Kluyveromyces marxianus haploid yeast and its construction method and application

Abstract

The present application belongs to the technical field of bioengineering, and particularly relates to a Kluyveromyces marxianus haploid yeast, a construction method and application thereof. The Kluyveromyces marxianus haploid yeast is a chassis strain, and is obtained by using Kluyveromyces marxianus ATCC 36534 as a microbial chassis host, on the basis of constructing a MATα3 gene-deficient strain, and through a spore induction and separation method, and is successfully applied to the fields of ergothioneine high-efficiency biosynthesis and extracellular secretion expression of hyaluronic acid degradation enzymes. The present application lays a foundation for developing the Kluyveromyces marxianus as a synthetic biology chassis, and confirms the application of the Kluyveromyces marxianus in the fields of high-value-added chemicals and industrial enzymes, and is suitable for industrial production application.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of bioengineering technology, and particularly relates to a Kluyveromyces marxianus haploid yeast and a construction method and application thereof. BACKGROUND

[0002] In recent years, with the vigorous development of synthetic biology, it is greatly promoting and improving the development of various microbial cell factories and the efficient biological manufacturing capacity. As the core part of biological manufacturing, the rational design and modification of industrial microbial chassis cells are playing an increasingly important role. With the help of synthetic biology technology, unconventional yeasts are gradually becoming a microbial cell with great development potential for green biological manufacturing of various natural products, biofuels and large-scale chemicals due to their unique properties, such as high-density fermentation, wide temperature and pH tolerance, and wide substrate spectrum.

[0003] Kluyveromyces marxianus widely exists in yogurt, fruits, kefir and other environments, and is a safe yeast in nature. As a new type of industrial microbial chassis cell, Kluyveromyces marxianus is a GRAS level yeast, which has been safety certified by the European Food Safety Supervision Agency and the US FDA, and also approved by the Chinese Health Committee as a new food raw material (in 2013), so it can be used for the production of nutritional chemicals, proteins, drugs and the like. Compared with Saccharomyces cerevisiae, Kluyveromyces marxianus has the advantages of higher growth temperature, faster growth rate and wider substrate utilization spectrum, and has a wide application in the food and feed industry, environmental field, biological medicine and the like, and is a kind of yeast cell factory host with great potential.

[0004] K.marxianus can exist in haploid cells and diploid form in natural environment. And haploid cells exist in two different sexes, mainly including mating-type a (MATa) type and mating-type a (MATa) type. Some excellent industrial K.marxianus strains, such as K.marxianus ATCC36534 and K.marxianus NRRL Y-6860, exist in diploid form, which greatly hinders the further engineering and application of the yeast in the field of synthetic biology. How to develop wild-type diploid yeast strains to obtain stable and excellent haploid strains has become one of the core problems of building K.marxianus cell factory. However, the current development of K.marxianus cell factory is still insufficient, and the existing reports only stop at the breeding of wild fermentation strains and the establishment of conventional knockout and expression tool methods (CN201610944729.3; CN201610944729.3). At the same time, K.marxianus is mainly applied in traditional food industry and synthesis of some bulk chemicals including ethanol and enzyme preparation. Therefore, constructing more convenient and efficient K.marxianus chassis strains and developing more high-value-added products will further promote the industrial application of the yeast. SUMMARY

[0005] The technical problem to be solved by the present application is to provide a K.marxianus haploid yeast.

[0006] The present application also solves the technical problem of providing a method for constructing the above-mentioned K.marxianus haploid yeast.

[0007] The present application finally solves the technical problem of providing the above-mentioned K.marxianus haploid yeast in the field of ergothioneine biosynthesis and the field of extracellular secretion of hyaluronidase.

[0008] To solve the above technical problems, the technical scheme adopted by the present application is as follows:

[0009] A K.marxianus haploid yeast, which is a chassis strain, is based on K.marxianus as a host, and is obtained by inducing sporulation separation method on the basis of constructing MATa3 gene-deficient strain.

[0010] The K.marxianus is Kluyvomyces marxianus ATCC36534, which was purchased from Beina Biology in September 2019.

[0011] The construction method of the Kluyveromyces marxianus haploid yeast comprises the following steps.

[0012] (1) Construction of a MATa3 gene-deficient strain: a MATa3 gene-deficient strain is obtained by knocking out the MATa3 gene of Kluyveromyces marxianus ATCC 36534;

[0013] (2) Construction of Kluyveromyces marxianus haploid yeast: the MATa3 gene-deficient strain obtained in step (1) is inoculated in a sporulation induction medium for culture, and cells are collected, and the collected cells are treated with lywallase to obtain a spore suspension, the spore suspension is inoculated on a YPD plate and verified, and Kluyveromyces marxianus haploid yeast cells are obtained.

