A double-plasmid system suitable for yeast prime editing and application thereof

By introducing a yeast-compatible dual-plasmid system into yeast and using the epigRNA and nCas-RT protein complex for gene editing, the problem of low editing efficiency in yeast was solved, achieving efficient and accurate editing of the ADE2 gene and promoting the transformation of engineered strains.

CN115948449BActive Publication Date: 2026-03-27ZJU HANGZHOU GLOBAL SCI & TECH INNOVATION CENT
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-20
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

Existing gene editing technologies are inefficient in Saccharomyces cerevisiae, failing to meet the needs of large-scale modification of engineered strains, and the 3' ends of pegRNAs are easily degraded, affecting editing efficiency.

Method used

A dual-plasmid system suitable for yeast was designed, comprising a first plasmid expressing epigRNA and a second plasmid expressing the nCas9-M-MLV RT fusion protein. By introducing a motif at the 3' end of the epigRNA, gene editing is performed using the epigRNA and nCas-RT protein complex, thereby improving editing efficiency.

Benefits of technology

It significantly improved the editing efficiency of the leader editing system in yeast, promoted the cost-effective conversion of engineered strains, and achieved efficient and accurate editing of the ADE2 gene.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115948449B_ABST
    Figure CN115948449B_ABST
Patent Text Reader

Abstract

The application discloses a double-plasmid system suitable for yeast lead editing and application, and relates to microbial gene editing and modification. The double-plasmid system comprises a first plasmid and a second plasmid. The first plasmid contains a sequence for coding epegRNA. The epegRNA is an RNA molecule with a motif introduced at the 3' end of pegRNA. The sequence of the motif is shown as SEQ ID NO. 12. The second plasmid contains a sequence for coding a fusion protein formed by nucleic acid nicking enzyme nCas9 and reverse transcriptase M-MLV RT. The application detects the editing efficiency of the lead editing system in yeast for the first time. Meanwhile, the double-plasmid expression system is used to separately express epegRNA and nCas-RT protein, so that the editing efficiency of the lead editing system in yeast is improved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to microbial gene editing and modification, in particular to a dual-plasmid system suitable for yeast prime editing and application thereof. BACKGROUND

[0002] In 2019, Anzalone et al. first proposed a prime editing system (Prime editing), referred to as "PE", which is a new generation of gene editing technology after the CRISPR-Cas editing system. The PE system is composed of two parts of prime editing gRNA (pegRNA), nucleic acid nickase Cas9-nickase (nCas9) and engineered reverse transcriptase M-MLV RT fusion protein. The pegRNA is composed of sgRNA, primer binding site (PBS) and reverse transcription template sequence containing the genetic information to be edited. Under the guidance of pegRNA, the nCas9-M-MLV RT complex reaches the target site to produce a single-strand break on the DNA strand containing PAM (protospacer adjjacent motif); the broken target DNA strand is complementary to the PBS sequence in pegRNA; the M-MLV RT protein starts reverse transcription along the RT template sequence, transferring the required editing information from pegRNA to DNA; the cut of the DNA strand forms 3'-flap and 5'-flap structures in dynamic balance, wherein the 5'-flap structure without editing information is easily recognized and removed by exonuclease, and the 3'-flap with editing information is incorporated into the DNA double strand by competition to form heteroduplex DNA; after DNA mismatch repair, precise gene editing is achieved at the target site. The PE system does not require DSB and donor DNA template, and is more functional and accurate to a certain extent than other gene editors.

[0003] David Liu et al. studies have shown that the 3' end of pegRNAs is prone to degradation, which can significantly interfere with the efficiency of prime editing. Studies have found that adding a structural RNA motif to the 3' end can increase the stability of pegRNAs, and the modified pegRNAs (epegRNAs) can significantly improve the efficiency of prime editing. In addition, researchers have also developed a computational tool pegLIT to guide the design and optimization of epegRNAs, and have demonstrated the great potential of epegRNAs for gene therapy at multiple pathogenic sites (Nelson, J.W., Randolph, P.B., Shen, S.P. et al. Engineered pegRNAs improve prime editing efficiency. Nat Biotechnol, 2022, 40, 402-410.). But the PE system suitable for Saccharomyces cerevisiae has not been reported.

