A directional attenuated vaccinia virus vaccine
By deleting the TK, F4L and B2R genes and inserting a promoter, the recombinant vaccinia virus VTT-dB/T/F was constructed, which solved the problems of high toxicity and poor immune effect of vaccinia virus and achieved a recombinant vaccinia virus with low toxicity and high immunogenicity. It is suitable for preventing poxviridae virus infections and as a vaccine vector.
Patent Information
- Application Number
- CN202310080294.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-18
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2043-01-18
AI Technical Summary
Existing vaccinia virus vaccines are highly toxic, resulting in significant side effects, and their immune effects are inferior to those of replication-deficient strains. They are difficult to replicate in mammalian cells and require booster immunization or high-dose use to achieve immune effects.
By deleting the TK gene, F4L gene and B2R gene based on the Tiantan strain of vaccinia virus, a recombinant vaccinia virus was constructed. Gene editing was performed using homologous recombination, and the p11 and p7.5 promoters were inserted to form the recombinant vaccinia virus VTT-dB/T/F, which reduced toxicity and maintained complete replication ability.
The recombinant vaccinia virus with low toxicity and high immunogenicity can replicate completely in mammalian cells, activate a strong innate immune response, reduce side effects and improve immune effects.
Smart Images

Figure CN115927215B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of vaccines, and particularly relates to a recombinant vaccinia virus and use thereof. BACKGROUND
[0002] Poxvirus is the largest class of DNA viruses of virions, including various types: vaccinia virus, variola virus, cowpox virus and monkey poxvirus, etc. Before the last century, variola virus was spread worldwide, with a mortality rate of 30%, and then vaccinia virus was used as a vaccine strain for the prevention and immunization of smallpox, and played a significant role in the process of eradicating smallpox, and then it was found that the vaccinia virus strain used for the prevention of smallpox also had a protective effect on the infection of other orthopoxviruses such as monkey pox after vaccination. In 1978, WHO announced that smallpox virus was eradicated, and the vaccination of vaccinia virus was also stopped, but due to the characteristics of vaccinia virus, such as wide host range, many non-essential genes, high conservation, large capacity of foreign genes, cytoplasmic replication, etc., it still has further research value as a vaccine carrier for the development of new infectious disease vaccine carriers and oncolytic viruses.
[0003] The vaccinia virus used for the prevention of smallpox, i.e. the primary vaccinia virus (VACV), has complete replication ability in mammalian cells. The production of primary vaccine strains is mostly carried out in animals, and the vaccine strain is inoculated in the skin lymph nodes of animals for replication and expansion, and then the vaccine strain is prepared for human immunization, such as the New York City Board of Health (NYCBH) strain stored and produced in the United States, the Lister strain stored and used in many countries in Europe, the Tiantan strain (VACV Tiantan, VTT) in China, and the Copenhagen (Cop) strain in Denmark. Although the primary vaccine strain has high protection rate, it has certain side effects in the human population, 40-47% of the injection sites are painful, 5-9% appear fever, and individual immunity abnormal persons appear symptoms such as eczema and encephalitis after vaccination.
[0004] With the development of vaccine production technology, the production of vaccine strains has shifted to tissue or chicken embryo cell culture, thus generating the second generation of vaccinia virus strains. For example, the RIVM strain produced by culturing the Lister strain in rabbit kidney cells, the Lister / CEP strain produced by culturing the Lister strain in chicken embryo allantoic membrane, the CCSV strain produced by passing the NYCBH strain in MRC-5 cells, and the ACAM1000 and ACAM2000 strains. The second generation of immunizing strains has similar immunizing effects as the primary vaccine strains, and the ACAM2000 vaccine strain has relatively reduced neurotoxicity compared to the primary vaccine strain, but still produces certain side effects after immunizing humans as a vaccine strain.
[0005] To solve the relative safety problems of the previous two generations of vaccine strains, attenuated third-generation vaccine strains have been further developed. The first and second generations of vaccine strains with replication ability are continuously passed in cultured cells, and genetic mutations accumulate between generations, resulting in changes in host range factors and viral virulence genes, and thus low-toxicity vaccine strains are screened. The third-generation vaccine strains mainly include the MVA strain, the LC16m8 strain, and the DI strain. Japanese researchers obtained the attenuated LC16m8 strain by passing the Lister strain in rabbit kidney epithelial cells (PRK) under low-temperature conditions, which has relatively few genetic mutation sites and can still replicate in human cells. The attenuated DI strain was obtained by passing the Japanese primary Dairen vaccine strain in 1-day-old chicken embryos, which has more genetic deletion sites than the LC16m8 strain, with 19 open reading frame deletions, and cannot replicate in most mammalian cells. The MVA strain, the weakest third-generation vaccine strain, was isolated from chicken embryo fibroblasts after more than 500 passages of the CVA strain, which has about 15% of its genome deleted compared to the parent CVA strain. Although it can infect human cells and encode early, middle, and late proteins, it cannot assemble into infectious virus particles, so it cannot replicate in a variety of mammalian cells, including humans, and its toxicity is significantly reduced. Moreover, the virus passage effect is better than that of the DI strain, and it is widely used as a new generation of vaccine carrier to prevent infectious diseases and tumors. However, compared with the immune effects of different vaccine strains, it is found that under the same dose, the replication-defective strain needs 1-2 logarithmic levels of virus titer higher than the primary vaccine strain or uses a booster immunization scheme to achieve the immune effect of the primary vaccine, and the antibody protection time, neutralization effect, and specific cellular immunity are still inferior to those of the complete replication of the primary vaccine.
[0006] Therefore, it is necessary to develop a new generation of candidate vaccinia virus with complete replication ability, reduced toxicity, and enhanced immunogenicity for preventing the spread of animal-derived infections and interpersonal infections caused by the Poxviridae family, as well as a new vaccine carrier. SUMMARY
[0007] Therefore, the present application aims to provide a recombinant vaccinia virus and use thereof, which has low toxicity, can completely replicate and has higher immunogenicity, and can be used for preventing infection of a poxviridae virus and as a viral vector for constructing vaccines for other infectious diseases and tumor vaccines.
[0008] In order to achieve the above-mentioned purpose, the first aspect of the present application provides a recombinant vaccinia virus, which lacks at least one of a TK gene, a F4L gene and a B2R gene relative to vaccinia virus Tianlun strain.
[0009] In a preferred embodiment of the present application, the recombinant vaccinia virus is one of the following recombinant vaccinia viruses:
[0010] (1) a recombinant vaccinia virus VTT-dTK, which lacks a TK gene relative to vaccinia virus Tianlun strain;
[0011] (2) a recombinant vaccinia virus VTT-dF4L, which lacks a F4L gene relative to vaccinia virus Tianlun strain;
[0012] (3) a recombinant vaccinia virus VTT-dB2R, which lacks a B2R gene relative to vaccinia virus Tianlun strain;
[0013] (4) a recombinant vaccinia virus VTT-dT / F, which lacks a TK gene and a F4L gene relative to vaccinia virus Tianlun strain;
[0014] (5) a recombinant vaccinia virus VTT-dB / T / F, which lacks a TK gene, a F4L gene and a B2R gene relative to vaccinia virus Tianlun strain.
[0015] In a preferred embodiment of the present application, the recombinant vaccinia virus is a recombinant vaccinia virus VTT-dB / T / F, which lacks a TK gene, a F4L gene and a B2R gene relative to vaccinia virus Tianlun strain.
[0016] In a preferred embodiment of the present application, the sequences of the TK gene, the F4L gene and the B2R gene are respectively shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.