[0014] Specifically, step (1) is to clone the nucleotide sequences shown in SEQ ID NO. 1-3 into an expression plasmid pMLG to obtain pMLG-sgRNA-UP-DOWN, and then the recombinant plasmid pMLG-sgRNA-UP-DOWN is transformed into Kluyveromyces marxianus by a chemical transformation method to obtain an engineering strain for knocking out the a3 gene.

[0015] In step (2), the formula of the sporulation induction medium is 1 g / L of glucose, 1.8 g / L of KCl, 8.2 g / L of NaAC, 2.5 g / L of yeast extract, and 20 g / L of agar.

[0016] In step (2), the culture condition is 30℃ and the culture time is 3-5 days. Preferably, the culture is carried out at 30℃ for 3 days.

[0017] The above-mentioned Kluyveromyces marxianus haploid yeast as a chassis strain in the construction of a microbial strain engineering strain is also within the scope of the present application.

[0018] The Kluyveromyces marxianus haploid yeast as a chassis strain in the construction of a gene engineering strain for biosynthesis of ergothioneine is also within the scope of the present application.

[0019] Specifically, the ergothioneine synthesis gene expression plasmid is transformed into the Kluyveromyces marxianus haploid yeast by a lithium acetate transformation method to construct a gene engineering strain for producing ergothioneine, and the fermentation preparation of ergothioneine is realized by using the gene engineering strain.

[0020] Specifically, taking the Schizosaccharomyces pombe genome as a template, the nucleotide sequence of SpEgt1 shown in SEQ ID NO. 4 is amplified by using primer SpEgt1-F and primer SpEgt1-R. The PCR product SpEgt1 is ligated with the plasmid pRSG which is double digested by restriction enzymes Nde I and Xhol I under the action of Exnase II by using one-step cloning method to obtain the recombinant plasmid pRSG-SpEgt1 and verify it. Taking the Schizosaccharomyces pombe genome as a template, the nucleotide sequence of SpEgt2 shown in SEQ ID NO. 5 is amplified by using primer SpEgt2-F and primer SpEgt2-R. The PCR product SpEgt2 is ligated with the plasmid pRSG-SpEgt1 which is double digested by restriction enzymes Sal I and Sma I under the action of Exnase II by using one-step cloning method to obtain the recombinant plasmid pRSG-SpEgt1-SpEgt2 and verify it. Figure 4 , Figure 5 ) After the verification of the recombinant plasmid pRSG-SpEgt1-SpEgt2 is successful, the plasmid is extracted, and the lithium acetate transformation method is used to transform the obtained K. marxianus haploid HP11, and the recovered transformation liquid is coated on the YPD agar plate containing G418 (100 μg / mL) and cultured at 37℃ for 12 hours. The single colony grown on the plate is observed to obtain the colony morphology of the recombinant strain and the positive strain verified by colony PCR, which is the K. marxianus engineering strain with ergothioneine expression plasmid.

[0021] Specifically, in the shake flask fermentation test of the K. marxianus engineering strain, it is found that the OD 600 reaches the maximum at 48h, and whether the precursor is added or not has a great influence on the yield of ergothioneine.

[0022] Specifically, in the fermentation tank fermentation test of the K. marxianus engineering strain, in the 10L fermentation tank, after 90h fermentation, the dry cell weight DCW in the fermentation tank can be up to 47.65g / L, the residual sugar amount in the fermentation broth changes from 200g to 7.8g, and the yield of ergothioneine is 835.6±31.6mg / L. The K. marxianus haploid is genetically engineered, and the expression of ergothioneine in the K. marxianus haploid HP11 is preliminarily realized.

[0023] The application of the K. marxianus haploid yeast as a chassis strain in the construction of the gene engineering strain for extracellular secretion and expression of hyaluronan-degrading enzyme is also within the scope of the application.

[0024] Specifically, the hyaluronic acid degrading enzyme gene expression plasmid is transformed into Kluyveromyces marxianus by lithium acetate transformation method, and the genetically engineered bacteria are used to realize the extracellular secretion expression of the hyaluronic acid degrading enzyme.