[0004] Saccharomyces cerevisiae has the advantages of safety, non-pathogenicity, clear genetic background, simple culture and rapid propagation. Engineered yeast cells are also widely used to produce post-translationally modified recombinant proteins, drugs, biofuels and other high-value-added products. However, gene editing techniques based on recombinant enzymes and homologous recombination have failed to meet the requirements of large-scale modification of engineered strains, and new gene editing tools need to be developed to promote the cost-effective transformation of engineered strains. As a new gene editing method, the development of a PE system suitable for Saccharomyces cerevisiae (model strain BY4741, industrial strain ERΔHWLV) and the verification of its gene editing ability not only enriches the gene editing methods of yeast, but also provides more possibilities for comprehensive editing of the yeast genome, and promotes the application of industrial strains in actual production. SUMMARY

[0005] The present application provides a dual-plasmid system suitable for yeast PE, which comprises a first plasmid and a second plasmid, wherein the first plasmid comprises a first expression cassette for expressing a pegRNA sequence, and the second plasmid comprises a second expression cassette for expressing a nCas9-M-MLV RT fusion protein. The results show that the dual-plasmid system of the present application can successfully mutate the 158th glycine (GGT) in the ADE2 gene of the yeast strain (BY4741, ERΔHWLV) to the stopper TAA.

[0006] The technical solutions of the present application are as follows:

[0007] The present application provides a dual-plasmid system suitable for yeast prime editing, comprising a first plasmid and a second plasmid, wherein the first plasmid comprises a sequence for encoding epegRNA,

[0008] The epegRNA is an RNA molecule with a motif introduced at the 3' end of the pegRNA, the sequence of the motif is shown as SEQ ID NO. 12.

[0009] The second plasmid contains a sequence for encoding a fusion protein formed by fusing the nucleic acid nicking enzyme nCas9 and the reverse transcriptase M-MLV RT.

[0010] Preferably, the pegRNA contains an sgRNA targeting the DNA of interest, a primer binding site, and a reverse transcription template sequence containing the genetic information to be edited.

[0011] Preferably, the reverse transcriptase M-MLV RT includes five site mutations, D200N, L603W, T330P, T306K and W313F. D200N means that the 200th amino acid aspartic acid is mutated to asparagine, and the others are the same.

[0012] As a preferred, the first plasmid further includes a sequence for encoding PE3 nicking-sgRNA, which is connected to the sequence for encoding epegRNA through a Pre-tRNA sequence, the sequence for encoding PE3 nicking-sgRNA is shown as SEQ ID NO. 14, and the Pre-tRNA sequence is shown as SEQ ID NO. 13.

[0013] As a preferred, the first plasmid uses the expression vector pCRCT as a backbone, and the sequence of the first plasmid is shown as SEQ ID NO. 2.

[0014] As a preferred, the second plasmid uses the expression vector p415 as a backbone, and the sequence of the second plasmid is shown as SEQ ID NO. 5.

[0015] The application also provides the use of the double-plasmid system in yeast gene editing.

[0016] The application also provides a gene editing method suitable for yeast lead editing, which uses the double-plasmid system, and the gene editing method includes the following steps:

[0017] (1) Design the epegRNA sequence according to the sequence of the target gene to be edited, and obtain the first plasmid by cloning;

[0018] (2) Introduce the first plasmid and the second plasmid into the edited body to achieve gene editing.

[0019] The application has the following beneficial effects:

[0020] The application detects the editing efficiency of the prime editing system in yeast for the first time, and uses a double-plasmid expression system to separately express epegRNA and nCas-RT protein, thereby improving the editing efficiency of the prime editing system in yeast.

