, and also discloses a culture medium and a culture method for the in vitro directed differentiation of mammalian pluripotent stem cells into definitive endoderm cells. The culture medium comprises a basal medium and an inhibitor of the fatty acid synthesis metabolic pathway; the culture method is to culture mammalian pluripotent stem cells using the above-mentioned culture medium to enable their directed differentiation into definitive endoderm cells. By adding the fatty acid synthesis metabolic pathway inhibitor Firsocostat or C75 to the basal medium, the present invention improves the efficiency of differentiating mammalian pluripotent stem cells into definitive endoderm cells. The differentiation method provided by the present invention has good repeatability and low cost, and improves the efficiency of differentiating mammalian pluripotent stem cells into definitive endoderm. This provides low-cost and highly efficient research materials for studying early embryonic development, organ transplantation, and drug screening, etc.

Description

Technical Field

[0001] The present invention relates to the fields of stem cells and regenerative medicine, and particularly to the application of fatty acid synthesis and metabolism pathway inhibitors in the differentiation of definitive endoderm cells. Background Art

[0002] Pluripotent embryonic stem cells (ESCs) are a type of cells isolated from early embryos, which have the potential for self-renewal and multi-directional differentiation. The in vitro differentiation system of pluripotent stem cells provides important research materials and technical support for the research in the field of regenerative medicine including early embryonic development, disease models, and organ transplantation. During in vitro culture, pluripotent stem cells can be induced to form definitive endoderm cells and further differentiate into cells such as the pancreas and liver. The cells differentiated and matured in vitro have normal functions, which provides a new idea for the treatment of diseases such as diabetes through cell transplantation. Therefore, in order to obtain the desired cells, it is particularly important to improve the differentiation efficiency of definitive endoderm.

[0003] During the differentiation of embryonic stem cells, the intracellular fatty acid metabolism state changes significantly, and this change in the metabolic state appears even earlier than the expression fluctuations of transcription factors. Thus, it shows that fatty acid metabolism plays an important role in the differentiation of embryonic stem cells. Firsocostat and C75 respectively inhibit the enzyme activities of the key proteins fatty acid synthase (FASN) and acetyl-CoA carboxylase (ACC) in the fatty acid synthesis process, thereby reducing the level of intracellular fatty acid synthesis and increasing the level of the substrate acetyl-CoA, thus having an important impact on processes such as cell proliferation and cell differentiation.

[0004] At present, the culture system for differentiating pluripotent stem cells into definitive endoderm has been relatively mature, and a certain proportion of endoderm cells can be obtained by adding growth factors such as Activin A to the basal medium. However, the current growth factors mainly play a role in promoting differentiation through signal pathways, and this culture method is time-consuming and has low efficiency. Therefore, it is particularly important to establish an efficient and rapid culture method to obtain definitive endoderm cells for the research of embryonic development and regenerative medicine. Summary of the Invention

[0005] The object of the present invention is to provide the application of fatty acid synthesis and metabolism pathway inhibitors in the differentiation of definitive endoderm cells. Based on the effect of fatty acid synthesis and metabolism pathway inhibitors in improving the differentiation efficiency of mammalian pluripotent stem cells into definitive endoderm cells, the object of the present invention is also to provide a culture medium and a culture method for differentiating mammalian pluripotent stem cells into definitive endoderm cells.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] In the first aspect of the present invention, there is provided the use of a fatty acid anabolic pathway inhibitor in enhancing the efficiency of differentiation of mammalian pluripotent stem cells into definitive endoderm cells. The fatty acid anabolic pathway inhibitor is preferably Firsocostat or C75. The concentration of Firsocostat is preferably 5 - 10 nM; the concentration of C75 is preferably 2.5 - 5 μM.

[0008] In the second aspect of the present invention, there is provided a culture medium for differentiating mammalian pluripotent stem cells into definitive endoderm cells, the culture medium comprising: a basal medium, a fatty acid anabolic pathway inhibitor. The fatty acid anabolic pathway inhibitor is preferably Firsocostat or C75.

[0009] Furthermore, the culture medium further comprises: Activin A, Wnt3a protein. Even further, the culture medium further comprises fatty acid-free bovine serum albumin and penicillin-streptomycin.