[0025] Specifically, the nucleotide sequence of the inulinase signal peptide is amplified by using primer Afactor-F and primer Afactor-R with Kluyveromyces marxianus ATCC 36534 genome as a template; the codon-optimized nucleotide sequence of Leecho hyaluronic acid degrading enzyme (NCBI accession number: X4Y2L4.1) from the database of Japanese leech genome template DNA is entrusted to General Bio (Anhui) Co., Ltd. for whole gene synthesis, and is amplified by PCR through primer Leecho-F and primer Leecho-R. The PCR product alpha-Leecho is connected with the plasmid pRSG digested by restriction endonucleases Nde I and Xhol I by using one-step cloning method under the action of Exnase II, to obtain the recombinant plasmid pRSG-alpha-Leecho and verify it. The verified recombinant plasmid pRSG-alpha-Leecho is extracted, and is transformed into the screened Kluyveromyces marxianus haploid HP11 by using chemical transformation method, and the recovered transformation liquid is coated on the YPD agar plate containing G418 (100 μg / mL), and is cultured at 37 DEG C for 12 hours. The single colony grown on the plate is observed to observe the colony morphology of the recombinant bacteria and the positive strain verified by colony PCR, that is, the Kluyveromyces marxianus haploid engineering bacteria with the hyaluronic acid degrading enzyme expression plasmid.

[0026] Specifically, in the enzyme production fermentation of the Kluyveromyces marxianus haploid engineering bacteria with the hyaluronic acid degrading enzyme expression plasmid, the protein content and enzyme activity in the fermentation broth are detected. The protein content in the fermentation broth is calculated according to the protein concentration standard curve, the extracellular protein content in the fermentation broth is 0.297 mg / mL, and the enzyme activity 2643±21 U / mL (g protein)-1min-1 can be calculated according to the enzyme activity calculation formula. Figure 8 ) is defined as follows: the amount of enzyme required to degrade 1 μmol of unsaturated double bond of hyaluronic acid per minute under given conditions. Through genetic engineering modification, the extracellular expression of Japanese leech hyaluronic acid degrading enzyme in Kluyveromyces marxianus haploid HP11 is realized.

[0027] Beneficial effects:

[0028] 1. The application constructs a stable, excellent performance, convenient and efficient Kluyveromyces marxianus haploid yeast HP11, which can be used as a chassis strain to develop more high-value-added products, and further promote the industrial application of the yeast.

[0029] 2. This invention utilizes a constructed *Xylaria xylene* haploid yeast HP11 to reconstruct the ergothioneine synthesis pathway, providing a novel method for the production of ergothioneine through food-grade microbial fermentation. The genetically engineered strain described in this invention, which stably and efficiently produces ergothioneine, achieves a yield of 835.6 ± 31.6 mg / L of ergothioneine after 90 hours of fermentation. This strain exhibits high safety, ease of genetic manipulation, and a short fermentation cycle, demonstrating significant application value and industrialization potential.

[0030] 2. This invention utilizes a constructed Max Kluyveromyces haploid yeast HP11 to reconstruct a hyaluronic acid degrading enzyme pathway, providing a novel method for the production of hyaluronic acid degrading enzymes through food-grade microbial fermentation. The genetically engineered strain described in this invention, which stably and efficiently produces hyaluronic acid degrading enzymes, exhibits an enzyme activity of 2643±21 U / mL in the fermentation broth after 72 hours of fermentation. This strain demonstrates high safety, ease of genetic manipulation, and a short fermentation cycle, possessing significant application value and industrialization potential. Attached Figure Description

[0031] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.

[0032] Figure 1 1A is a diagram of the plasmid pMLG-sgRNA-UP-DOWN construction process; 1B is a schematic diagram of electrophoresis detection of wild-type and knockout strains after PCR verification. Note: Lane 1: DL 5000 Marker; Lane 2: Wild-type; Lane 3: Knockout strain; 1C is a diagram of Kluyveromyces marxoiris type-alternating generations; 1D is an electrophoresis detection pattern verified by Sla-F / a2-R and Sla-F / α3-R PCR. Note: Lane 1: Sla-F / a2-R; Lane 2: Sla-F / α3-R; Lane 3: DL 15000 Marker.

[0033] Figure 2 This is a schematic diagram of the ergothioneine structure;

[0034] Figure 3 A schematic diagram of the ergothioneine synthesis pathway in eukaryotes;

[0035] Figure 44A is the process chart of constructing plasmid pRSG-SpEgt1-SpEgt2 (Sp1 is SpEgt1 and Sp2 is SpEgt2 in the chart); 4B is the electrophoresis detection schematic diagram of recombinant plasmid pRSG-SpEgt1-SpEgt2, note: lane 1: DL5000Marker; lane 2: pRSG-SpEgt1-SpEgt2 was verified by Nde 1 and Xho 1 enzyme digestion (the target band is 2322bp); lane 3: pRSG-SpEgt1-SpEgt2 was verified by Sal 1 and Sma 1 enzyme digestion (the target band is 1179bp);

[0036] Figure 5 The schematic diagram for adding methionine, histidine betaine and other precursors to affect the production of ergothioneine by the engineering bacteria;

[0037] Figure 6 The schematic diagram of ergothioneine production by the engineering bacteria in a 10L fermenter;

[0038] Figure 7 The electrophoresis schematic diagram of recombinant plasmid pRSG-Leecho. Note: lane 1: DL 5000Marker; lane 2: pRSG-Leecho was verified by Nde 1 and Xho 1 enzyme digestion (the target band is 1535bp);

[0039] Figure 8 The schematic diagram of the growth of engineering bacteria and enzyme activity in fermentation broth. DETAILED DESCRIPTION

[0040] The experimental methods described in the following examples are all conventional methods unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified.