[0021] The application uses pretRNA to connect pegRNA and nicking-sgRNA, and introduces a motif at the 3' end of pegRNA, so that the editing efficiency of the prime editing system in yeast can be effectively improved, and the cost-effectiveness of the engineering strain is promoted. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 ADE2-PE3-epegRNA sequence diagram.

[0023] Figure 2 P415-PE3 double-plasmid system editing efficiency diagram in different yeast strains.

[0024] Figure 3 P415-PE3 double-plasmid system editing information diagram in different yeast strains. DETAILED DESCRIPTION

[0025] Prime editors include two parts of pegRNA and nCas-RT protein complex. Anzalone V.A. et al. developed three prime editors, PE1, PE2, PE3 and PE3b. In PE1, the wild-type Moloney murine leukemia virus (M-MLV) RT is fused with nCas9. PE2 introduces mutations (RT D200N+L603W+T330P+T306K+W313F) in five sites on the basis of PE1, which can improve the thermal stability, progressivity and DNA-RNA substrate affinity of M-MLV reverse transcriptase, thereby improving the editing efficiency. PE3 introduces an sgRNA on the basis of PE2 to cut the DNA non-editing strand to form a wound. The DNA repair mechanism is to repair the chain with a gap first, so as to reduce the repair of the editing chain in PE2. The pegRNA contains a spacer sequence sgRNA that guides the binding with the target DNA, a PBS site (8 to 15 bases), and a RT template sequence (containing a mutation to be introduced). The introduction of a motif (tevopreQ) at the 3' end of pegRNA to form epegRNA (engineered pegRNA) can effectively improve the editing efficiency of the PE system.

[0026] The application designs and constructs an expression vector suitable for a yeast PE3 system, wherein an epegRNA sequence is cloned into a simplified pCRCT plasmid backbone to construct a pCRCT-ADE2-PE3-epegRNA plasmid; an nCas-RT protein is loaded into a p415 plasmid backbone to construct a p415-nCas-RT protein expression plasmid; and the yeast p415-PE3 system is composed of the pCRCT-ADE2-PE3-epegRNA and p415-nCas-RT double plasmids.

[0027] Example 1: Construction of the first plasmid pCRCT-ADE2-PE3-epegRNA plasmid

[0028] The ADE2-PE3-epegRNA fragment is synthesized by General Biotech (Anhui) Co., Ltd. (Chuzhou, Anhui), wherein the PE3 nicking-sgRNA required to be introduced in the PE3 system is connected through a Pre-tRNA sequence, and specific sequence information is shown in Table 1, and a sequence composition diagram is shown in Figure 1 .

[0029] Table 1: Composition and sequence of ADE2-PE3-epegRNA

[0030]

[0031]

[0032] The pCRCT-iCas9 (the sequence is shown as SEQ ID NO. 1) is used as a template, and the primers are as follows:

[0033] pCRCT-BB-F: AGCTTGGCGTAATCATGGTCATAGC,

[0034] pCRCT-BB-R: CCGATCATTTATCTTTCACTGCGGAGAAGTTT;

[0035] The pCRCT backbone is obtained by PCR amplification; the ADE2-PE3-epegRNA fragment is constructed into the pCRCT backbone to obtain the expression vector plasmid pCRCT-ADE2-PE3-epegRNA, and the sequence is shown as SEQ ID NO. 2.