[0010] Furthermore, the concentration of Firsocostat is preferably 5 - 10 nM, the concentration of C75 is preferably 2.5 - 5 μM. The concentration of Activin A is preferably 100 ng / mL, the concentration of Wnt3a protein is preferably 25 ng / μL. The concentration of fatty acid-free bovine serum albumin is preferably 0.2%, and the concentration of penicillin-streptomycin is preferably 1%.

[0011] Specifically, the mammalian pluripotent stem cells include: one of human pluripotent stem cells, primate pluripotent stem cells, mouse pluripotent stem cells, rat pluripotent stem cells, canine pluripotent stem cells, feline pluripotent stem cells, porcine pluripotent stem cells, bovine pluripotent stem cells, and equine pluripotent stem cells.

[0012] In the third aspect of the present invention, there is provided a culture method for differentiating mammalian pluripotent stem cells into definitive endoderm cells, the method comprising the following steps: culturing mammalian pluripotent stem cells using the culture medium to differentiate into definitive endoderm cells.

[0013] Furthermore, the method comprises the following steps:

[0014] Culturing mammalian pluripotent stem cells in a stem cell maintenance medium for 3 - 7 days, digesting and re-seeding them in a well plate coated with Matrigel, and culturing them in the stem cell maintenance medium for 1 - 2 days;

[0015] When the cell density reaches 75 - 85%, replace it with the above-mentioned culture medium for culturing to obtain definitive endoderm cells.

[0016] In the above technical solution, the stem cell maintenance medium can specifically be mTeSR TM 1 or E8 + 1% double antibody. Matrigel is coated in the well of the plate at a dilution ratio of 1:100. In other embodiments, the addition ratio can also be appropriately adjusted.

[0017] In the above technical solution, for a 24-well plate, cells are seeded into the 24-well plate coated with Matrigel at a density of 1×10 5 per well; in other embodiments, for different culture dishes, the number of seeded cells should be appropriately adjusted.

[0018] The CAS number of Firsocostat of the present invention is 1434635-54-7; the CAS number of C75 is 218137-86-1.

[0019] The present invention has at least the following technical effects or advantages:

[0020] The application of the fatty acid synthesis and metabolism pathway inhibitor provided by the present invention in the differentiation of definitive endoderm cells is to add the fatty acid synthesis and metabolism pathway inhibitor Firsocostat or C75 to the basal medium to improve the differentiation efficiency of mammalian pluripotent stem cells into definitive endoderm cells; specifically:

[0021] (1) Adding Firsocostat or C75 to the medium enables a relatively high differentiation efficiency to be achieved on the 3rd or 4th day of pluripotent stem cell differentiation, which can shorten the differentiation time.

[0022] (2) The medium provided by the present invention differentiates mammalian pluripotent stem cells into definitive endoderm cells in an efficient and stable manner. This provides high-efficiency research materials for in vitro research on early embryonic development, regenerative medicine, drug screening, etc., which will greatly promote the research and application of clinical cell therapy and has good application prospects. Description of the Drawings

[0023] Figure 1 Quantitative PCR results showing the effect of Firsocostat on the expression of endoderm differentiation marker genes in human embryonic stem cells for comparison between Example 1 and Comparative Example 1;

[0024] Figure 2 Flow cytometry results showing the effect of Firsocostat on the positive rate of endoderm differentiation in human embryonic stem cells for comparison between Example 1 and Comparative Example 1;

[0025] Figure 3 Quantitative PCR results showing the effect of C75 on the expression of endoderm differentiation marker genes in human embryonic stem cells for comparison between Example 2 and Comparative Example 2;

[0026] Figure 4 Flow cytometry results showing the effect of C75 on the positive rate of endoderm differentiation in human embryonic stem cells, as compared between Example 2 and Comparative Example 2;

[0027] Figure 5 Immunofluorescence results showing the effect of C75 on the expression of endoderm differentiation marker genes, as compared between Example 2 and Comparative Example 2;

[0028] Figure 6 Flowchart of the culture method for differentiating mammalian pluripotent stem cells into definitive endoderm cells according to the present invention. Detailed Description of the Invention

[0029] To more clearly demonstrate the advantages and various effects of the present invention, the present invention will be described below in conjunction with specific embodiments and examples. For those skilled in the art, these specific embodiments and examples are used to illustrate the present invention, rather than to limit the present invention.

[0030] The terms used in this specification, unless otherwise specified, should be understood as having the meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as the general understanding of those skilled in the art to which the present invention pertains. In case of conflict, this specification shall prevail.