[0041] Main experimental materials and experimental kits: E. coli DH5a competent cells (Nanjing Novozyme Bio-tech Co., Ltd.), primer synthesis (Nanjing Kingsriver Biological Technology Co., Ltd.), DNA sequencing (Shanghai Genechem Co., Ltd.), 2x Phanta Max Master Mix (Dye Plus) high-fidelity enzyme (Nanjing Novozyme Bio-tech Co., Ltd.), restriction endonuclease Sph I, Bcl I, Nde I, Xho I, Sal I, Sma I (Takara), DNA marker (Nanjing Novozyme Bio-tech Co., Ltd.), plasmid extraction kit (Nanjing Novozyme Bio-tech Co., Ltd.), gel recovery kit (Nanjing Novozyme Bio-tech Co., Ltd.), one-step cloning connection Exnase II kit (Nanjing Novozyme Bio-tech Co., Ltd.), pMLG plasmid (constructed by the laboratory independently, on the basis of pML plasmid, the screening marker was replaced from URA3 to G418, the original 2μori replication element on the plasmid was replaced by the autonomous replication sequence ARS1, the nucleotide sequence of pMLG plasmid is shown as SEQ ID NO. 8), pRSG plasmid (constructed by the laboratory independently, on the basis of pRS426 plasmid, the screening marker URA3 was replaced by G418, the original 2μori replication element on the plasmid was replaced by the autonomous replication sequence ARS1, and the MCS expression frame of the original plasmid was increased to two by adding enzyme digestion sites and T ADH1 Terminator, P PGK Promoter, p

[0042] Fermentation broth ergothioneine detection method: product is determined using HPLC system, Hypersil ODS C18 column (250mmx4.6mmx5μm); column temperature: 30℃; mobile phase: methanol: water (1:99v / v); flow rate: 0.7mL / min; detection wavelength: 257nm; injection volume: 5μL; detection time: 20min.

[0043] Method for determining enzyme activity of hyaluronic acid-degrading enzyme in fermentation broth: HAase specifically acts on the glucuronide bond of HA to produce small molecular polysaccharides with a reducing end of glucuronic acid. The 3,5-dinitrosalicylic acid (DNS) colorimetric method is used to determine the reducing sugar equivalent produced by hydrolyzed HA, and the analytical pure glucose is used as the standard curve, and the protein content is determined by the Coomassie brilliant blue method to calculate the specific enzyme activity. 0.2% HA substrate is prepared with pH 5.5, 50mM citric acid-sodium phosphate buffer, 1mL reaction system contains 800μL of HA solution, 100μL of enzyme solution, and the buffer is supplemented to 1mL. Reaction at 37℃ for 20min, immediately stop the reaction in boiling water, and the DNS method is used to determine the reducing sugar equivalent (equivalent to the reducing power of an equivalent amount of glucose), and the enzyme activity ratio is calculated.

[0044] In the following examples, the strain used is Kluyvomyces marxianus, strain number: ATCC 36534, purchased from Beina Biology in September 2019.

[0045] The MATa3 gene-deficient strain described in this paper and the engineering strain with the a3 gene knocked out represent the same meaning.

[0046] Example 1: Obtaining of a3 gene knockout strain and haploid strain

[0047] The recombinant fragment for knockout is composed of the upstream and downstream homologous arms of the gene to be knocked out (upstream homologous arm-downstream homologous arm). The nucleotide sequences shown in SEQ ID NO. 1-3 are cloned into the expression plasmid pMLG to obtain pMLG-sgRNA-UP-DOWN, and then the recombinant plasmid pMLG-sgRNA-UP-DOWN is transformed into Kluyvomyces marxianus by chemical transformation method to obtain the engineering strain with the a3 gene knocked out, and the specific process is as follows:

[0048] (1) The nucleotide sequence of UP shown in SEQ ID NO. 1 is amplified by using primer UP-F and primer UP-R. The nucleotide sequence of DOWN shown in SEQ ID NO. 2 is amplified by using primer DOWN-F and primer DOWN-R. The nucleotide sequence of sgRNA shown in SEQ ID NO. 3 is amplified by using primer sgRNA-F and primer sgRNA-R.