[0036] Example 2: Construction of the second plasmid p415-nCas-RT expression vector

[0037] The p415-TDH3p-BE4-Gam-JL1801 plasmid (the sequence is shown as SEQ ID NO. 3) is used as a template, and the primers are as follows:

[0038] P415-nCasRT-F: CACCATCACCATTGAGTTTAAACCGAGGCGAATTTC;

[0039] P415-nCasRT-R: GAGTCGTATTAGCGGCCGCTGGCGGCGG;

[0040] The p415 backbone fragment was obtained by PCR amplification;

[0041] The pCMV-PE2 (Addgene #132775, purchased from Addgene, sequence as shown in SEQ ID NO. 4) plasmid was used as a template, and the primers were as follows:

[0042] T7-nCase-F: CAGCGGCCGCTAATACGACTCACTATAGGGAGAG, RT-His-R: GGTTTAAACTCAATGGTGATGGTGATGATGACC;

[0043] The nCas-RT fragment was obtained by PCR amplification. The above-mentioned fragment was subjected to homologous recombination to obtain the p415-nCas-RT plasmid, and the sequence is shown in SEQ ID NO. 5. The p415-PE3 double plasmid system yeast was composed of the pCRCT-ADE2-PE3-epegRNA obtained in Example 1 and the p415-nCas-RT double plasmid obtained in the present example.

[0044] Example 3

[0045] Preparation of yeast cells: Saccharomyces cerevisiae BY4741 and industrial strain ERΔHWLV were inoculated into 20 ml of YPD liquid medium (10 g / l of yeast powder, 20 g / l of protein powder, 20 g / l of glucose, 80 mg / l of adenine hemisulfate, solvent was deionized water, pH 5.5) respectively, and cultured at 30°C, 200 rpm for 12-16 h. 1 ml of culture solution was transferred to 25 ml of YPD liquid medium, and cultured at 30°C, 200 rpm for 4-6 h (OD600 value was 0.5), and the precipitate was washed twice with sterile water to obtain the bacterial cells (wildtype).

[0046] Yeast transformation: Saccharomyces cerevisiae BY4741 and ERΔHWLV cells (approximately 10⁸ cells), 50 μl of 1 mg / ml salmon sperm DNA, 240 μl of 0.5 g / ml polyethylene glycol (PEG) aqueous solution (PEG molecular weight 3350), 36 μl of 1.0 M lithium acetate solution, the first plasmid pCRCT-ADE2-epeg RNA (approximately 0.375 μg), and the second plasmid p415-nCas-RT (approximately 1 μg) were mixed and pipetted to mix thoroughly. The mixture was then heat-shocked in a 42°C water bath for 40-60 min, centrifuged at 4000 rpm for 1 min, the supernatant was discarded, and the precipitate was resuspended in 0.5 ml of SC-Ura-Leu liquid medium. The precipitate was then added to a shake flask containing 9.5 ml of SC-Ura-Leu medium and incubated at 30°C and 120 rpm for 4 days.

[0047] Example 4

[0048] ADE2 is the gene encoding phosphoribosylformamide imidazole carboxylase, an enzyme that catalyzes the sixth step in purine nucleotide synthesis. Using the PE system, the expression of the ADE2 gene was blocked by replacing the glycine codon (GGT) at position 158 with the stop codon TAA. The defect in ADE2 caused the accumulation of purine precursors in yeast cells, which were then converted into a red product, facilitating the detection of the editing effects of different PE systems.

[0049] The first plasmid, pCRCT-ADE2-PE3-epegRNA, contains the URA3-selective marker, and the second plasmid, p415-nCas-RT, contains the LEU2-selective marker. Therefore, yeast transformants can be screened using SC-Ura-Leu yeast auxotrophic medium. After culturing the transformants in shake flasks for 4 days, 100 μL of the bacterial culture is diluted 10 μL. 4 150 μl of the diluted bacterial suspension was spread onto SC-Ura-Leu solid medium and incubated at 30°C for 5 days. After 5 days, the presence of single red colonies was observed on the SC-Ura-Leu plates. The red and white colonies on the plates were counted, and the editing efficiency of the p415-PE3 dual plasmid system on the ADE2 gene was calculated (editing efficiency is the ratio of red colonies to total colonies). The results showed that the editing efficiency of the p415-PE3 dual plasmid system on the ADE2 gene in BY4741 and ERΔHWLV strains was 95.38±2.62% and 37.41±16.04%, respectively (e.g., ...). Figure 2 ).

