Use of cfo-mir159a in affecting lignin synthesis

By overexpressing or silencing the cfo-miR159a gene in Japanese cedar, lignin synthesis was regulated, solving the problems of Japanese cedar wood quality and properties, and achieving wood improvement and performance enhancement.

CN115927308BActive Publication Date: 2025-11-04NANJING FORESTRY UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202210890298.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-27
Publication Date
2025-11-04
Estimated Expiration
2042-07-27

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively regulate lignin synthesis in Japanese cedar, affecting wood quality and properties.

Method used

By introducing the Japanese cedar cfo-miR159a gene and its silencing sequence STTM159a, and using genetic engineering techniques to overexpress or silence cfo-miR159a in plants, recombinant vectors were constructed and transformed into host cells to promote or inhibit lignin synthesis.

Benefits of technology

It promotes lignin synthesis, increases wood quality, and improves wood properties, manifested in significant changes in plant height, stem width, lignin content, and cell wall thickness, and enhances the corrosion resistance and workability of Japanese cedar wood.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115927308B_ABST
    Figure CN115927308B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of plant molecular biology and genetic engineering, and specifically discloses application of cfo-miR159a in influencing lignin synthesis, obtains a precursor sequence fragment of cfo-miR159a from Cryptomeria fortunei, and performs expression analysis on the precursor sequence fragment in different periods and different tissues of the vascular cambium of the Cryptomeria fortunei, finally constructs an overexpression vector and a silencing expression vector to perform genetic transformation function verification, and the conclusion proves that the cfo-miR159a has a promoting effect on plant xylem development and synthesis of lignin, has an important influence on improvement of wood properties, and has important application value and significance.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of plant molecular biology and genetic engineering technology, and particularly relates to application of cfo-miR159a in affecting lignin synthesis. BACKGROUND

[0002] Cryptomeria fortunei is a common coniferous tree species in China, also known as long-leaf peacock pine, a plant of the genus Cryptomeria D.Don in the Taxodiaceae family, evergreen tall trees, which likes light and warm and humid climate and acid and alkaline suitable soil. The Cryptomeria fortunei trunk is straight, the wood texture is clear, the wood quality is light and soft, has strong corrosion resistance, easy processing and other characteristics, is a good industrial timber tree species, and is often used as an ornamental tree species in gardens because of its evergreen and beautiful tree shape. At the same time, Cryptomeria fortunei can prevent wind and sand, and maintain water and soil, and is a pioneer tree species for protective forest construction and desert greening. The lignification degree of Cryptomeria fortunei affects the size of the wood quality, thereby affecting the quality of the wood.

[0003] miR159 is one of the more conservative old families in plant miRNA, which can be involved in various plant physiological processes, including plant growth and development, biological and non-biological stress response and plant secondary metabolism. For example, overexpression of miR159 in Arabidopsis thaliana can inhibit the growth of Arabidopsis thaliana plants, and cause plant dwarfing and leaf curling. After mutation of miR159 in tobacco, the expression of NtGAMYB gene is increased, the growth of tobacco plants is inhibited, obvious growth defects appear, and the phenotype of loss of apical dominance appears. It can be seen that miR159 plays an important role in the growth and development period of plants, and it is of great significance to study its function to use genetic engineering technology to transfer the precursor sequence of cfo-miR159a and the STTM159a sequence silencing cfo-miR159a in Cryptomeria fortunei into other plants, and has great application prospect. SUMMARY

[0004] In order to solve the above problems, the primary purpose of the present application is to provide the application of cfo-miR159a in affecting lignin synthesis.

[0005] The specific technical scheme of the present application includes:

[0006] The present application provides a cfo-miR159a gene capable of affecting lignin synthesis, and the nucleotide sequence is shown as SEQ ID NO. 3.

[0007] A precursor gene of the cfo-miR159a gene is also provided, and the nucleotide sequence is shown as SEQ ID NO. 1.

[0008] The application also provides a STTM159a gene for silencing the expression of the cfo-miR159a gene, and the nucleotide sequence is shown in SEQ ID NO. 2.

[0009] The application also provides a vector, a recombinant bacterium or a host cell containing the cfo-miR159a gene, the precursor gene or the STTM159a gene.