[0017] In a preferred embodiment of the present application, the recombinant vaccinia virus is:
[0018] (1) the genome sequence of the recombinant vaccinia virus VTT-dTK is that of the vaccinia virus Tianlun strain with a partial sequence of the TK region deleted and a pl 1 promoter sequence and a p7.5 promoter sequence inserted, wherein the partial sequence of the TK region is 80439-80465 in GenBank: JX489139.1, and the pl 1 promoter sequence and the p7.5 promoter sequence are 43077-43168 in GenBank: JX489139.1 and 189237-189494 in GenBank: JX489139.1, respectively;
[0019] (2) the genome sequence of the recombinant vaccinia virus VTT-dF4L is that of the vaccinia virus Tianlun strain with a partial sequence of the F4L region deleted and a pl 1 promoter sequence and a p7.5 promoter sequence inserted, wherein the partial sequence of the F4L region is 32451-33293 in GenBank: JX489139.1, and the pl 1 promoter sequence and the p7.5 promoter sequence are 43077-43168 in GenBank: JX489139.1 and 189237-189494 in GenBank: JX489139.1, respectively;
[0020] (3) the genome sequence of the recombinant vaccinia virus VTT-dB2R is that of the vaccinia virus Tianlun strain with a sequence of the B2R region deleted and a pl 1 promoter sequence and a p7.5 promoter sequence inserted, wherein the sequence of the B2R region is 164449-165126 in GenBank: JX489139.1, and the pl 1 promoter sequence and the p7.5 promoter sequence are 43077-43168 in GenBank: JX489139.1 and 189237-189494 in GenBank: JX489139.1, respectively;
[0021] (4) the genome sequence of the recombinant vaccinia virus VTT-dT / F is that of the vaccinia virus Tianlun strain with a partial sequence of the TK region and a partial sequence of the F4L region deleted, wherein the partial sequence of the TK region is 80439-80465 in GenBank: JX489139.1, and the partial sequence of the F4L region is 32451-33293 in GenBank: JX489139.1;
[0022] (5) The genomic sequence of the recombinant vaccinia virus VTT-dB / T / F is the genomic sequence of the vaccinia virus Tianlun strain, with the deletion of part of the sequence of the TK region, part of the sequence of the F4L region, and the sequence of the B2R region; wherein the part of the sequence of the TK region is 80439-80465 in GenBank: JX489139.1, the part of the sequence of the F4L region is 32451-33293 in GenBank: JX489139.1, and the sequence of the B2R region is 164449-165126 in GenBank: JX489139.1;
[0023] The genomic sequence of the vaccinia virus Tianlun strain is the sequence represented by Gene Bank No. AF095689.
[0024] The second aspect of the present application provides a method for constructing a recombinant vaccinia virus, which uses the method of homologous recombination to construct the recombinant vaccinia virus.
[0025] In a preferred embodiment of the present application, it comprises the following steps:
[0026] (1) respectively constructing a first recombinant plasmid containing a left arm of a homologous arm of a TK gene and a right arm of the homologous arm of the TK gene, a second recombinant plasmid containing a left arm of a homologous arm of a F4L gene and a right arm of the homologous arm of the F4L gene, and a third recombinant plasmid containing a left arm of a homologous arm of a B2R gene and a right arm of the homologous arm of the B2R gene;
[0027] (2) infecting cells with the vaccinia virus Tianlun strain, and then respectively transfecting the first recombinant plasmid, the second recombinant plasmid, and the third recombinant plasmid, to obtain a recombinant vaccinia virus VTT-dTK that lacks the TK gene, a recombinant vaccinia virus VTT-dF4L that lacks the F4L gene, and a recombinant vaccinia virus VTT-dB2R that lacks the B2R gene, relative to the vaccinia virus Tianlun strain.
[0028] In a preferred embodiment of the present application, the recombinant vaccinia virus VTT-dTK is used to infect cells and the second recombinant plasmid is transfected again, to obtain a recombinant vaccinia virus VTT-dT / F that lacks the TK gene and the F4L gene, relative to the vaccinia virus Tianlun strain.
[0029] In a preferred embodiment of the present application, the recombinant vaccinia virus VTT-dT / F is used to infect cells and the third recombinant plasmid is transfected again, to obtain a recombinant vaccinia virus VTT-dB / T / F that lacks the TK gene, the F4L gene, and the B2R gene, relative to the vaccinia virus Tianlun strain.
[0030] The third aspect of the present application provides the use of the above-mentioned recombinant vaccinia virus in the preparation of a poxvirus vaccine or as a vaccine carrier.
[0031] A fourth aspect of the present application provides a poxvirus vaccine comprising the recombinant vaccinia virus described above.
[0032] The present application has the following beneficial effects:
[0033] Compared with the vaccinia virus Tianlun strain, the recombinant vaccinia virus provided by the present application has the characteristics of low toxicity, is an attenuated vaccinia virus, and has higher safety; and the recombinant vaccinia virus provided by the present application also has the characteristics of complete replication and higher immunogenicity, and can better activate natural immune response. In other words, the recombinant vaccinia virus provided by the present application has higher safety and enhanced immunogenicity.
[0034] The recombinant vaccinia virus provided by the present application can be used for developing a new generation of vaccinia virus vaccine, for preventing infection of poxviridae viruses, and as a viral vector for constructing other infectious disease vaccines and tumor vaccines, etc. BRIEF DESCRIPTION OF DRAWINGS
[0035] Figure 1 Schematic diagram of homologous recombination for deletion of TK;
[0036] Figure 2 PCR identification results of the recombinant virus VTT-dTK, wherein WT is a wild type virus, and dTK is a VTT-dTK recombinant virus;
[0037] Figure 3 Schematic diagram of homologous recombination for deletion of F4L;
[0038] Figure 4 PCR identification results of the recombinant virus VTT-dF4L, wherein WT is a wild type virus, and dF4L is a VTT-dF4L recombinant virus;
[0039] Figure 5 Schematic diagram of homologous recombination for deletion of B2R;
[0040] Figure 6 Schematic diagram of PCR primers required for identification of the recombinant virus VTT-dB2R;
[0041] Figure 7 Identification results of the recombinant virus VTT-dB2R. Among them, N is a negative control, WT is a wild type virus, and delB2R is a recombinant virus VTT-dB2R;
[0042] Figure 8 The level of natural immune response induced by the recombinant virus VTT-dB2R, wherein mock is a negative control, WT is a wild type virus, and delB2R is a recombinant virus VTT-dB2R;
[0043] Figure 9Identification results of recombinant virus VTT-dT / F. Among them, WT is wild virus, and dT / F is recombinant virus VTT-dT / F;
[0044] Figure 10 Identification results of recombinant virus VTT-dB / T / F. Among them, 1-6 is recombinant virus VTT-dB / T / F, and WT is wild type virus;
[0045] Figure 11 Comparison of replication levels of different recombinant viruses in mammalian cells;
[0046] Figure 12 Body weight change results of mice infected with different viruses;
[0047] Figure 13 Survival of mice infected with different viruses;
[0048] Figure 14 Comparison of red spot sizes at injection sites after rabbits were immunized with different viruses;
[0049] Figure 15 Statistical results of red spot size comparison at injection sites after rabbits were immunized with different viruses;
[0050] Figure 16 Antibody titer levels induced after mice were immunized with different viruses;
[0051] Figure 17 Serum neutralizing antibody levels after mice were immunized with different viruses. DETAILED DESCRIPTION
[0052] It should be noted that, unless otherwise defined, the technical terms or scientific terms used in the present application should be understood as the general meanings understood by those skilled in the art.
[0053] The experimental methods in the following examples are all conventional methods unless otherwise specified. The medicinal material raw materials, reagent materials, etc. used in the following examples are all commercially available products unless otherwise specified.
[0054] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.
[0055] In the present application, the term "comprising / comprise" generally means including the explicitly specified features, but excluding other elements.
[0056] In the present application, "directional attenuation" refers to the use of genetic engineering (e.g., homologous recombination) to produce a directional mutation in the Tian Tan strain of vaccinia virus, in which at least one of the TK gene, F4L gene and B2R gene is deleted, thereby greatly reducing its toxicity. The vaccine prepared from such a recombinant vaccinia virus with reduced toxicity is referred to as an attenuated vaccine.
[0057] As a DNA virus, vaccinia virus relies on a variety of enzymes related to deoxyribonucleic acid synthesis to play an important role in its replication process. These enzymes include thymidylate kinase (TK), ribonucleotide reducyase, deoxyuridine triphosphatase, etc. During vaccinia virus replication, a high concentration of nucleotide pool can be formed under the action of these enzymes to ensure the smooth progress of the replication of the daughter DNA. In normal cells, the concentration of nucleotides is low, so TK is essential for the proliferation of viruses in normal cells; in tumor cells, there is a high concentration of nucleotides, so TK is not essential for the proliferation of viruses in tumor cells. As can be seen from the above, a vaccinia virus with a deleted TK gene can preferentially replicate in tumor cells that provide sufficient nucleotides, but cannot replicate in normal cells. Ribonucleotide reducyase F4L is produced shortly after viral infection of cells, and its structure is 70%-80% similar to that of ribonucleotide reducyase in eukaryotes, which contains a catalytic small subunit and a regulatory large subunit and can catalyze the formation of deoxyribonucleotide diphosphate from ribonucleotide diphosphate. Mutation of the large subunit will inhibit the activity of the reducyase, and the virulence of the viral mutant in mice will also be reduced. The sensing molecule of viral DNA in host cells, i.e., cGAS, is activated upon recognition of exogenous DNA molecules such as viruses, activates the downstream STING signaling pathway by synthesizing 2',3'-cGAMP, and induces the expression of interferon to achieve the host's natural immune response to viruses. The B2R gene of vaccinia virus encodes the poxin protein, which can specifically degrade 2',3'-cGAMP in cells, thereby blocking the activation of natural immune signals induced by intracellular cGAS. After deletion of B2R, vaccinia virus infection can activate stronger natural immunity and induce higher levels of specific immune response.