[0031] Unless otherwise specifically stated, various raw materials, reagents, instruments, and equipment used in the present invention can be obtained through market purchase or by existing methods.

[0032] The following will detail a culture medium and a culture method for differentiating mammalian pluripotent stem cells into definitive endoderm cells according to the present application, in conjunction with examples, comparative examples, and experimental data.

[0033] Example 1

[0034] 1. A culture medium for differentiating human pluripotent stem cells into definitive endoderm cells

[0035] The culture medium is based on DMEM / F12 and further includes the following components: 100 ng / mL Activin A, 25 ng / μL Wnt3a, 0.2% fatty acid-free bovine serum albumin, 1% double antibody, and 5 or 10 nM Firsocostat (FIRSO).

[0036] 2. A culture method for differentiating human pluripotent stem cells into definitive endoderm cells, using the above culture medium for culturing, specifically including the following steps:

[0037] (1) Human embryonic stem cells HUES8 (Cowan CA, Klimanskaya I, McMahon J, Atienza J, Witmyer J, Zucker JP, Wang S, Morton CC, McMahon AP, Powers D, Melton DA. Derivation of embryonic stem-cell lines from human blastocysts. N Engl J Med. 2004 Mar 25; 350(13):1353-6. doi:10.1056 / NEJMsr040330.) were cultured using mTeSR TM 1 + 1% double antibody as a stem cell maintenance medium and cultured on Matrigel (BD Bioscience) at a dilution ratio of 1:100.

[0038] (2) When the human embryonic stem cells in step (1) were cultured to a cell density of about 80%-90% of the bottom area of the well plate, dead cells were washed away with DPBS, and then incubated with Accutase in a 37°C cell culture incubator for about 3 minutes until the cells were spherical under the microscope. DMEM / F12 medium was added to terminate digestion and the cells were pipetted and resuspended. The cells were centrifuged at 1000 rpm for 3 min, and then resuspended with mTeSR TM 1 + 1% double antibody. After counting, the cells were seeded into a 24-well plate coated with Matrigel at a density of 1×10 5 per well.

[0039] (3) When the cells in step (2) were cultured for 1-2 days until the cell density reached about 80% of the bottom area of the well plate, the above freshly prepared medium was replaced to start definitive endoderm differentiation, denoted as differentiation D0.

[0040] (4) The above fresh medium was replaced every 24 hours, and definitive endoderm cells could be obtained at D3.

[0041] Comparative Example 1

[0042] In this Comparative Example 1, except that Firsocostat was not added to the differentiation medium, other steps were the same as in Example 1.

[0043] Example 2

[0044] 1. A medium for differentiating human pluripotent stem cells into definitive endoderm cells

[0045] This culture medium is based on DMEM / F12 and also includes the following components: 100 ng / mL Activin A, 25 ng / μL Wnt3a, 0.2% fatty acid-free bovine serum albumin, 1% double antibody, and 2.5 or 5 μM C75.

[0046] 2. A culture method for differentiating human pluripotent stem cells into definitive endoderm cells, which uses the above-mentioned culture medium for culture, and specifically includes the following steps:

[0047] (1) Human embryonic stem cells HUES8 are cultured using mTeSR TM 1 + 1% double antibody as a stem cell maintenance medium and cultured on Matrigel (BD Bioscience) at a dilution ratio of 1:100.

[0048] (2) When the human embryonic stem cells in step (1) are cultured to a cell density of about 80%-90% of the bottom area of the well plate, dead cells are washed away with DPBS, and then incubated with Accutase in a 37°C cell culture incubator for about 3 minutes until the cells are spherical under a microscope. DMEM / F12 medium is added to terminate digestion and the cells are pipetted and resuspended. Centrifuge at 1000 rpm for 3 min, and then resuspend the cell pellet with mTeSR TM 1 + 1% double antibody. After counting, the cells are seeded into a 24-well plate coated with Matrigel at a density of 1×10 5 per well.

[0049] (3) When the cells in step (2) are cultured for 1-2 days until the cell density reaches about 80% of the bottom area of the well plate, the above-mentioned freshly prepared culture medium is replaced to start definitive endoderm differentiation, denoted as differentiation D0.

[0050] (4) Freshly replace the above-mentioned culture medium every 24 hours, and definitive endoderm cells can be obtained at D3.