[0010] As a further optimization scheme of the application, the vector is a plant recombinant expression vector, in particular, pBI121+cfo-miR159a or pBI121+STTM159a.

[0011] As a further optimization scheme of the application, the host cell is Agrobacterium EHA105.

[0012] The application also provides an application of the cfo-miR159a gene as described above in affecting the synthesis of lignin.

[0013] The application also provides an application of the precursor gene of the cfo-miR159a gene as described above in affecting the synthesis of lignin.

[0014] As a further optimization scheme of the application, the application comprises:

[0015] A, promoting the development of the xylem of a plant;

[0016] B, promoting the synthesis of lignin of a plant;

[0017] C, improving the wood properties of a plant.

[0018] As a further optimization scheme of the application, the plant is a cryptomeria or a tobacco.

[0019] In conclusion, the application has the following beneficial effects: the precursor sequence fragment of cfo-miR159a is obtained from cryptomeria, expression analysis is performed on different periods and different tissues of the vascular cambium of the cryptomeria, and finally, the overexpression vector and the silencing expression vector are constructed to perform genetic transformation function verification. The results show that the tobacco plants overexpressing cfo-miR159a are high, the stems are wide, the content of lignin is increased, the expression of lignin synthesis genes is increased, the number of cell layers is increased, and the thickness of cell walls is increased. The tobacco plants silencing expressing STTM159a are inhibited in growth, the plants are short, the stems are thin, the flower color is pale, the stamens are short, the content of lignin is reduced, the expression of lignin synthesis genes is reduced, the number of cell layers is reduced, and the cell arrangement is loose. It is concluded that cfo-miR159a has a promoting effect on the development of the xylem of a plant and the synthesis of lignin, has an important influence on the improvement of wood properties, and has important application value and significance. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 Figure of pBI121 map provided by the present application;

[0021] Figure 2 Figure of relative expression amount of cfo-miR159a at different development stages and different tissues provided by the present application;

[0022] Figure 3 Figure of growth process results of 35S::cfo-miR159a and 35S::STTM159a tobacco provided by the present application;

[0023] Figure 4 Figure of phenotype comparison results of 35S::cfo-miR159a and 35S::STTM159a tobacco after maturation provided by the present application;

[0024] (Note: the left side of figure A1, B1 is WT, and the right side is 35S::cfo-miR159a tobacco; the left side of figure A2, B2 is WT wild type, and the right side is 35S::STTM159a tobacco; the left side of figure C1 is 35S::cfo-miR159a tobacco, and the right side is WT wild type, and the left side of figure C2 is 35S::STTM159a tobacco, and the right side is WT wild type);

[0025] Figure 5 Figure of paraffin section observation of 35S::cfo-miR159a and 35S::STTM159a tobacco mature stem cross section provided by the present application;

[0026] Figure 6 Figure of scanning electron microscope observation of 35S::cfo-miR159a and 35S::STTM159a tobacco mature stem cross section provided by the present application;

[0027] Figure 7 Expression amount of 35S::cfo-miR159a tobacco and 35S::STTM159a tobacco lignin synthesis related genes provided by the present application. DETAILED DESCRIPTION

[0028] The following further describes the present application in conjunction with the drawings. It is necessary to point out that the following detailed description is only used to further illustrate the present application, and cannot be understood as limiting the protection scope of the present application. The skilled in the art can make some non-essential improvements and adjustments to the present application according to the above application content.

[0029] Example 1

[0030] I. Materials

[0031] The method used in this example is a conventional method known to those skilled in the art, and the reagents and other materials used are commercially available products unless otherwise specified; all primers in this example are synthesized by Beijing Genki Biotechnology Co., Ltd., and sequencing is completed by Shanghai Jie Li Biotechnology Co., Ltd.

[0032] II. Methods

[0033] 1. Cloning and expression analysis of cfo-miR159a precursor sequence

[0034] (1) Cloning of cfo-miR159a precursor sequence

[0035] Select the well-grown 3-year-old Cryptomeria fortunei of Baima Gene of Nanjing Forestry University as the sampling object, take the stem section as the material, extract total RNA and reverse transcribe into cDNA, and design the cfo-miR159a precursor sequence primer according to the transcriptome sequencing data and miRNA sequencing data of Cryptomeria fortunei in the laboratory.