[0058] The present application attempts to delete at least one of the above genes based on the Tian Tan strain of vaccinia virus, in order to obtain a recombinant vaccinia virus with low toxicity, complete replication and higher immunogenicity.
[0059] In a preferred embodiment of the present application, the recombinant vaccinia virus is one of the following recombinant viruses:
[0060] (1) recombinant vaccinia virus VTT-dTK which is deleted of TK gene relative to vaccinia virus Tianlun strain;
[0061] (2) recombinant vaccinia virus VTT-dF4L which is deleted of F4L gene relative to vaccinia virus Tianlun strain;
[0062] (3) recombinant vaccinia virus VTT-dB2R which is deleted of B2R gene relative to vaccinia virus Tianlun strain;
[0063] (4) recombinant vaccinia virus VTT-dT / F which is deleted of both TK gene and F4L gene relative to vaccinia virus Tianlun strain;
[0064] (5) recombinant vaccinia virus VTT-dB / T / F which is deleted of TK gene, F4L gene and B2R gene relative to vaccinia virus Tianlun strain.
[0065] In a preferred embodiment of the present application, the recombinant vaccinia virus is the recombinant vaccinia virus VTT-dB / T / F which is deleted of TK gene, F4L gene and B2R gene relative to vaccinia virus Tianlun strain. The recombinant vaccinia virus VTT-dB / T / F has the following characteristics:
[0066] 1. The recombinant virus VTT-dB / T / F which is deleted of TK gene, F4L gene and B2R gene has a lower replication level in mammalian cells than vaccinia virus Tianlun strain.
[0067] 2. The recombinant virus VTT-dB / T / F which is deleted of TK gene, F4L gene and B2R gene has a significantly reduced virulence than vaccinia virus Tianlun strain.
[0068] 3. The recombinant virus VTT-dB / T / F which is deleted of TK gene, F4L gene and B2R gene can still induce a high level of serum antibody after immunizing mice.
[0069] In summary, the recombinant vaccinia virus VTT-dB / T / F which is deleted of TK gene, F4L gene and B2R gene relative to vaccinia virus Tianlun strain (VTT) has a significantly reduced virulence than VTT, is safer and does not cause severe pathological reactions in the body, and the recombinant vaccinia virus VTT-dB / T / F can better activate the natural immune response and has higher immunogenicity. In other words, the recombinant vaccinia virus VTT-dB / T / F which is deleted of TK gene, F4L gene and B2R gene has higher safety and enhanced immunogenicity.
[0070] The recombinant vaccinia virus is constructed by homologous recombination, and the basic principle is that a recombinant plasmid containing a homologous arm is transfected into cells after being infected with virus, so that the virus performs homologous recombination in the cells to delete or insert the target gene.
[0071] The application further provides a poxvirus vaccine comprising the recombinant vaccinia virus, which can be used for preventing infection of a poxviridae virus and as a virus carrier for constructing other infectious disease vaccines and tumor vaccines.
[0072] The technical solutions provided by the application are further described below in combination with specific examples. The following examples are only used to illustrate the application and do not limit the protection scope of the application.
[0073] In the application, the whole genome sequence of the vaccinia virus Tianlu strain is stored in the international gene bank, and the number is Gene Bank, No.AF095689. The source of the vaccinia virus Tianlu strain is not specially limited in the application, and the conventional method can be used. The HEK293T, Vero and HeLa cells used in the application are cultured in DMEM culture solution containing 10% fetal bovine serum, 100 U / mL penicillin and 100 μg / mL streptomycin, and the THP1 cells are cultured in 1640 culture solution containing 10% fetal bovine serum, 100 U / mL penicillin and 100 μg / mL streptomycin in a 37℃, 5% CO2 incubator, and are subcultured every 2-3 days.
[0074] The technical solutions provided by the application are further described below in combination with specific examples. The following examples are only used to illustrate the application and do not limit the protection scope of the application.
[0075] The nucleotide sequences of the corresponding positions in GenBank:JX489139.1 mentioned in the following examples can be queried by the person skilled in the art in the NICBI database (https: / / www.ncbi.nlm.nih.gov / ), for example, the nucleotide sequence of 79716-80438 in GenBank:JX489139.1 queried in the NCBI data is (as shown in the sequence with underline):
[0076] 79681 gtataaagat tgtgcaaagc ttttgcgatc aataa atgga tcacaaccag tatctcttaa
[0077] 79741 cgatgttctt cgcagatgat gattcatttt ttaagtattt ggctagtcaa gatgatgaat
[0078] 79801 cttcattatc tgatatattg caaatcactc aatatctaga ctttctgttattattattga
[0079] 79861 tccaatcaaa aaataaatta gaagccgtgg gtcattgtta tgaatctctt tcagaggaat
[0080] 79921 acagacaatt gacaaaattc acagactctc aagattttaa aaaactgttt aacaaggtcc
[0081] 79981 ctattgttac agatggaagg gtcaaactta ataaaggata tttgttcgac tttgtgatta
[0082] 80041 gtttgatgcg attcaaaaaa gaatcctctc tagctaccac cgcaatagat cctattagat
[0083] 80101 acatagatcc tcgtcgcgat atcgcatttt ctaacgtgat ggatatatta aagtcgaata
[0084] 80161 aagtgaacaa taattaattc tttattgtca tcatgaacgg cggacatatt cagttgataa
[0085] 80221 tcggccccat gttttcaggt aaaagtacag aattaattag acgagttaga cgttatcaaa
[0086] 80281 tagctcaata taaatgcgtg actataaaat attctaacga taatagatac ggaacgggac
[0087] 80341 tatggacgca tgataagaat aattttgaag cattggaagc aactaaacta tgtgatgtct
[0088] 80401 tggaatcaat tacagatttc tccgtgatag gtatcgat ga aggacagttctttccagaca
[0089] The primer sequences involved in the following examples are summarized in the table below.
[0090] Table of primer sequences
[0091] Example 1 Construction of TK gene deleted recombinant virus VTT-dTK
[0092] 1. Method
[0093] 1.1 Recombination
[0094] The recombinant plasmid pdelJ2R was synthesized by GenScript, mainly including p7.5 promoter (early promoter), p11 promoter (late promoter), TK region homologous arm.
[0095] The pdelJ2R plasmid preferably contains a p7.5 promoter, a p11 promoter and a TK region homologous arm sequence. The sequence of the pdelJ2R plasmid is shown in SEQ ID NO: 4. The key sequences are in turn a TK region homologous arm left arm (79716-80438 in GenBank: JX489139.1), a p11 and p7.5 promoter sequence (43077-43168 in GenBank: JX489139.1, 189237-189494 in GenBank: JX489139.1), a TK region homologous arm right arm (80466-81460 in GenBank: JX489139.1).
[0096] 293T cells (5 x 10 5 ) were inoculated in a six-well plate in DMEM complete medium without antibiotics and cultured overnight. When the cells grew to 60%-70%, the cells were infected with wild-type virus (i.e. vaccinia virus Tiantan strain) diluted with DMEM. After 2 hours, the recombinant plasmid pdelJ2R was transfected. After 4 hours, the medium was replaced with a medium containing 2% FBS. After 48 hours, 1.2 mL of supernatant was removed, the cells were blown and frozen and thawed three times.
[0097] 1.2 Screening and purification of recombinant virus
[0098] Vero cells (1 x 10 6 ) were inoculated in a six-well plate in DMEM complete medium without antibiotics and cultured overnight. When the cells grew to 80%-90%, the virus supernatant suspension obtained by centrifugation of the above-mentioned 1.2.1 frozen and thawed three times was diluted 10 times in gradient and used to infect Vero cells again. After 2 hours, the cells were washed once with PBS and replaced with a medium containing 1.2% methyl cellulose. After three days, single plaques were selected by virus plaque purification and identified by PCR. The primer sequences are shown in Table 1 and are located in the left and right homologous arms of the TK gene. According to the difference in amplified fragments between the wild-type virus and the recombinant virus, the recombinant vaccinia virus was identified, and the purification step was repeated until the pure recombinant virus VTT-dTK was obtained.
[0099] Table 1 primer sequences
[0100]
[0101] The specific operation steps of PCR are as follows:
[0102] Table 2 PCR amplification operation steps
[0103]
[0104]
[0105] (1) Add the above-mentioned reagents to 0.2 mL thin-walled PCR tubes according to the above table (primer sequences are shown in the above primer table).
[0106] (3) Mix gently and centrifuge briefly to ensure that all the reaction components are at the bottom of the tube.
[0107] (4) Place the reaction system in the PCR instrument set up according to the above method and react. Collect the PCR reaction product and store at -20°C.