[0049] Table 1 Primer sequence-1 used in example 1

[0050]

[0051]

[0052] PCR amplification system: genomic template DNA: 2 μL, primer F and primer R: 2 μL each, 2 × Phanta Max Master Mix (Dye Plus) high-fidelity enzyme: 12.5 μL, ddH2O: 6.5 μL;

[0053] PCR reaction program: 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, then 55°C annealing for 30 s, 72°C extension for 1 min, for 35 cycles; recover the PCR amplification product, and connect the three fragments in overlap;

[0054] Overlap PCR amplification system: 2 μL of each of the three fragments, 2 μL of primer sgRNA-F and DN-R, 2 × Phanta Max Master Mix (Dye Plus) high-fidelity enzyme: 12.5 μL, ddH2O: 2.5 μL; recover the overlap PCR product;

[0055] Overlap PCR reaction program: 95°C pre-denaturation for 10 min, 95°C denaturation for 30 s, then 55°C annealing for 1 min, 72°C extension for 3 min, for 35 cycles; recover the PCR amplification product;

[0056] The overlap PCR product and the plasmid pMLG digested by restriction endonucleases Sph I and Bcl I are connected using one-step cloning method under the action of Exnase II, to obtain the recombinant plasmid pMLG-sgRNA-UP-DOWN;

[0057] (2) The recombinant plasmid pMLG-sgRNA-UP-DOWN is transformed into competent Escherichia coli DH5α, and is coated on LB solid culture medium containing 100 μg / mL ampicillin, and is incubated at 37°C for 12-16 h to obtain primary positive clones; the primary positive clones are respectively picked into 5 mL of LB liquid medium containing 100 μg / mL ampicillin, and are incubated at 37°C and 200 rpm overnight, and the plasmid is extracted, the plasmid is double-digested by restriction endonucleases Sph I and Bcl I, and the plasmid with the DNA overlap fragment with the sequence table SEQ ID NO: 1-3 is judged as the recombinant plasmid pMLG-sgRNA-UP-DOWN Figure 1 A).

[0058] (3) The recombinant plasmid pMLG-sgRNA-UP-DOWN after successful verification was extracted, and the chemical transformation method was used to transform into Kluyveromyces marxianus strain, and the recovered transformation liquid was coated on the YPD agar plate containing G418 (100 μg / mL), 37°C, and incubated for 12 h. The single colony growing on the plate was observed to observe the colony morphology of the recombinant strain and the positive strain of colony PCR verification, that is, the α3 gene knockout strain Figure 1 B), and the verification primers used were α3Out-F and α3Out-R.

[0059] (4) The α3 gene knockout strain was diluted and coated on the sporulation induction medium, and the sporulation induction medium was glucose 1 g / L, KCl 1.8 g / L, NaAC 8.2 g / L, yeast extract 2.5 g / L, and agar 20 g / L. 30°C constant temperature culture for 3 days, scrape the colony periphery mud, sterile water wash two to three times, use 1.2M sorbitol to prepare 100mg / mL snailase solution, add 200 μL snailase solution, hydrolyze at 37°C for 1h, 55°C for 10min, use vortex instrument to fully shake for 5-10min, 4000rpm centrifuge for 5min, resuspend with 200 μL sterile water, dilute and coat on YPD plate, use SLA-F and α3-R to identify yeast MATα mating type, use SLA-F and a2-R to identify MATa mating type. According to the yeast mating type generation map of Figure 1 C, after knocking out the α3 gene, the haploid with MATα mating type will remain MATα. A MATα mating type Kluyveromyces marxianus haploid was identified by PCR, such as Figure 1 D.

[0060] Table 2 Primer sequence used in example 1-2

[0061] Primer (5'-3') Sequence a3Out-F CCAGTATTCAAGTGTTTATTAAGAATTATTCAA a3Out-R AGCTACATAGTATTCCGCTTCAAATTCT SLA-F ATGTCAAGGGAAGAACAAGCGTTAGAGAAGTCTA α3-R ACCAATTATATATTGATGTAAAAACAGA a2-R TTAAACAAGGAAGAGATCTTCGATAA

[0062] Example 2: Construction of ergothioneine expression pathway in Kluyveromyces marxianus haploid

[0063] Ergothioneine (2-mercapto-L-histidine trimethyl inner salt, Ergothioneine, EGT) is a special amino acid derived from histidine, which has a mercapto group on the second C atom of the imidazole ring, and the structure is as shown in Figure 2 . Figure 3The synthesis pathway of ergothioneine in eukaryotes is shown. In eukaryotes, Egt1 transfers three methyl groups from S-adenosylmethionine (SAM) to histidine to form histidine trimethylsulfonium, and further catalyzes histidine trimethylsulfonium to form histrinylcysteine sulfoxide by using oxygen and cysteine, and finally generates L-EGT by catalysis of Egt2.