[0051] Comparative Example 2

[0052] In this Comparative Example 2, except that C75 is not added to the differentiation medium, other steps are the same as those in Example 2.

[0053] Experimental Example 1

[0054] Detect the mRNA level or differentiation efficiency of the marker genes of the definitive endoderm cells obtained in each example and each comparative example.

[0055] I. The detection method is as follows:

[0056] 1. Detect the mRNA level of the marker genes of the definitive endoderm cells obtained by real-time fluorescence quantitative PCR:

[0057] (1) Cell collection

[0058] Wash the specified definitive endoderm cells obtained at D3 with DPBS to remove dead cells, and then add TrypLE and incubate in a 37 °C cell culture incubator for 1 min. Gently pipette the cells with DMEM / F12 medium to terminate digestion, collect the cells in a 1.5 mL EP tube, centrifuge at 4 °C and 3000 rpm for 3 min, and aspirate the supernatant to obtain a cell pellet.

[0059] (2) Total RNA extraction from cells

[0060] Use the Total RNA Mini Kit (dual-column type) from Meiji Bio to extract RNA from cells. The specific operation steps are as follows:

[0061] Take an appropriate amount of Buffer RL and add it to the cell pellet, and pipette thoroughly. Transfer the above liquid to a gDNA filtration column and centrifuge at 14000 g for 2 min; discard the gDNA filtration column, add an equal volume of 70% ethanol and pipette evenly; transfer the above liquid to an RNA purification column and centrifuge at 12000 g for 1 min, discard the filtrate; reinstall the RNA purification column into the collection tube, add 500 μL of Buffer RW1 to the RNA purification column and centrifuge at 12000 g for 1 min, discard the filtrate; reinstall the RNA purification column into the collection tube, add 500 μL of Buffer RW2 to the RNA purification column and centrifuge at 12000 g for 1 min, discard the filtrate; reinstall the RNA purification column into the collection tube, add 500 μL of Buffer RW2 to the RNA purification column and centrifuge at 12000 g for 1 min, discard the filtrate; reinstall the RNA purification column into the collection tube and centrifuge at 12000 g for 2 min. Transfer the RNA purification column to a new 1.5 mL EP tube, add 30 μL of RNase-Free Water to the center of the purification column, and let it stand at room temperature for 2 min; centrifuge at 12000 g for 1 min, discard the filtration column, detect the RNA concentration and quality, and store at -80 °C. The above steps are all carried out on ice.

[0062] (3) Reverse transcription to obtain cDNA

[0063] Use the Abclonal reverse transcription kit to prepare cDNA. The specific operation steps are as follows:

[0064] Add 4 μL of Abclonal's 5×qRT SuperMix and 1 μg of the above-obtained RNA to an EP tube, add RNase-Free Water to make up the volume to 20 μL, mix well and centrifuge with a handheld centrifuge until the liquid aggregates at the bottom of the tube, and carry out a reverse transcription reaction in a Bio-rad PCR instrument. The reverse transcription conditions are 25 °C for 5 min; 42 °C for 20 min; 85 °C for 5 sec. After completion, store at -20 °C.

[0065] (4) Real-time fluorescence quantitative PCR

[0066] Add 20 ng of the above cDNA, 5 μL of Bimake 2×SYBR Green qPCR MasterMix, 0.5 μL of 5 μM forward primer, and 0.5 μL of 5 μM reverse primer to each well of a 384-well plate, and add RNase-Free Water to make the volume up to 10 μL; use a CFX384 quantitative PCR instrument from Bio-rad for amplification, and the reaction conditions are: 95°C for 5 min, 95°C for 15 s, 60°C for 30 s, and repeat 39 cycles. The experimental results were analyzed using the ΔΔCT method compared with the housekeeping gene GAPDH.

[0067] The primer sequences used in this experiment are as follows:

[0068] GAPDH forward primer AATGAAGGGGTCATTGATGG (as shown in SEQ ID NO.1), reverse primer AAGGTGAAGGTCGGAGTCAA (as shown in SEQ ID NO.2);

[0069] FOXA2 forward primer GGAGCAGCTACTATGCAGAGC (as shown in SEQ ID NO.3), reverse primer CGTGTTCATGCCGTTCATCC (as shown in SEQ ID NO.4);

[0070] SOX17 forward primer GCATGACTCCGGTGTGAATCT (as shown in SEQ ID NO.5), reverse primer TCACACGTCAGGATAGTTGCAGT (as shown in SEQ ID NO.6);

[0071] CXCR4 forward primer TACACCGAGGAAATGGGCTCA (as shown in SEQ ID NO.7), reverse primer AGATGATGGAGTAGATGGTGGG (as shown in SEQ ID NO.8).