[0108] PCR product electrophoresis:
[0109] Use 1% agarose gel electrophoresis to detect viral PCR products:
[0110] (1) Add 0.3 g of accurately weighed agarose powder to a triangular flask that has been added with 30 mL of 1x TAE electrophoresis buffer.
[0111] (2) Place the conical flask in a microwave oven and heat until the agarose is completely dissolved. Cool to about 60-70°C at room temperature, add 2 μL of ethidium bromide (EB), and mix gently to ensure uniformity.
[0112] (3) Place the gel mold in the gel slot and fix it, and place the comb at a distance of 0.5-1.0 mm from the bottom plate, so that after adding the agarose, a complete sample well can be formed.
[0113] (4) Pour the warm agarose solution into the gel mold, and the thickness of the gel should be between 3-5 mm.
[0114] (5) After the gel is completely solidified (at room temperature for 10-25 min or in a 4°C refrigerator for 5 min), carefully remove the comb and place the gel in the electrophoresis slot.
[0115] (6) Add enough electrophoresis buffer to a depth of about 1 mm above the gel surface.
[0116] (7) Mix 10 μL of DNA sample with 2 μL of 6x Loading Buffer, and then slowly add the mixture to the sample well using a micropipette.
[0117] (8) Cover the electrophoresis slot and apply power to make the DNA move towards the anode. After a few minutes, bromophenol blue migrates from the sample well into the gel. Continue electrophoresis until the bromophenol blue migrates an appropriate distance in the gel.
[0118] (9) Turn off the power, remove the power cord from the electrophoresis slot, and open the slot cover. Remove the gel.
[0119] (10) Observe the movement of the sample under ultraviolet light and take a photo.
[0120] 1.3 Identification of recombinant virus
[0121] The obtained recombinant virus and wild type virus sample was extracted DNA according to the instruction of DNA Mini Kit, and then the DNA was dissolved in sterile water, and the DNA content was determined by Nanodrop. The extracted wild type and recombinant virus genome was amplified by PCR, and the identification primer was shown in Table 1.
[0122] 2、Results
[0123] 2.1 Construction of recombinant plasmid pdelJ2R
[0124] The constructed recombinant plasmid pdelJ2R mainly includes p7.5 promoter, p11 promoter, TK region homologous arm (as shown in Table 1). Figure 1
[0125] 2.2 Screening and identification of recombinant virus VTT-dTK
[0126] The recombinant virus was extracted DNA according to the instruction of DNA Mini Kit, and then the DNA was dissolved in sterile water, and the DNA content was determined by Nanodrop. The extracted wild type and recombinant virus genome was amplified by PCR, and the identification primer was shown in Table 1. Figure 2 The recombinant virus was extracted DNA according to the instruction of DNA Mini Kit, and then the DNA was dissolved in sterile water, and the DNA content was determined by Nanodrop. The extracted wild type and recombinant virus genome was amplified by PCR, and the identification primer was shown in Table 1.
[0127] Example 2 Construction of recombinant virus VTT-dF4L with F4L gene deletion
[0128] 1. Method
[0129] 1.1 Construction of recombinant virus VTT-dF4L
[0130] The recombinant plasmid pdelF4L was synthesized by the company, and mainly included the constructed recombinant plasmid including p7.5 promoter, p11 promoter and F4L region homologous arm.
[0131] The pdelF4L plasmid preferably contains a p7.5 promoter, a p11 promoter and F4L region homologous arm sequences. The pdelF4L plasmid is shown in SEQ ID NO: 5. The key sequences are in turn F4L region homologous arm left arm (31818-32450 in GenBank: JX489139.1), p11 promoter and p7.5 promoter (43077-43168 in GenBank: JX489139.1, 189237-189494 in GenBank: JX489139.1), F4L region homologous arm right arm (33281-33900 in GenBank: JX489139.1).
[0132] The method is the same as in Example 1. Wild-type vaccinia virus (i.e. vaccinia virus Tianlun strain) is infected in 293T cells and the recombinant plasmid pdelF4L is transfected to obtain a suspension containing recombinant virus VTT-dF4L. The virus identification primers are shown in Table 2 below.
[0133] Table 2 primer sequences
[0134]
[0135]
[0136] The virus is purified and identified in the same way as in Example 1.
[0137] 2. Results
[0138] 2.1 Construction of recombinant plasmid pdelF4L
[0139] The constructed recombinant plasmid pdelF4L mainly includes a p7.5 promoter, a p11 promoter and F4L region homologous arms (as shown in SEQ ID NO: 5). Figure 3
[0140] 2.2 Screening and identification of recombinant virus VTT-dF4L
[0141] DNA is extracted from the recombinant virus according to the DNAMini Kit instructions, and then PCR amplification is used for verification (the primers used for PCR verification are shown in Table 2). The F4L region is deleted in the recombinant virus (as shown in SEQ ID NO: 6), and the PCR product is sequenced. The F4L region partial sequence is deleted (32451-33293 in GenBank: JX489139.1) and the p11 promoter sequence and p7.5 promoter sequence are inserted (43077-43168 in GenBank: JX489139.1, 189237-189494 in GenBank: JX489139.1) in the recombinant virus, thereby confirming that the F4L region is knocked out in the recombinant virus VTT. Figure 4
[0142] Example 3 Construction of recombinant virus VTT-dB2R with B2R gene deletion
[0143] 1. Method
[0144] 1.1 Obtaining of recombinant virus VTT-dB2R
[0145] The recombinant plasmid pdelB2R was synthesized by a company, which mainly includes p7.5 promoter, p11 promoter and B2R region homologous arm sequence.
[0146] The pdelB2R plasmid preferably contains p7.5 promoter, p11 promoter and B2R region homologous arm sequence. The pdelB2R plasmid is shown in SEQ ID NO: 6. The key sequences therein are, in order, B2R region homologous arm left arm (163789-164448 in GenBank: JX489139.1), p11 promoter and p7.5 promoter (43077-43168, 189237-189494 in GenBank: JX489139.1), B2R region homologous arm right arm (165109-165768 in GenBank: JX489139.1).
[0147] The recombinant, purification and identification process method is the same as in Example 1. The wild-type vaccinia virus was infected in 293T cells and the recombinant plasmid pdelB2R was transfected to obtain a suspension containing recombinant virus VTT-dB2R. The virus identification primers are shown in Table 3 below. The virus purification and identification method is the same as in Example 1.
[0148] Table 3 Primer sequences
[0149]
[0150]
[0151] 1.2. Evaluation of the effect of activating natural immunity by recombinant virus VTT-dB2R
[0152] 1.2.1 Infection of THP1 cells by recombinant virus
[0153] 18-24 hours before infection, THP1 cells were inoculated in a six-well plate at 1 × 10 6 An equal amount of recombinant virus VTT-dB2R and wild-type vaccinia virus (MOI: 1) was used to infect THP1 cells, which were then placed in a cell culture incubator at 37°C, 5% CO2 for 6 hours. Then the cells were collected.
[0154] 1.2.2 Protein extraction
[0155] 3000rpm centrifugation for 3 min, PBS wash once, add 100 μL cell lysate RIPA (20 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.25% sodium deoxycholate, 1 mM EDTA, 1% NP40), centrifugal supernatant after adding loading buffer, Western Blot.
[0156] 1.3.3. Western Blot detection of p-IRF3 and p-TBK1 protein expression
[0157] (l) First prepare 12% separation gel (4 mL 30% acrylamide solution, 2.5 mL Tris / HCI pH 8.8, 100 μL 10% SDS, 100 μL 10% ammonium persulfate, 5 μL TEMED), fill the gel, add water to the top of the liquid, polymerize at room temperature for 60 min.
[0158] (2) Pour the water on top, then prepare 5% stacking gel (0.5 mL 30% acrylamide solution, 0.5 mL Tris / HCI pH 6.8, 40 μL 10% SDS, 50 μL 10% ammonium persulfate, 5 μL TEMED), insert the comb into the stacking gel, polymerize at room temperature for 50 min. After the gel is completely condensed, carefully pull out the comb.
[0159] (3) The harvested lysate was centrifuged at 12000 rpm, 4°C for 10 min. Take 60 μL, add 4x loading buffer 20 μL, 98°C boil for 10 min.
[0160] (4) Prepare the electrophoresis gel and put it into the electrophoresis tank, add fresh electrophoresis buffer to the inner tank (cover the gel plate), take 20 μL of the sample treated in the previous step and slowly add it to the comb hole of the stacking gel, then add appropriate amount of electrophoresis buffer to the outer tank of the electrophoresis tank, and perform electrophoresis: first 120V, electrophoresis for 20 minutes, observe that the sample is well compressed into a line, and the protein pre-dye Marker starts to separate, indicating that the sample has entered the separation gel, adjust the current to 160V, continue electrophoresis for 40 minutes, observe that the protein pre-dye Marker is well separated, end electrophoresis.