[0064] (1) Construction of SpEgt1 expression plasmid

[0065] The nucleotide sequence of SpEgt1 shown in SEQ ID NO. 4 is amplified using the primer SpEgt1-F and the primer SpEgt1-R as templates with the Schizosaccharomyces pombe genome.

[0066] The PCR amplification system is as follows: Schizosaccharomyces pombe genomic template DNA: 2 μL, primer F and primer R: 2 μL each, 2×Phanta Max Master Mix (Dye Plus) high-fidelity enzyme: 12.5 μL, ddH2O: 6.5 μL.

[0067] The PCR reaction program is as follows: 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, then 55°C annealing for 30 s, 72°C extension for 2 min 30 s, for 35 cycles; and recovering the PCR amplification product.

[0068] The PCR product SpEgt1 and the plasmid pRSG digested by the restriction endonucleases Nde I and Xhol I are connected using one-step cloning under the action of Exnase II to obtain the recombinant plasmid pRSG-SpEgt1.

[0069] The recombinant plasmid pRSG-SpEgt1 is transformed into the competent Escherichia coli DH5α, and is coated on the LB solid medium containing 100 μg / mL ampicillin and is incubated at 37°C for 12-16 h to obtain the preliminary positive clones; the preliminary positive clones are respectively picked into 5 mL of LB liquid medium containing 100 μg / mL ampicillin, and are incubated at 37°C and 200 rpm overnight; the plasmid is extracted, the plasmid is digested by the restriction endonucleases Nde I and Xhol I, and according to the electrophoresis result, it is judged that the SpEgt1 plasmid with the sequence table SEQ ID NO: 4 is the recombinant plasmid pRSG-SpEgt1, and the colony with the plasmid is the positive clone strain.

[0070] (2) Construction of SpEgt2 expression plasmid

[0071] The nucleotide sequence of SpEgt2 shown in SEQ ID NO. 5 was amplified using primer SpEgt2-F and primer SpEgt2-R as templates and the genome of Schizosaccharomyces pombe as a template.

[0072] The PCR amplification system was as follows: 2 μL of the genomic template DNA of Schizosaccharomyces pombe, 2 μL of primer F and 2 μL of primer R, 12.5 μL of 2x Phanta Max Master Mix (Dye Plus) high-fidelity enzyme, and 6.5 μL of ddH2O.

[0073] The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, then annealing at 55°C for 30 s, extension at 72°C for 2 min 30 s, for 35 cycles, and recovery of the PCR amplification product.

[0074] The PCR product SpEgt2 was ligated with the plasmid pRSG-SpEgt1 digested with restriction endonucleases Sal I and Sma I using one-step cloning under the action of Exnase II to obtain the recombinant plasmid pRSG-SpEgt1-SpEgt2. Figure 4 Figure 5 ).

[0075] Table 3 Primer sequences used in Example 2

[0076]

[0077] The recombinant plasmid pRSG-SpEgt1-SpEgt2 was transformed into competent Escherichia coli DH5α, and was inoculated on LB solid medium containing 100 μg / mL ampicillin and was incubated at 37°C for 12-16 h to obtain primary positive clones. The primary positive clones were inoculated in 5 mL of LB liquid medium containing 100 μg / mL ampicillin, and were incubated at 37°C and 200 rpm overnight. The plasmid was extracted, and the plasmid was digested with restriction endonucleases Sal I and Sma I. According to the electrophoresis results, the SpEgt2 plasmid with the sequence table SEQ ID NO: 5 was the recombinant plasmid pRSG-SpEgt1-SpEgt2, and the colony with the plasmid was the positive clone strain.

[0078] ​(3) The successfully validated recombinant plasmid pRSG-SpEgt1-SpEgt2 was extracted and transformed into the selected Kluyveromyces martensii haploid HP11 using the lithium acetate conversion method. The resuscitation and transformation solution was plated onto YPD agar plates containing G418 (100 μg / mL) and incubated at 37°C for 12 h. Single colonies that grew from the plates were picked to observe the colony morphology of the recombinant bacterial strain and to verify the colony PCR positive strain. These were identified as Kluyveromyces martensii engineered strains with ergothionein expression plasmids.