[0072] 2. Detect the efficiency of human embryonic stem cell differentiation into definitive endoderm by flow cytometry:

[0073] Wash the specified definitive endoderm cells obtained from the differentiation with DPBS to remove dead cells, then add TrypLE and incubate in a 37 °C cell culture incubator for 1 min. Gently pipette the cells with DPBS + 2% FBS to terminate digestion, and evenly divide and collect the cells into two 1.5 mL EP tubes. Centrifuge at 4 °C and 3000 rpm for 3 min, and aspirate the supernatant. Dilute the CXCR4-APC, SOX17-FITC, and APC-Isotype (negative control group) antibodies with DPBS + 2% FBS at a dilution ratio of 1:200. Take 200 μL of the diluted antibody each and resuspend and mix the cell pellet, then incubate in the dark on ice for 30 min. Centrifuge at 4 °C and 3000 rpm for 3 min, discard the supernatant, resuspend the cells with DPBS + 2% FBS, centrifuge at 4 °C and 3000 rpm for 3 min, and discard the supernatant. Finally, resuspend the cells with ice-cold DPBS and transfer them to a flow tube, and detect the positive rate of CXCR4 by flow cytometry. The antibodies used in this experiment are Anti-CXCR4 (555976, 1:200, BD Biosciences) and Anti-SOX17 (AF1924, 1:200, R&D).

[0074] 3. Detect the efficiency of human embryonic stem cell differentiation into definitive endoderm by immunofluorescence:

[0075] Wash the specified definitive endoderm cells obtained from the differentiation with DPBS to remove dead cells. Add an appropriate amount of 4% PFA to each well and incubate at room temperature for 15 min, then wash once with DPBS; add an appropriate amount of blocking solution (8.7 mL DPBS + 1 mL donkey serum + 0.3 mL 10% Triton-X100) to each well and incubate at room temperature for 30 min; discard the blocking solution, add an appropriate amount of primary antibody diluted with the blocking solution, and incubate at room temperature for 2 h, then wash three times with DPBS, 5 min each time; discard the DPBS, add an appropriate amount of secondary antibody diluted with the blocking solution, and incubate in the dark at room temperature for 2 h, then wash three times with DPBS, 5 min each time; discard the DPBS, add an appropriate amount of DAPI diluted with DPBS, and incubate in the dark at room temperature for 10 min, then wash once with DPBS; finally, soak the cells with DPBS, place them under an inverted fluorescence microscope for fluorescence observation and image acquisition. The primary antibodies used in this experiment are Anti-FOXA2 (ET1703-76, 1:200, HuaBio); Anti-OCT4 (sc-5279, 1:200, SANTA CRUZ). The fluorescent secondary antibodies used in this experiment are DoαMs TRITC (1:200, Jackson ImmunoResearch); DoαRb 488 (1:200, Jackson ImmunoResearch); nuclear dye: DAPI (Roche, USA).

[0076] II. Test Results and Analysis

[0077] 1. Example 1 and Comparative Example 1

[0078] Detect the mRNA and protein expression levels of definitive endoderm marker genes in the cells of Example 1 and Comparative Example 1. The specific results are shown in Figure 1-2 .

[0079] Figure 1 shows the mRNA expression levels of definitive endoderm marker genes FOXA2, SOX17, and CXCR4 in the cells of Example 1 and Comparative Example 1, where "FIRSO-0nM" is Comparative Example 1. The results show that compared with 1-fold of the comparative example, the addition of 5 and 10 nM of Firsocostat in Example 1 increased the expression level of FOXA2 by 1.4 and 1.4 times, the expression level of SOX17 by 1.2 and 1.4 times, and the expression level of CXCR4 by 1.6 and 1.8 times, respectively.