[0050] Example 5

[0051] PCR amplification of ADE2 gene editing site for positive colonies (red) obtained in Example 4, primers as follows:

[0052] ADE F1: CGATTGAGATTGAGCATGTTGATG;

[0053] ADE R1: CCACACCAAATATACCACAACCG;

[0054] PCR amplification of the target band of ADE2 editing site, SANGER sequencing of the obtained PCR product to check the accuracy of editing by p415-PE3 double plasmid system. The sequencing results show that the codon GGT encoding the 158th amino acid of the ADE2 gene of the positive (red) colonies edited by the p415-PE3 double plasmid system is all edited to the stop codon TAA, without other base insertion and deletion. Therefore, the accuracy of editing of the ADE2 gene by the p415-PE3 system in the yeast BY4741 and ERΔHWLV is 100% (Example 4). Figure 3 )

Claims

1. Use of a dual plasmid system in gene editing in yeast, the yeast being Saccharomyces cerevisiae BY4741; the dual plasmid system comprising a first plasmid containing a sequence for encoding an epegRNA, the epegRNA being an RNA molecule with a motif introduced at the 3' end of a pegRNA, the sequence of the motif being as set forth in SEQ ID NO. 12; the second plasmid containing a sequence for encoding a fusion protein of a nuclease nicking nCas9 and a reverse transcriptase M-MLV RT, the reverse transcriptase M-MLV RT comprising five site mutations, D200N, L603W, T330P, T306K and W313F; the first plasmid further comprising a sequence for encoding a PE3 nicking-sgRNA, the sequence for encoding the PE3 nicking-sgRNA being as set forth in SEQ ID NO. 14, linked to the sequence for encoding the epegRNA by a Pre-tRNA sequence, the Pre-tRNA sequence being as set forth in SEQ ID NO. 13; the first plasmid using an expression vector pCRCT, the sequence of the first plasmid being as set forth in SEQ ID NO. 2; the second plasmid using an expression vector p415, the sequence of the second plasmid being as set forth in SEQ ID NO.

5.

2. Use according to claim 1, wherein the pegRNA containing a sgRNA targeting a DNA of interest, a primer binding site and a reverse transcription template sequence comprising genetic information to be edited.

3. A method of gene editing suitable for yeast prime editing, comprising, Use of a dual plasmid system in gene editing in yeast, the yeast being Saccharomyces cerevisiae BY4741; the epegRNA being an RNA molecule with a motif introduced at the 3' end of a pegRNA, the sequence of the motif being as set forth in SEQ ID NO. 12; the second plasmid containing a sequence for encoding a fusion protein of a nuclease nicking nCas9 and a reverse transcriptase M-MLV RT, the reverse transcriptase M-MLV RT comprising five site mutations, D200N, L603W, T330P, T306K and W313F; the first plasmid further comprising a sequence for encoding a PE3 nicking-sgRNA, the sequence for encoding the PE3 nicking-sgRNA being as set forth in SEQ ID NO. 14, linked to the sequence for encoding the epegRNA by a Pre-tRNA sequence, the Pre-tRNA sequence being as set forth in SEQ ID NO. 13; the first plasmid using an expression vector pCRCT, the sequence of the first plasmid being as set forth in SEQ ID NO. 2; the second plasmid using an expression vector p415, the sequence of the second plasmid being as set forth in SEQ ID NO.

5. the yeast being Saccharomyces cerevisiae BY4741; the method of gene editing comprising the steps of: (1) Designing epegRNA sequence according to the target gene sequence to be edited, and cloning to obtain a first plasmid; (2) Introducing the first plasmid and the second plasmid into the body to be edited to realize gene editing.

4. The method of gene editing of claim 3, wherein, The pegRNA contains sgRNA targeting the target DNA, a primer binding site, and a reverse transcription template sequence containing the genetic information to be edited.