A gene sequence detection method

Abstract

This invention discloses a gene sequence detection method that uses an electrochemiluminescence (ECL) sensor combined with CRISPR / Cas12a to alter the ECL signal output by introducing a target, thereby causing changes in energy transfer of the ECL luminescent material on the electrode surface. Since the ECL signal is generated without external light source stimulation, it reduces background interference while maintaining high sensitivity. This detection system exhibits good stability and reproducibility, which is crucial for the effective large-scale screening of transgenic crops in resource-scarce regions. We anticipate that this method may provide a potential platform for the detection of transgenic crops.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method for gene sequence detection. Background Technology

[0002] Genetically modified organisms (GMOs) are organisms into which specific genes have been introduced using genetic engineering techniques, allowing them to be expressed and thus acquiring new characteristics not present in the organism itself. These organisms, which have acquired foreign genes, are called genetically modified organisms (GMOs). GMOs possess superior characteristics unmatched by traditional crops, such as resistance to insects and diseases, herbicide resistance, high yields, drought and cold resistance, and improved nutrient content, bringing significant benefits to the agricultural sector.

[0003] Over the past few decades, progress has been made in identifying genetically modified plants and quantifying transgenic quantities, including Southern blotting analysis and real-time polymerase chain reaction (PCR). Since the introduction of PCR in 1985, almost all transgenic detection has used PCR amplification, providing a reliable method with high sensitivity and stability. However, PCR requires a high level of expertise and expensive equipment, is time-consuming, and is difficult to implement for widespread field testing. Furthermore, the inactivation of nucleic acid amplification enzymes and different detection methods often lead to false positive results. Therefore, there is a strong need to develop more sensitive, rapid, and high-throughput innovative detection methods.

[0004] Insect-resistant crops are among the most important transgenic organisms, developed by inserting the cry gene, isolated from the soil bacterium Bacillus thuringiensis (Bt), into the genetic material of plants (Kadam, USet.al, Schulz, B.; Irudayaraj, J., Single molecule Raman spectroscopic assay to detect transgene from GM plants. Analytical Biochemistry 2017, 532, 60-63.). Bacillus thuringiensis (Bt) is a spore-forming bacterium, one of its most important characteristics being the formation of intracellular inclusions composed of protoxins (8-endotoxins), which are highly specific and effective biological insecticides. The Bt Cry1Ab insecticidal protein gene encodes an insecticidal crystal protein (ICP) with highly specific insecticidal activity, toxic to Lepidoptera, Coleoptera, and Diptera insects. The Cry1Ab gene has been widely introduced into genetically modified crops such as maize, potato, cotton, and rice, and its planting area is increasing globally every year. Currently, one of the main genes used in commercially available transgenic insect-resistant maize is the Bt Cry1Ab gene (Zhang, DBet.al, The Development and Standardization of Testing Methods for Genetically Modified Organisms and their Derived Products. Journal of Integrative Plant Biology 2011, 53(7), 539-551.), which has good insect resistance against the Asian corn borer. Transgenic maize MON810 is an insect-resistant variety of Bt Cry1Ab gene. Globally, this variety is permitted for cultivation and application in the feed and food industries in 26 countries and regions, making it the most commercially viable transgenic insect-resistant maize. Therefore, establishing a rapid and accurate detection method is crucial for the regulation of this transgenic variety.

[0005] Flanking sequences of transgenic host plant DNA are the only target sequences that can specifically detect transgenes and perform real-time quantitative PCR to date ([1] Gasparic, MB et al., Comparison of nine different real-time PCR chemistries for qualitative and quantitative applications in GMO detection. Analytical and Bioanalytical Chemistry 2010, 396(6), 2023-2029. [2] LaPaz, et al., Comparison of real-time PCR detection chemistries and cycling modesusing Mon810 event-specific assays as model. Journal of Agricultural and Food Chemistry 2007, 55(11), 4312-4318.). However, real-time quantitative PCR has high requirements for instruments, which is not conducive to large-scale application.

[0006] DNA tetrahedra are assembled using a simple annealing technique (Ye, J. et.al, Dual-Wavelengthratiometric electrochemiluminescence immunosensor for cardiac troponin detection. Analytical Chemistry 2019, 91(2), 1524-1531.). DT has been used as a scaffold for electrode surfaces in electrochemical and electrochemiluminescence biosensors. Generally, thiolated single- and double-stranded DNA probes do not contain secondary structures and can easily bind to gold electrodes. However, due to the difficulty in controlling their density and perpendicularity, the distribution of DNA probes on the electrode is uneven, leading to hybridization between DNA molecules and significantly reducing the hybridization efficiency between recognition units and targets. Recent studies have shown that DT can overcome these shortcomings and can be applied to electrodes. For example, Chen et al. developed an electrochemical biosensor that uses DT nanostructures to detect DNA methylation (Chen, X., et al., ApH-engineering regenerative DNA tetrahedron ECL biosensor for the assay of SARS-CoV-2RdRp gene based on CRISPR / Cas12a trans-activity, ACS Appl. Mater. Interfaces. 2019, 11(4), 3745–3752.). Summary of the Invention

[0007] This invention addresses the problems existing in the detection of transgenic plants in the prior art by providing a gene sequence detection method.