[0161] (5) Cut off the excess gel, and stack the filter paper, gel, nitrocellulose membrane (NC membrane), and filter paper in the order of cathode to anode in the transfer membrane clamp, put it into the transfer membrane device, add fresh transfer membrane liquid, and insert the electrodes on ice or at 4°C to transfer the protein on the gel to the NC membrane at 80V for 120 min.
[0162] (6) The transferred membrane is blocked with 5% skim milk, incubated on a horizontal shaker at 25 rpm and room temperature for 1 h.
[0163] (7) The membrane is immersed in 5% skim milk containing the appropriate dilution of antibody (p-IRF3, p-TBK1, etc. antibody 1:1000 dilution), 25 rpm on a horizontal shaker, 4°C overnight.
[0164] (8) The membrane is washed with TBST for 4 times, 5 min each time, 50 rpm on a horizontal shaker.
[0165] (9) Discard the washing solution, add 1:10000 dilution of Alexa 488 goat anti-Rabbit secondary antibody, 25 rpm on a horizontal shaker, room temperature, avoid light, incubate for 1 h.
[0166] (10) Discard the secondary antibody, wash the membrane with TBST for 4 times, 5 min each time, 25 rpm on a horizontal shaker.
[0167] (11) Take out the membrane, scan the membrane by using LI-COR Odyssey instrument
[0168] 2. Results
[0169] 2.1 Construction and identification of recombinant plasmid pdelB2R
[0170] The constructed recombinant plasmid pdelB2R includes P7.5, P11, B2R region homologous arms (Left arm, Right arm), as shown in Figure 5 .
[0171] 2.2 Screening of recombinant virus VTT-dB2R
[0172] The recombinant and screening process is the same as Example 1. The virus plaques are screened by PCR using screening primers (B2Rup-F + B2Rdown-R), and the gene difference between wild type virus and VTT-dB2R is shown in Figure 6 . The PCR identification result of the purified recombinant virus VTT-dB2R is shown in Figure 7 , confirming that the B2R gene is deleted in the recombinant virus. And the PCR product is sequenced, the B2R region sequence (GenBank: JX489139.1 164449-165126) is deleted in the recombinant virus, and the p11 promoter sequence and p7.5 promoter sequence (GenBank: JX489139.1 43077-43168, GenBank: JX489139.1 189237-189494) are inserted, confirming that the B2R region is knocked out in the recombinant virus VTT.
[0173] 2.3 Evaluation of the effect of activating natural immunity of recombinant virus VTT-dB2R
[0174] Compared with the wild type, the B2R deletion strain can activate innate immunity and induce host cells to produce higher levels of p-IRF3 (human phosphorylated interferon regulatory factor 3) and p-TBK1 (human phosphorylated TANK binding kinase) after simultaneously infecting THP1 cells with the recombinant virus VTT-dB2R and the wild vaccinia virus WT (as shown in Figure 8
[0175] Example 4 Construction of recombinant virus VTT-dT / F simultaneously deleting F4L gene and TK gene
[0176] In this example, the TK gene and the F4L gene are simultaneously deleted in the vaccinia virus Tiantan strain to obtain the recombinant virus VTT-dT / F deleting the TK gene and the F4L gene, and the construction method of the recombinant virus deleting the TK gene and the F4L gene is the same as that in Example 2, specifically as follows:
[0177] The 293T cells are infected with the recombinant virus VTT-dTK and transfected with the recombinant plasmid pdelF4L to obtain a suspension containing the recombinant virus VTT-dT / F, and the further screening and purification of the recombinant virus are the same as those in Example 2. The obtained purified virus is identified by using the F4L and TK region identification primers, and the PCR fragment size is different from that of the wild type (i.e. the vaccinia virus Tiantan strain) (as shown in Figure 9 ), and is verified by sequencing. The TK region partial sequence (80439-80465 in GenBank: JX489139.1) and the F4L region partial sequence (32451-33293 in GenBank: JX489139.1) are deleted in the recombinant virus, thereby confirming that the recombinant virus VTT-dT / F deleting the TK gene and the F4L gene is obtained.
[0178] Example 5 Construction of recombinant virus VTT-dB / T / F simultaneously deleting F4L gene, TK gene and B2R gene
[0179] In this example, when the TK gene, the F4L gene and the B2R gene are simultaneously deleted in the vaccinia virus Tiantan strain to obtain the recombinant virus VTT-dB / T / F deleting the TK gene, the F4L gene and the B2R gene, the construction method of the recombinant virus VTT-dB / T / F deleting the TK gene, the F4L gene and the B2R gene is the same as that in Example 3, specifically as follows:
[0180] The 293T cells are infected with the recombinant virus VTT-dT / F and transfected with the recombinant plasmid pdelB2R to obtain a suspension containing the recombinant virus VTT-dB / T / F, and the further screening and purification of the recombinant virus are the same as those in Example 3. The obtained purified virus is identified by using the B2R, F4L and TK region identification primers, and the PCR fragment size is different from that of the wild type (i.e. the vaccinia virus Tiantan strain) (as shown inFigure 10 ), and sequencing verification, the recombination virus in which the TK region partial sequence (GenBank: JX489139.1 80439-80465), F4L region partial sequence (GenBank: JX489139.1 32451-33293) and B2R region sequence (GenBank: JX489139.1 164449-165126) were deleted, confirmed to obtain the recombination virus VTT-dB / T / F which simultaneously deleted B2R gene, TK gene and F4L gene.
[0181] Example 6 Comparison of replication levels of recombination viruses which deleted TK, F4L and B2 in mammalian cells
[0182] 1. Method
[0183] 1.1 Infection of mammalian cells with recombination viruses
[0184] Human liver cells LO2 (2*10 5 / well) were inoculated in 12-well plates in antibiotic-free DMEM complete medium, cultured overnight, and when the cells grew to 70%-80% confluence, the recombination viruses were added for infection (MOI = 0.005). There were six recombination viruses, the first group was the prototype strain vaccinia virus VACV tiantan strain (VTT); the second group was the VACV tiantan strain which deleted the TK region (VTT-dTK); the third group was the VACV tiantan strain which deleted the F4L region (VTT-dF4L); the fourth group was the VACV tiantan strain which deleted the TK region and the F4L region (VTT-dT / F); the fifth group was the VACV tiantan strain which deleted the B2R region (VTT-dB2); the sixth group was the VACV tiantan strain which simultaneously deleted the TK region, the F4L region and the B2 region (VTT-dB / T / F). After 2 hours of infection, 1 mL of PBS was washed once, and 2% serum DMEM medium was replaced for culture at 37°C; the culture plates were collected at 12 hours, 24 hours, 36 hours and 48 hours after infection, and were frozen and thawed 3 times between -80°C and room temperature, the cell liquid after freezing and thawing was centrifuged at 1500g for 10 minutes, the supernatant was taken, and the obtained virus suspension was detected for virus titer by plaque assay.
[0185] 1.2 Detection of replication titer of recombination viruses by plaque formation
[0186] Vero cells (2*10 5) Inoculated in 12-well plate antibiotic-free DMEM complete medium, cultured overnight, when the cells grew to 80%~90% confluence, the collected virus suspension was 10-fold gradient diluted to re-infect Vero cells. After 2 hours, 1 mL PBS was washed once, and replaced with low-melting-point agar DMEM medium with a final concentration of 1%. After three days, the formed plaques were counted to calculate the titer after virus replication.
[0187] 2. Results
[0188] 2.1 Replication of recombinant viruses lacking TK, F4L and B2 in mammalian cells
[0189] Virus titration tests were performed on cells harvested at different infection times (12 hours, 24 hours, 36 hours, 48 hours) infected with recombinant viruses lacking TK, F4L and B2 in human liver cells LO2. The results showed that the wild virus VTT and the single deletion B2 VTT-dB2R had the strongest replication ability, reaching 10 6 PFU / mL at 48 hours after infection; the replication ability of the single deletion TK (VTT-dTK) and the single deletion F4L (VTT-dF4L) recombinant vaccinia virus was slightly worse than that of VTT, reaching 2*10 5 / mL at 48 hours after infection; the replication ability of the double deletion TK and F4L (VTT-dT / F) and the triple deletion TK, F4L and B2 (VTT-dB / T / F) recombinant vaccinia virus was the lowest, reaching 5*10 4 PFU / mL and 1.5*10 4 PFU / mL at 48 hours after infection, but several recombinant viruses could effectively replicate in mammalian cells (as shown in Figure 11 .