[0079] Example 3: Investigation of shake-flask fermentation of engineered *Kluyveromyces martensii*

[0080] Glyceryl oleoresinian strains expressing ergothioneine plasmids were inoculated into seed culture medium containing G418 antibiotic (20 g / L glucose, 10 g / L yeast extract, 20 g / L peptone) and cultured overnight at 30°C and 220 rpm for 12-16 h. The culture was then transferred to 250 mL Erlenmeyer flasks containing 50 mL of fermentation medium (20 g / L glucose, 10 g / L yeast extract, 20 g / L peptone), at an inoculation rate of 2% v / v, and cultured at 30°C and 220 rpm for 48 h. At 12 h of culture, 2-10 g / L methionine and 10-15 g / L histidine, betaine, histidine, and cysteine ​​were added to the fermentation medium. After shake-flask fermentation, the ergothioneine yield of the fermentation broth was measured. The results are as follows: Figure 5 It can be seen that at 48 hours of fermentation, OD 600 The yield of ergothionein is maximized, and the addition of precursor substances has a significant impact on its production.

[0081] Example 4: Fermentation Investigation of Engineered Microorganisms in a Fermentation Tank

[0082] From the streak plate of the engineered bacteria, use an inoculation loop to take a single colony and inoculate it into seed culture medium containing G418 antibiotic (20 g / L glucose, 10 g / L yeast extract, 20 g / L peptone), and incubate overnight at 30°C and 220 rpm for 12-16 h. Inoculate the seed culture into a shake flask (5% v / v) or a 250 ml Erlenmeyer flask (50 mL of the solution), and incubate overnight at 30°C and 220 rpm to prepare the seed culture. Transfer the seed culture to a 10% v / v fermenter containing fermentation medium (20 g / L glucose, 10 g / L yeast extract, 20 g / L peptone).

[0083] The stirring speed of the fermenter was 450-800 rpm, the dissolved oxygen was coupled, the dissolved oxygen was controlled at 40%, the temperature was 30℃, and the air flow was 3 L / min. At 24 h of fermentation, 5 g / L methionine, 10 g / L histidine betaine, histidine, and cysteine were added to the fermentation medium. After the fermentation in the fermenter was completed, the ergothioneine yield of the fermentation broth was detected. The results are shown in Table 1. Figure 6 In the 10 L fermenter, after 90 h of fermentation, the dry cell weight DCW in the fermenter was as high as 47.65 g / L, and the ergothioneine yield was 835.6±31.6 mg / L. Through genetic engineering of the haploid of Kluyveromyces marxianus, the expression of ergothioneine in the haploid of Kluyveromyces marxianus HP11 was initially realized, and subsequent fermentation optimization techniques such as medium optimization and promoter optimization can be used to further improve the yield of ergothioneine.

[0084] Example 5: Construction of an expression pathway of hyaluronic acid-degrading enzyme in the haploid of Kluyveromyces marxianus

[0085] (1) Using the genome of Kluyveromyces marxianus ATCC 36534 as a template, the nucleotide sequence of the inulinase signal peptide was amplified by using primer Afactor-F and primer Afactor-R; the codon-optimized nucleotide sequence of Leecho hyaluronic acid-degrading enzyme (NCBI accession number: X4Y2L4.1) derived from the database of the genome of Japanese leech was entrusted to General Bio (Anhui) Co., Ltd. for full gene synthesis, and PCR amplification was performed by using primer Leecho-F and primer Leecho-R.

[0086] Table 4 Primer sequences used in Example 5

[0087]

[0088] The PCR amplification system was as follows: 2 μL of the database of the genome of Japanese leech, 2 μL of primer F and primer R, 12.5 μL of 2×Phanta Max Master Mix (Dye Plus) high-fidelity enzyme, and 6.5 μL of ddH2O; 2 μL of the inulinase signal peptide genomic template DNA, 2 μL of primer F and primer R, 12.5 μL of 2×Phanta Max Master Mix (Dye Plus) high-fidelity enzyme, and 6.5 μL of ddH2O.

[0089] The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, then 55℃ annealing for 30 s, 72℃ extension for 2 min 30 s, for 35 cycles, and recovery of the PCR amplification product.

[0090] The recovered inulinase signal peptide gene (SEQ ID NO: 6) was overlapped with the Lee cho degrading enzyme gene (SEQ ID NO: 7), and the overlapping PCR amplification system was as follows: inulinase signal peptide gene: 2 μL; Lee cho degrading enzyme gene: 2 μL, primer F and primer R: 2 μL each; 2 × Phanta Max Master Mix (Dye Plus) high-fidelity enzyme: 12.5 μL, ddH2O: 6.5 μL.

[0091] The PCR reaction program was as follows: 95 °C pre-denaturation for 10 min, 95 °C denaturation for 30 s, then 55 °C annealing for 1 min, 72 °C extension for 2 min, for 35 cycles; and the PCR amplification product was recovered.