[0036] Design specific amplification primers cfo-miR159a-F and cfo-miR159a-R, and perform PCR amplification with cDNA as the template, recover the PCR product, and connect the pBI121 vector Figure 1 ).

[0037] Among them, the specific amplification primers cfo-miR159a-F and cfo-miR159a-R are:

[0038] cfo-miR159a-F: 5'-TGGTAGAGTTCCTTTTATACC-3';

[0039] cfo-miR159a-R: 5'-CAGTAGAGCTCCCTTCAAACC-3';

[0040] Using the cDNA synthesized by reverse transcription as the template, the primers cfo-miR159a-F and cfo-miR159a-R are used for amplification. The amplification reaction system (50 μL) is: 25.0 μL 2×Phanta Max Master Mix, 2.0 μL Primer F, 2.0 μL Primer R, 1.0 μL template DNA, 20.0 μL ddH2O; The amplification reaction program is: 95℃ 3min; 95℃ 15sec, 56℃ 15sec, 72℃ 1min, 35 cycles; 72℃ 5min.

[0041] PCR products were detected by 2% agarose gel electrophoresis, and the miR59a target fragment was recovered and ligated to the vector pBI121, then transferred to E. coli competent cells, and the positive clones were detected and sent to Shanghai Jilei Biotechnology Co., Ltd. for sequencing. After the design of STTM159a sequence was completed, it was handed over to Nanjing Kingsray Biotech Co., Ltd. for synthesis and sequencing.

[0042] After sequencing, the DNAMAN software was used for alignment, and the results showed that the obtained cfo-miR159a and STTM159a nucleotide sequences were as shown in SEQ ID NO. 1 and SEQ ID NO. 2, and the sizes were 178 bp and 96 bp, respectively.

[0043] (2) Real-time fluorescent quantitative expression analysis of cfo-miR159a

[0044] U6 was selected as the internal reference gene, and according to the mature sequence nucleotide sequence of cfo-miR159a as SEQ ID NO. 3, miRNA Design was used to design the real-time quantitative stem loop primer.

[0045] RT-cfo-miR159a-F: CGCGTTGGTTTGAAGGGAG;

[0046] RT-cfo-miR159a-R: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACT

[0047] GGATACGACGTAGAG;

[0048] Real-time fluorescent quantitative PCR reaction system (20 μL): 10.0 μL 2 × miRNA Universal SYBR qPCR Master Mix, 1.0 μL Specific Primer (10 μM), 1.0 μL mQ Primer R, 2.0 μL template cDNA, 6 μL ddH2O; PCR amplification program: 95℃ 5min, 95℃ 10sec, 60℃ 30sec, 95℃ 15sec, 60℃ 60sec, 95℃ 15sec.

[0049] Fluorescent quantification results Figure 2) Display: cfo-miR159a showed a trend of first rising and then falling in five different growth stages, reaching the highest value in July. In previous studies, it was found that July was an active period of vascular cambium development in Cryptomeria japonica, and the high expression of cfo-miR159a in July suggested that it might be involved in the differentiation of the vascular cambium and the development of the xylem. The expression of cfo-miR159a in different tissues of Cryptomeria japonica was the highest in fruits and the lowest in roots, suggesting that cfo-miR159a might be involved in the reproductive development of Cryptomeria japonica.

[0050] 2. Construction of pBI121 expression vector and host cells

[0051] According to the successfully cloned cfo-miR159a precursor sequence and STTM159a sequence, the pBI121 vector was linearized using double enzyme digestion method to reduce the transformation background and reduce false positive clones.

[0052] According to the amplified cfo-miR159a precursor sequence and STTM159a sequence, the amplification primers of the insertion fragment were automatically generated by CE Design, and then the PCR amplification, recombination, transformation and identification of the target insertion fragment were carried out.

[0053] The constructed expression vectors pBI121+cfo-miR159a and pBI121+STTM159a were transformed into Agrobacterium EHA105 competent cells, and positive colonies were detected by PCR to obtain transformed host cells.