[0190] Example 7 Virulence verification of recombinant virus VTT-dB / T / F
[0191] When the recombinant virus VTT-dB / T / F lacking TK gene, F4L gene and B2R gene simultaneously infected animals showed significantly reduced virulence, the virulence experiment of the recombinant virus included the following steps:
[0192] 1. Method
[0193] 1.1 Mouse recombinant virus administration scheme
[0194] 6-week-old BALB / c female mice were divided into 13 groups, 6 mice in each group. The first group was the negative control, given PBS; the remaining 12 groups were given 2.5*10 5 PFU / mouse and 2.5*10 6PFU / mouse. The second group was the prototype vaccinia virus VACV tiantan (VTT, 2.5*10 5 PFU / mouse); the third group was the VACV tiantan strain with TK region deleted (VTT-dTK, 2.5*10 5 PFU / mouse); the fourth group was the VACV tiantan strain with F4L region deleted (VTT-dF4L, 2.5*10 5 PFU / mouse); the fifth group was the VACV tiantan strain with both TK region and F4L region deleted (VTT-dT / F, 2.5*10 5 PFU / mouse); the sixth group was the VACV tiantan strain with B2 region deleted (VTT-dB2, 2.5*10 5 PFU / mouse); the seventh group was the VACV tiantan strain with TK region, F4L region and B2 region deleted simultaneously (VTT-dB / T / F, 2.5*10 5 PFU / mouse); the eighth group was the prototype vaccinia virus VACV tiantan (VTT, 2.5*10 6 PFU / mouse); the ninth group was the VACV tiantan strain with TK region deleted (VTT-dTK, 2.5*10 6 PFU / mouse); the tenth group was the VACV tiantan strain with F4L region deleted (VTT-dF4L, 2.5*10 6 PFU / mouse); the eleventh group was the VACV tiantan strain with both TK region and F4L region deleted (VTT-dT / F, 2.5*10 6 PFU / mouse); the twelfth group was the VACV tiantan strain with B2 region deleted (VTT-dB2, 2.5*10 6 PFU / mouse); the thirteenth group was the VACV tiantan strain with TK region, F4L region and B2 region deleted simultaneously (VTT-dB / T / F, 2.5*10 6 PFU / mouse). The above different recombinant viruses and different concentrations were administered by nose drop, 50 μl / mouse, on day 0, and the survival and body weight of the mice were observed at the same time every day, for a total of 21 days.
[0195] 1.2 Rabbit recombinant virus administration scheme
[0196] Six New Zealand white rabbits, 2-2.5 kg, were divided into three groups, two in each group, for immunization with different concentrations of recombinant viruses. The first group was administered at a concentration of 1*10 6 PFU / needle, the second group was 1*10 5 / needle, and the third group was 1*10 4 / needle. First, the back of the rabbit was prepared for skinning, and then six recombinant VACV tiantan strains were injected subcutaneously on the hairless back of the rabbit in turn, 2 injections of 100 μl per injection for each virus; the six recombinant viruses were injected subcutaneously from the direction close to the head of the rabbit to the direction of the tail, in turn, they were the prototype strain VACV tiantan (VTT), the TK region deletion VACV tiantan strain (VTT-dTK), the F4L region deletion VACV tiantan strain (VTT-dF4L), the double deletion TK region and F4L region VACV tiantan strain (VTT-dT / F), the B2 region deletion VACV tiantan strain (VTT-dB2), and the triple deletion TK region, F4L region and B2 region VACV tiantan strain (VTT-dBTF). The subcutaneous injection was given on day 0, and the red spot diameter of the injection site on the back of the rabbit was observed and photographed every day thereafter.
[0197] 2. Results
[0198] 2.1 Body weight changes after immunization of mice
[0199] The body weight of the mice immunized by nose drops was measured every day, and the data obtained were plotted to obtain the body weight change curve of the mice. The results showed that the two immunization concentrations showed similar body weight change trends. The body weight of the mice in the wild type (VTT) and B2R knockout (VTT-dB2) groups decreased significantly compared with the control group injected with PBS, and the body weight of the mice in the remaining knockout strains, including VTT-dTK, VTT-dF4L, VTT-dT / F and VTT-B / T / F groups, did not change significantly compared with the control group (injected with PBS) (as shown in Figure 12 , indicating that VTT-dT / F and VTT-B / T / F were successfully attenuated compared with the wild type.
[0200] 2.2 Survival of mice after immunization
[0201] The survival of the mice immunized by nose drops was observed every day, and the survival curve was plotted according to the change in time. The results showed that in the 2.5*10 6 PFU / each dose group, the mice in the VTT and VTT-dB2 groups died on the fifth and sixth days, and the remaining injection groups (VTT-dTK, VTT-dF4L, VTT-dT / F and VTT-B / T / F) were in good survival condition within the observation period; in the 2.5*10 5 PFU / each dose group, the mice in the VTT group died after 7 days, and two mice in the VTT-dB2 group died after 5 days; the remaining mice were in good survival condition within the observation period (as shown in Figure 13 , indicating that VTT-dT / F and VTT-B / T / F were successfully attenuated compared with the wild type.
[0202] 2.3 Rabbit redness on the back after administration
[0203] After the skin of the back of the rabbit was prepared, the redness of the injection site of different recombinant viruses injected subcutaneously was observed, measured and photographed. The redness size of 3 concentrations (1*10 6 PFU / needle, 1*10 5 PFU / needle, 1*10 4 PFU / needle) showed that the redness caused by the prototype strain VTT and VTT-dB2 with deletion of B2 was significantly larger than that of the injection of other recombinant viruses; in the low dose group, only the prototype strain VTT and VTT-dB2 with deletion of B2 produced obvious redness, and the rest of the groups (VTT-dTK, VTT-dF4L, VTT-dT / F and VTT-B / T / F) only produced slight skin redness and recovered completely about a week after injection (results shown in Figure 14 and Figure 15 ). It showed that VTT-dT / F and VTT-B / T / F were successfully attenuated compared with the wild type.
[0204] Example 8 Mouse immunization experiment of recombinant viruses with deletion of TK, F4L and B2
[0205] 1. Method
[0206] 1.1 Mouse immunization scheme
[0207] 6-week-old BALB / c mice were divided into 6 groups, 5 in each group. The first group was the prototype strain VACV tiantan (VTT), the second group was dTK with single deletion of TK, the third group was dF4L with single deletion of F4L region, the fourth group was dT / F with double deletion of TK and F4L region, the fifth group was dB2 with single deletion of B2 region, and the sixth group was dB / T / F with triple deletion of TK, F4L and B2 region. Each recombinant virus was used to immunize mice at a dose of 2.5*10 6 PFU / mouse, and the mice were immunized by intranasal administration. After 21 days, the serum of the mice was collected, inactivated at 56°C for 30 minutes, and then stored in a refrigerator at -80°C.
[0208] 1.2 Detection of mouse serum anti-VACV antibody
[0209] The ELISA method was used to detect the anti-VACV antibody titer in the mouse serum. The specific method was as follows: first, the purified VACV tiantan (VTT) virus was inactivated at 56°C for 30 minutes, and then the inactivated VTT was diluted into 1*10 5PFU / 100 μL / well, added to high-binding ELISA-specific 96-well plates, coated at 37°C for 2 hours. After coating, wash the plate with 1x wash buffer, 300 μL / well soak for 1 min, tap the plate dry, and proceed to the next wash, a total of 5 times. Then add blocking solution 200 μL / well, block at 37°C for 2 hours. After blocking, wash the plate with 1x wash buffer, 300 μL / well soak for 1 min, tap the plate dry, and proceed to the next wash, a total of 5 times. Dilute the mouse serum with 1x dilution buffer by 4-fold gradient, add the diluted mouse serum 100 μL / well to the ELISA plate, and incubate at room temperature for 2 hours. Discard the liquid in the wells, tap the plate dry, wash the plate with 1x wash buffer, 300 μL / well soak for 1 min, tap the plate dry, and proceed to the next wash, a total of 5 times. Dilute the anti-mouse IgG antibody-HRP 1:100 with 1x dilution buffer, add 100 μL / well to the ELISA plate, mix well, and incubate at room temperature for 1 hour. Discard the liquid in the wells, tap the plate dry, wash the plate with 1x wash buffer, 300 μL / well soak for 1 min, tap the plate dry, and proceed to the next wash, a total of 5 times. Add the pre-prepared substrate solution (mix substrate A and substrate B in equal volumes at 1:1, prepare 10 minutes before use) to the ELISA plate, 200 μL / well, mix well, and incubate at room temperature for 20 minutes in the dark. Add 50 μL / well of stop solution to the ELISA plate, gently shake the plate until the color develops evenly. Read the OD450nm light absorption value within 20 minutes.
[0210] 1.3 Detection of neutralizing antibodies in mouse serum
[0211] Dilute the mouse serum with DMEM by 4-fold gradient, and then incubate the diluted mouse serum with an equal amount of VACV tiantan strain expressing GFP (VTT-GFP) at 37°C for 1 hour. Then add to the 48-well plate coated with Vero cells, and culture for 24 hours. Then detect the GFP signal expressed by VACV to indicate the level of neutralizing antibodies in the mouse serum.