[0092] The PCR product α-Leecho was ligated with the plasmid pRSG digested by restriction endonucleases Nde I and Xhol I using one-step cloning under the action of Exnase II, to obtain the recombinant plasmid pRSG-α-Leecho Figure 7 );

[0093] The recombinant plasmid pRSG-α-Leecho was transformed into competent Escherichia coli DH5α, and was coated on LB solid medium containing 100 μg / mL ampicillin, and was incubated at 37 °C for 12-16 h to obtain primary positive clones; the primary positive clones were respectively picked into 5 mL of LB liquid medium containing 100 μg / mL ampicillin, and were incubated at 37 °C and 200 rpm overnight, and the plasmid was extracted, and the plasmid was double-digested by restriction endonucleases Nde I and Xhol I, and according to the electrophoresis results, the α-Leecho plasmid with the sequence table SEQ ID NO: 6-7 was judged as the recombinant plasmid pRSG-α-Leecho, and the colony with the plasmid was the positive clone strain.

[0094] (2) The recombinant plasmid pRSG-α-Leecho verified successfully was extracted, and was transformed into the screened K. marxianus haploid HP11 by chemical transformation, and the recovered transformation liquid was coated on YPD agar plate containing G418 (100 μg / mL), and was incubated at 37 °C for 12 h. The single colony grown on the plate was observed to observe the colony morphology of the recombinant strain and the colony PCR verified positive strain, that is, the K. marxianus haploid engineering strain with hyaluronidase expression plasmid.

[0095] Example 6 Fermentation of enzyme production by engineering bacteria

[0096] The glycerol tube seed of the haploid engineering bacteria of the Kluyveromyces marxianus with the hyaluronidase expression plasmid is inoculated into the resistant seed culture medium (glucose 20 g / L, yeast powder 10 g / L, peptone 20 g / L), and is cultured at 30°C, 220 rpm overnight, is transferred into a 250 mL flask with 50 mL fermentation medium (glucose 20 g / L, yeast powder 10 g / L, peptone 20 g / L), the inoculation amount is 2% v / v, and is cultured at 30°C, 220 rpm for 72 h. After the shake flask fermentation is finished, the protein content and enzyme activity in the fermentation liquor are detected. According to the protein concentration standard curve, the protein content in the fermentation liquor is calculated, the extracellular protein content in the fermentation liquor is 0.297 mg / mL, and according to the enzyme activity calculation formula, the enzyme activity 2643±21 U / mL( Figure 8 ) can be calculated. The enzyme activity is defined as follows: the amount of enzyme required for degrading hyaluronic acid to form 1 μmol unsaturated double bond per minute under given conditions. Through genetic engineering modification, the extracellular expression of the hyaluronidase of Japanese medical leech in the haploid Kluyveromyces marxianus HP11 is preliminarily realized, and the yield of the hyaluronidase can be further improved through signal peptide optimization, culture medium optimization and the like.

[0097] The application provides a Kluyveromyces marxianus and a construction method and application idea and method thereof. There are many methods and approaches for specifically realizing the technical scheme, and the above description is only a preferred embodiment of the application. It should be noted that, for ordinary skilled persons in the art, some improvements and refinements can be made without departing from the principle of the application, and these improvements and refinements should also be regarded as the protection scope of the application. The components not explicitly described in the embodiment can be realized by using the prior art.​

Claims

1. Application of Max Kluyveromyces haploid as a chassis strain in the construction of genetically engineered bacteria for the biosynthesis of ergothionein; in, The aforementioned *Kluyveromyces martensii* haploid yeast uses *Kluyveromyces martensii* as the host in the construction... MATα3 Obtained from gene-deficient strains through induced sporulation isolation method; Among them, the Kluyveromyces martensii is Kluyveromyces martensii. Kluyveromyces marxianus ATCC36534; The Max Kluyveromycetes haploid yeast is MATα-type.

2. The application according to claim 1, characterized in that, Ergothioneine synthesis gene expression plasmid was transformed into Max Kluyvere haploid yeast using lithium acetate conversion method to construct a genetically engineered strain for ergothioneine production, and ergothioneine was prepared by fermentation using this genetically engineered strain.

3. Application of Max Kluyveromyces haploid as a chassis strain in the construction of genetically engineered bacteria that express extracellular secretory hyaluronic acid degrading enzyme; in, The aforementioned *Kluyveromyces martensii* haploid yeast uses *Kluyveromyces martensii* as the host in the construction... MATα3 Obtained from gene-deficient strains through induced sporulation isolation method; Among them, the Kluyveromyces martensii is Kluyveromyces martensii. Kluyveromyces marxianus ATCC36534; The Max Kluyveromycetes haploid yeast is MATα-type.

4. The application according to claim 3, characterized in that, The hyaluronic acid degrading enzyme gene expression plasmid was transformed into Max Kluyvellus haploid yeast using the lithium acetate conversion method, and the extracellular secretory expression of hyaluronic acid degrading enzyme was achieved using this genetically engineered strain.

Images