[0054] 3. Genetic transformation, screening and identification of tobacco

[0055] Wild non-resistant tobacco leaf discs were placed in the diluted bacterial liquid of transformed Agrobacterium EHA105 for infection, screening, seedling and soil culture Figure 3 DNA extraction and PCR detection were performed on transgenic tobacco, and finally cfo-miR159a and STTM159a transformed tobacco were obtained, denoted as 35S::cfo-miR159a tobacco and 35S::STTM159a tobacco, and the two were observed.

[0056] (1) Phenotype observation

[0057] The Agrobacterium-infected tobacco leaf discs were placed in the corresponding medium for culture, as shown in Figure 4 The 35S::cfo-miR159a tobacco showed a phenotype of taller plants, wider stems, larger and yellowish leaves, and the 35S::STTM159a tobacco showed a phenotype of shorter plants, thinner stems, smaller leaves, smaller flowers and lighter flower color.

[0058] (2) Paraffin section observation

[0059] As shown in Fig. 3, the number of xylem cell layers in the cross section of 35S::cfo-miR159a tobacco was significantly increased and arranged closely compared with wild type, and the number of xylem cell layers in the cross section of 35S::STTM159a tobacco was significantly reduced and arranged sparsely compared with wild type. Figure 5

[0060] (3) Scanning electron microscope observation

[0061] As shown in Fig. 4, the thickness of xylem in the cross section of 35S::cfo-miR159a tobacco was significantly increased, and the thickness of xylem in the cross section of 35S::STTM159a tobacco was significantly reduced, but the thickness of xylem cell wall in the two transgenic tobaccos did not change significantly compared with wild type. Figure 6 (4) Determination of lignin content in transgenic tobacco

[0062] The lignin content was determined by Klason method.

[0063] First, the harvested tobacco stem segments were dried and ground into powder, extracted with acetone and methanol and air-dried. 100.0 mg of air-dried sample was placed in a test tube, 3 ml of 72% concentrated sulfuric acid was added and hydrolyzed for 3 h, then 190 ml of sterile water was added and reacted at 121 °C for 1 h. The reaction was washed and filtered and dried to constant weight, and the weight was calculated. The acid-insoluble lignin content in the mature tobacco stem segments was calculated according to the formula. The filtrate was made up to 500 ml, and the absorbance of the filtrate was determined at a wavelength of 205 nm on a UV spectrophotometer. The acid-soluble lignin content in the mature tobacco stem segments was calculated according to the formula.

[0064] Results: The acid-soluble lignin content of 35S::cfo-miR159a tobacco was 2.91 ± 0.03%, the acid-insoluble lignin content was 15.42 ± 0.02%, and the total lignin content was 18.33%, which was significantly increased compared with wild type. The acid-soluble lignin content of 35S::STTM159a tobacco was 2.91 ± 0.05%, the acid-insoluble lignin content was 11.07 ± 0.03%, and the total lignin content was 13.99%, which was significantly decreased compared with wild type. It is shown that overexpression of cfo-miR159a can increase the acid-insoluble lignin content in tobacco.

[0065] (5) Determination of expression amount of lignin synthesis related genes in transgenic tobacco

[0066]

[0067] ​​Genes related to lignin synthesis in tobacco were searched using NCBI, and primers were designed. The correctness of the primer design was detected using semi-quantitative methods, and qPCR analysis was performed using the primers for the lignin synthesis-related genes that were verified to be correct.

[0068] like Figure 7 As shown, lignin synthesis-related genes were significantly upregulated in 35S::cfo-miR159a tobacco and significantly downregulated in 35S::STTM159a tobacco, indicating that cfo-miR159a can regulate the expression of lignin synthesis-related genes through relevant pathways.

[0069] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various improvements without departing from the concept of the present invention, and these improvements all fall within the scope of protection of the present invention.

Claims

1. A kind cfo-miR159a The application of precursor genes in promoting plant lignin synthesis, characterized by: The cfo-miR159a The nucleotide sequence of the precursor gene is shown in SEQ ID NO.1, and the plant is either Japanese cedar or tobacco.

Citation Information

Patent Citations

  • MiRNA fluorescent quantitative reference genes of different tissues of cryptomeria fortunei as well as primers and application thereof

    CN112980989A