[0080] Figure 2 shows the flow cytometry results of the proportion of SOX17 and CXCR4 double-positive cells, which are definitive endoderm marker genes, in the cells of Example 1 and Comparative Example 1. Compared with the 45% positive rate of the comparative example "FIRSO-0nM", with the addition of Firsocostat in Example 1, the proportion of SOX17 and CXCR4 double-positive cells increased significantly in a concentration-dependent manner. When the addition concentration of Firsocostat was 10 nM, the proportion of double-positive cells in Example 1 increased by 20%.

[0081] Figure 1 and Figure 2 The results both show that the addition of Firsocostat can significantly promote the differentiation of definitive endoderm and has concentration dependence.

[0082] 2. Example 2 and Comparative Example 2

[0083] Detect the mRNA and protein expression levels of definitive endoderm marker genes in the cells of Example 2 and Comparative Example 2. The specific results are shown in Figures 3-5 .

[0084] Figure 3 shows the mRNA expression levels of definitive endoderm marker genes FOXA2, SOX17, and CXCR4 in the cells of Example 2 and Comparative Example 2, where "C75-0μM" is Comparative Example 2. The results show that compared with 1-fold of the comparative example, the addition of 2.5 and 5 μM of C75 in Example 2 increased the expression level of FOXA2 by 1.2 and 1.2 times, the expression level of SOX17 by 1.2 and 1.5 times, and the expression level of CXCR4 by 1.4 and 1.5 times, respectively.

[0085] Figure 4Flow cytometry results of the proportion of definitive endoderm marker genes SOX17 and CXCR4 double-positive cells in Example 2 and Comparative Example 2. Compared with the 45% positive rate of the comparative example "C75-0 μM", with the addition of C75 in Example 2, the proportion of SOX17 and CXCR4 double-positive cells increased significantly in a concentration-dependent manner. When the added concentration of C75 was 5 nM, the proportion of double-positive cells in the example increased by 15%.

[0086] Figure 5 Immunofluorescence results of the proportion of definitive endoderm marker gene FOXA2 and pluripotency marker gene OCT4 positive cells in Example 2 and Comparative Example 2. The results showed that compared with Comparative Example 2, after adding C75 during the differentiation process, the positive rate of the pluripotency gene OCT4 decreased significantly, and the positive rate of the definitive endoderm marker gene FOXA2 increased significantly.

[0087] Figures 3-5 The results all showed that the addition of C75 could significantly promote the differentiation of definitive endoderm and was concentration-dependent.

[0088] Finally, it should also be noted that the term "comprising", "including" or any other variant thereof is intended to cover non-exclusive inclusion, so that a process, method, article or device comprising a series of elements not only includes those elements but also includes other elements not expressly listed, or also includes elements inherent to such process, method, article or device.

[0089] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these embodiments once they know the basic creative concept. Therefore, the appended claims are intended to be construed as including the preferred embodiments and all changes and modifications falling within the scope of the present invention.

[0090] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. Use of a fatty acid anabolic pathway inhibitor in enhancing the efficiency of differentiation of human pluripotent stem cells into definitive endoderm cells in vitro, characterized in that: The fatty acid anabolism pathway inhibitor is Firsocostat or C75; the human pluripotent stem cell is the human embryonic stem cell HUES8.

2. The application according to claim 1, characterized in that, The concentration of Firsocostat is 5 - 10 nM; the concentration of C75 is 2.5 - 5 μM.

3. A culture medium for differentiating human pluripotent stem cells into definitive endoderm cells, characterized in that, The culture medium comprises: basal medium DMEM / F12, 100 ng / mL Activin A, 25 ng / μL Wnt3a, 0.2% fatty acid-free bovine serum albumin, 1% double antibody, and a fatty acid anabolism pathway inhibitor; the fatty acid anabolism pathway inhibitor is Firsocostat or C75, the concentration of Firsocostat is 5 - 10 nM, and the concentration of C75 is 2.5 - 5 μM.

4. A culture method for differentiating human pluripotent stem cells into definitive endoderm cells, characterized in that, The method comprises the following steps: culturing human pluripotent stem cells with the culture medium described in claim 3 to direct their differentiation into definitive endoderm cells; the human pluripotent stem cell is the human embryonic stem cell HUES8.

5. The culture method for differentiating human pluripotent stem cells into definitive endoderm cells according to claim 4, characterized in that, The method comprises the following steps: culturing human pluripotent stem cells with a stem cell maintenance medium, and when the cell density reaches 75 - 85%, replacing it with the culture medium described in claim 3 for culture to obtain definitive endoderm cells.

Images