[0212] 2. Results
[0213] 2.1 Detection of VACV antibodies in mouse serum
[0214] After diluting the mouse serum with 1x dilution buffer by 4-fold gradient, detect the S antibodies in the serum by ELISA. The results are as follows Figure 16As shown in the figure, the prototype strain VTT and the single deletion B2 VTT-dB2 induced higher antibody titers, the single deletion TK (VTT-dTK) and F4L (VTT-dF4L) and the double deletion VTT-dT / F and the triple deletion VTT-dB / T / F had lower antibody titers than the prototype strain and VTT-dB2, but the triple deletion VTT-dB / T / F had higher serum antibody titers than the double deletion VTT-dT / F. It is shown that the deletion of B2R after the deletion of TK and F4L improves the immunogenicity of the triple recombinant virus VTT-dB / T / F.
[0215] 2.2 Detection of neutralizing antibodies in mouse serum
[0216] After the mouse serum was diluted by 4-fold gradient dilution with DMEM, it was incubated with an equal amount of VACV-GFP at 37°C for 1 h, and then added to a 48-well plate coated with Vero cells. After 24 h of culture, the expression of GFP was detected by flow cytometry to indicate the infection of VACV-GFP. The results are shown in the figure. Figure 17 As shown in the figure, the prototype strain VTT and the single deletion B2 VTT-dB2 induced higher neutralizing antibody activity, the single deletion TK (VTT-dTK) and F4L (VTT-dF4L) and the double deletion VTT-dT / F and the triple deletion VTT-dB / T / F had lower neutralizing antibody activity than the prototype strain and VTT-dB2, but the triple deletion VTT-dB / T / F had higher neutralizing antibody activity than the double deletion VTT-dT / F.
[0217] The above only describes the preferred embodiments of the present application, and it should be noted that those skilled in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered within the protection scope of the present application.
[0218] SEQUENCE DESCRIPTION
[0219] SEQ ID NO: 1 (TK gene)
[0220] ATGAACGGCGGACATATTCAGTTGATAATCGGCCCCATGTTTTCAGGTAAAAGTACAGAATTAATTAGACGAGTTAGACGTTATCAAATAGCTCAATATAAATGCGTGACTATAAAATATTCTAACGATAATAGATACGGAACGGGACTATGGACGCATGATAAGAATAATTTTGAAGCATTGGAAGCAACTAAACTATGTGATGTCTTGGAATCAATTACAGATTTCTCCGTGATAGGTATCGATGAAGGACAGTTCTTTCCAGACATTGTTGAATTCTGTGAGCGTATGGCAAACGAAGGAAAAATAGTTATAGTAGCCGCACTCGATGGGACATTTCAACGTAAACCGTTTAATAATATTTTGAATCTTATTCCATTATCTGAAATGGTGGTAAAACTAACTGCTGTGTGTATGAAATGCTTTAAGGAGGCTTCCTTTTCTAAACGATTGGGTGAGGAAACCGAGATAGAAATAATAGGAGGTAATGATATGTATCAATCGGTGTGTAGAAAGTGTTACATCGACTCATAA
[0221] SEQ ID NO: 2 (F4L gene)
[0222] ATGGAACCCATCCTTGCACCAAATCCAAATAGATTTGTTATT
[0223] TTCCCAATCCAATATTATGACATCTGGAACATGTATAAAAAGGCA
[0224] GAGGCATCATTTTGGACAGTGGAAGAAGTAGATATATCTAAAGA
[0225] TATCAATGATTGGAATAAACTAACACCAGACGAAAAATATTTTAT
[0226] AAAACATGTATTGGCGTTTTTTGCAGCCAGTGACGGAATAGTGA
[0227] ATGAAAATTTGGCGGAACGATTTTGTACAGAAGTACAGATTACC
[0228] GAGGCTAGATGTTTCTACGGATTTCAGATGGCCATTGAAAACAT
[0229] TCATTCGGAAATGTATAGTCTTTTGATCGATACTTATGTTAAAGAT
[0230] AGTAATGAAAAAAACTATCTCTTTAATGCCATAGAAACGATGCCT
[0231] TGTGTAAAAAAGAAGGCCGATTGGGCTCAAAAGTGGATACATGA
[0232] CAGCGCCGGTTATGGAGAGAGACTTATTGCCTTTGCTGCAGTAG
[0233] AAGGAATCTTCTTTTCCGGATCATTCGCTTCCATATTTTGGCTTA
[0234] AAAAGCGTGGCCTAATGCCCGGACTCACGTTTTCCAACGAATTG
[0235] ATTAGTAGAGACGAGGGTCTGCACTGCGATTTCGCATGTTTGAT
[0236] GTTTAAACATTTATTGCATCCACCGAGTGAAGAAACCGTTAGAT
[0237] CTATTATAACAGATGCGGTATCCATTGAACAAGAATTTCTTACTG
[0238] CGGCTCTTCCAGTTAAACTTATAGGAATGAATTGTGAAATGATG
[0239] AAAACATATATAGAATTCGTCGCGGATAGATTGATTTCTGAATTG
[0240] GGATTTAAAAAAATTTATAATGTTACCAATCCGTTTGATTTCATG
[0241] GAAAATATATCATTGGAAGGAAAAACTAATTTTTTCGAAAAACGT
[0242] GTGGGTGAATACCAAAAAATGGGAGTTATGTCTCAAGAAGACAA
[0243] TCATTTTTCTTTAGATGTTGACTTTTAA
[0244] SEQ ID NO: 3 (B2R gene)
[0245] ATGGCGATGTTTTACGCACACGCTCTCGGTGGGTACGACGA
[0246] GAATCTTCATGCCTTTCCTGGAATATCATCGACTGTTGCCAATGA
[0247] TGTCAGAAAATATTCTGTTGTGTCAGTTTATAATAACAAGTATGA
[0248] CATTGTAAAAGACAAATATATGTGGTGTTACAGTCAGGTGAACA
[0249] AGAGATATATTGGAGCACTGCTGCCTATGTTTGAGTGCAATGAAT
[0250] ATCTACAAATTGGAGATCCGATCCATGATCAAGAAGGAAATCAA
[0251] ATCTCTATCATCACATATCGCCACAAAAACTACTATGCTCTAAGC
[0252] GGAATCGGGTACGAGAGTCTAGACTTGTGTTTGGAAGGAGTAG
[0253] GGATTCATCATCACACACTTGAAGCAGGAAACGCTGTATATGGA
[0254] AAAGTTCAACATGATTATTCTACTATCAAAGAGAAGGCCAAAGA
[0255] AATGAGTACACTTAGTCCAGGACCTATCATTGATTACCACGTCTG
[0256] GATAGGAGATTGTATCTGTCAAGTTACTGCTGTGGACGTACATG
[0257] GAAAGGAAATTATGAGAATGAGATTCAAAAAGGGTGCGGTGCTT
[0258] CCGATCCCAAATCTGGTAAAAGTTAAACTTGGGGAGAATGATAC
[0259] AGAAAATCTTTCTTCTACTATATCGGCGGCACCATCGAGGTAA
[0260] SEQ ID NO: 4 (pdelJ2R plasmid)
[0261] GTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCA
[0262] CTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCT
[0263] GTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTAT
[0264] GCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAAT
[0265] ACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAA
[0266] ACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGA
[0267] GATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCA
[0268] GCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGG
[0269] AAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAA
[0270] TGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTT
[0271] ATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTT
[0272] AGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAA
[0273] GTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACC
[0274] TATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAAGC
[0275] TTTTGCGATCAATAAATGGATCACAACCAGTATCTCTTAACGATG
[0276] TTCTTCGCAGATGATGATTCATTTTTTAAGTATTTGGCTAGTCAA
[0277] GATGATGAATCTTCATTATCTGATATATTGCAAATCACTCAATATC
[0278] TAGACTTTCTGTTATTATTATTGATCCAATCAAAAAATAAATTAGA
[0279] AGCCGTGGGTCATTGTTATGAATCTCTTTCAGAGGAATACAGAC
[0280] AATTGACAAAATTCACAGACTCTCAAGATTTTAAAAAACTGTTTA
[0281] ACAAGGTCCCTATTGTTACAGATGGAAGGGTCAAACTTAATAAA
[0282] GGATATTTGTTCGACTTTGTGATTAGTTTGATGCGATTCAAAAAA
[0283] GAATCCTCTCTAGCTACCACCGCAATAGATCCTATTAGATACATA
[0284] GATCCTCGTCGCGATATCGCATTTTCTAACGTGATGGATATATTA
[0285] AAGTCGAATAAAGTGAACAATAATTAATTCTTTATTGTCATCATG
[0286] AACGGCGGACATATTCAGTTGATAATCGGCCCCATGTTTTCAGG
[0287] TAAAAGTACAGAATTAATTAGACGAGTTAGACGTTATCAAATAGC
[0288] TCAATATAAATGCGTGACTATAAAATATTCTAACGATAATAGATAC
[0289] GGAACGGGACTATGGACGCATGATAAGAATAATTTTGAAGCATT
[0290] GGAAGCAACTAAACTATGTGATGTCTTGGAATCAATTACAGATTT
[0291] CTCCGTGATAGGTATCGATAGATCTGCTAGCCACGTGTTAATTAA
[0292] GCCCGGGCCTCGAGGAATTCATTTATAGCATAGAAAAAAACAAA
[0293] ATGAAATTCTACTATATTTTTACATACATATATTCTAAATATGAAAG
[0294] TGGTGATTGTGACTAGCGTAGCATCGCTTCTAGACATCTATATAC
[0295] TATATAGTAATACCAATACTCAAGACTACGAAACTGATACAATCT
[0296] CTTATCATGTGGGTAATGTTCTCGATGTCGATAGCCATATGCCCG
[0297] GTAGTTGCGATATACATAAACTGATCACTAATTCCAAACCCACCC
[0298] GCTTTTTATAGTAAGTTTTTCACCCATAAATAATAAATACAATAAT
[0299] TAATTTCTCGTAAAAGTAGAAAATATATTCTAATTTATTGCACGGT
[0300] AAGGAAGTAGAATCATAAAGAACAGTGACGGATCCCCGGGCCAT
[0301] GGGCGGCCGCGTCGACGTAGAAAGTGTTACATCGACTCATAATA
[0302] TTATATTTTTTATCTAAAAAACTAAAAATAAACATTGATTAAATTT
[0303] TAATATAATACTTAAAAATGGATGTTGTGTCGTTAGATAAACCGT
[0304] TTATGTATTTTGAGGAAATTGATAATGAGTTAGATTACGAACCAG
[0305] AAAGTGCAAATGAGGTCGCAAAAAAACTGCCGTATCAAGGACA
[0306] GTTAAAACTATTACTAGGAGAATTATTTTTTCTTAGTAAGTTACA
[0307] GCGACACGGTATATTAGATGGTGCCACCGTAGTGTATATAGGATC
[0308] TGCTCCTGGTACACATATACGTTATTTGAGAGATCATTTCTATAAT
[0309] TTAGGAGTGATCATCAAATGGATGCTAATTGACGGCCGCCATCA
[0310] TGATCCTATTTTAAATGGATTGCGTGATGTGACTCTAGTGACTCG
[0311] GTTCGTTGATGAGGAATATCTACGATCCATCAAAAAACAACTGC
[0312] ATCCTTCTAAGATTATTTTAATTTCTGATGTGAGATCCAAACGAG
[0313] GAGGAAATGAACCTAGTACGGCGGATTTACTAAGTAATTACGCT
[0314] CTACAAAATGTCATGATTAGTATTTTAAACCCCGTGGCATCTAGT
[0315] CTTAAATGGAGATGCCCGTTTCCAGATCAATGGATCAAGGACTT
[0316] TTATATCCCACACGGTAATAAAATGTTACAACCTTTTGCTCCTTC
[0317] ATATTCAGCTGAAATGAGATTATTAAGTATTTATACCGGTGAGAA
[0318] CATGAGACTGACTCGACCGATGCCCTTGAGAGCCTTCAACCCA
[0319] GTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCG
[0320] CACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTG
[0321] CCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCT
[0322] GGAGCGCGACGATGATCGGCCTGTCGCTTGCGGTATTCGGAAT
[0323] CTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCACC
[0324] AAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGG
[0325] CCGACGCGCTGGGCTACGTCTTGCTGGCGTTCGCGACGCGAGG
[0326] CTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGGCA
[0327] TCGGGATGCCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGA
[0328] TGACGACCATCAGGGACAGCTTCAAGGATCGCTCGCGGCTCTT
[0329] ACCAGCCTAACTTCGATCATTGGACCGCTGATCGTCACGGCGAT
[0330] TTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGATT
[0331] GTAGGCGCCGCCCTATACCTTGTCTGCCTCCCCGCGTTGCGTCG
[0332] CGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGC
[0333] GGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAGCCAAT
[0334] CAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGGC
[0335] AGAACATATCCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGG
[0336] CGCATCTCGGGCAGCGTTGGGTCCTGGCCACGGGTGCGCATGA
[0337] TCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTG
[0338] CCTTACTGGTTAGCAGAATGAATCACCGATACGCGAGCGAACGT
[0339] GAAGCGACTGCTGCTGCAAAACGTCTGCGACCTGAGCAACAAC
[0340] ATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGC
[0341] GGAAGTCAGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGC
[0342] GCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAA
[0343] GGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAA
[0344] AGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAA
[0345] AAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCT
[0346] GACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAA
[0347] ACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGC
[0348] TCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATA
[0349] CCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATA
[0350] GCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCC
[0351] AAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCT
[0352] GCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGA
[0353] CACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAG
[0354] CAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGG
[0355] TGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTG
[0356] CGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGC
[0357] TCTTGATCCGGCAAACAAACCACCCGCTGGTAGCGGTGGTTTTT
[0358] TTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAA
[0359] GAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAA
[0360] CGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAA
[0361] GGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAAT
[0362] CAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAAT
[0363] GCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTT
[0364] CATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATAC
[0365] GGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCG
[0366] AGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGC
[0367] CAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATC
[0368] CGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAA
[0369] GTTGTTGCCATTGCTGTTGTTGCCATTGCTGTTGTTGCCATTGCT
[0370] GTTGTTGCCATTGCTGTTGTTGCCATTGCTGTTGTTGCCATTGCT
[0371] GTTGTTGCCATTGCTGTTGTTGCCATTGCTGTTGTTGCCATTGCT
[0372] GTTGTTGCCATTGCTGTTGTTGCCATTGCTGTTGTTGCCATTGCT
[0373] GTTGTTGCCATTGCTGTTGTTGCCATTGCTGTTGTTGCCATTGCT
[0374] GTTGTTGCCATTGCTGTTGTTGCCATTGCTGTTGTTGCCATTGCT
[0375]
[0376] SEQ ID NO: 6 (pdelB2R plasmid)
[0377]
Claims
1. Use of a recombinant vaccinia virus in the preparation of a poxvirus vaccine or in the preparation of a vaccine vector; in, The recombinant vaccinia virus is a recombinant vaccinia virus VTT-dB / T / F that is deleted from the Tiantan strain of vaccinia virus in terms of TK gene, F4L gene and B2R gene. Wherein, the sequences of the TK gene, F4L gene and B2R gene are shown as SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.
2. Use of a recombinant vaccinia virus VTT-dB / T / F in the preparation of a poxvirus vaccine or in the preparation of a vaccine vector; in, The genome sequence of the recombinant vaccinia virus VTT-dB / T / F is relative to the genome sequence of the vaccinia virus Tiantan strain, and the partial sequence of the TK region, the partial sequence of the F4L region, and the B2R region are deleted; the partial sequence of the TK region is 80439-80465 in GenBank: JX489139.1, the partial sequence of the F4L region is 32451-33293 in GenBank: JX489139.1, and the sequence of the B2R region is 164449-165126 in GenBank: JX489139.
1.
3. A poxvirus vaccine comprising a recombinant vaccinia virus; in, The recombinant vaccinia virus is a recombinant vaccinia virus VTT-dB / T / F that is deleted from the Tiantan strain of vaccinia virus in terms of TK gene, F4L gene and B2R gene. Wherein, the sequences of the TK gene, F4L gene and B2R gene are shown as SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.
4. A poxvirus vaccine comprising a recombinant vaccinia virus VTT-dB / T / F; in, The genome sequence of the recombinant vaccinia virus VTT-dB / T / F is relative to the genome sequence of the vaccinia virus Tiantan strain, and the partial sequence of the TK region, the partial sequence of the F4L region, and the B2R region are deleted; the partial sequence of the TK region is 80439-80465 in GenBank: JX489139.1, the partial sequence of the F4L region is 32451-33293 in GenBank: JX489139.1, and the sequence of the B2R region is 164449-165126 in GenBank: JX489139.1.
Citation Information
Patent Citations
TK (Thymidine Kinase) gene removed recombinant VTT (Tian Tan strain) oncolytic VACA (Vaccinia Virus) and preparation and application thereof
CN109810953A
Recombinant virus for tumor treatment
CN110747174A
Recombinant poxviruses for cancer immunotherapy
CN112996917A