[0008] This invention first provides a gene sequence detection method using an ECL (enhanced chemiluminescence) electrochemical biosensor. The ECL electrochemical biosensor includes a gold electrode, which, after activation, is coupled with a DT probe. The DT probe is a DNA tetrahedral structure formed by the annealing assembly of four single-stranded DNA molecules (T1, T2, T3, and T4).

[0009] The gene sequence detection method includes the following steps:

[0010] (1) Prepare a triple-stranded DNA complex by mixing the three DNA strands T1, DNA1 and DNA2, and mix the target to be detected, fuel chain F and the triple-stranded DNA complex to obtain an entropy-driven chain displacement reaction solution.

[0011] (2) The ECL electrochemical biosensor is incubated with the entropy-driven chain displacement reaction solution in step (1). After incubation, the ECL electrochemical biosensor is incubated with a DNA solution modified with signal molecules to obtain the incubated ECL electrochemical biosensor.

[0012] (3) Use crRNA and S1, S2 to activate the trans-cleavage activity of CRISPR / Cas12a and prepare the cleavage reaction solution;

[0013] (4) Immerse the ECL electrochemical biosensor after incubation in step (2) into the cutting reaction solution in step (3) for single-chain cleavage, and then detect the ECL signal intensity. The stronger the ECL signal intensity, the higher the concentration of the target sequence in the object to be detected.

[0014] Preferably, the T1 sequence comprises the following portions arranged in sequence: T1-1 for binding to the target sequence, T1-2 for binding to a portion of DNA2, T1-3 for binding to a portion of DNA1, T1-4 for constructing a DNA tetrahedral scaffold, and T1-5 for binding to the fuel chain F.

[0015] Among them, T1-1 and T1-2 have partial sequence overlap, so when the target sequence binds to T1-1, the binding force between DNA2 and T1-2 weakens and causes it to fall off.

[0016] The sequence T1-5 consists of the sequences T1-2 and T1-3;

[0017] T2 and T3 sequences are used to construct DNA tetrahedral scaffolds;

[0018] The T4 sequence comprises the following parts arranged in sequence: T4-1 for constructing the DNA tetrahedral scaffold, T4-2 for binding to DNA1, and T4-3 for binding to DNA modified with signaling molecules.

[0019] The DNA tetrahedral scaffold in the DNA tetrahedral structure is assembled from T1-4, T2, and T3 sequences in the T1 sequence and T4-1 sequence in the T4 sequence. T1-1, T1-2, and T1-3 of the T1 sequence extend from the vertices of the DNA tetrahedral scaffold away from the gold electrode, while T4-2 and T4-3 of the T4 sequence extend from one of the vertices near the gold electrode.

[0020] One end of the T2 and T3 sequences, and the T4-1 end of the T4 sequence, are each modified with a coupling group for coupling with the gold electrode.

[0021] When a gold electrode is coupled with a DT probe, the concentration of the DT probe is preferably 0.3 to 1.6 μM; more preferably 1.0 to 1.6 μM; even more preferably 1.3 to 1.6 μM; and most preferably 1.3 μM.

[0022] In step (2), when the ECL electrochemical biosensor is incubated with the entropy-driven chain displacement reaction solution in step (1), the incubation time is preferably not less than 5 min; more preferably not less than 35 min; and even more preferably not less than 35 to 45 min.

[0023] In step (2), when the ECL electrochemical biosensor is incubated with the DNA solution modified with the signal molecule, preferably, the concentration of the DNA solution modified with the signal molecule is not less than 0.5 μM; more preferably, the concentration of the DNA solution modified with the signal molecule is 1.3 to 2.0 μM; and even more preferably, the concentration of the DNA solution modified with the signal molecule is 1.5 to 2.0 μM.

[0024] The gene sequence detection method described in this application can be used to detect various target sequences, especially for transgenic plants. For example, the target sequence in the target object is a specific fragment of transgenic maize MON810, with the sequence CGACCTGAACGAGGACtttcggtagcc. This application found that when using the method described in this application to detect the specific fragment of transgenic maize MON810, the concentration of the target sequence in the target object is 1 fM to 100 pM; the detection limit is 3.3 fM.

[0025] When detecting a specific fragment of transgenic maize MON810, with the sequence CGACCTGAACGAGGACtttcggtagcc, the preferred sequences for T1, T2, T3, and T4 in the DT probe are as follows:

[0026] T1: The bolded sequence is the sequence used to bind to the target, the underlined sequence is the sequence used to bind to a portion of DNA1, the sequence in the middle represented by lowercase letters is the sequence used to bind to a portion of DNA1, the sequence after the lowercase letter is used to construct the DNA tetrahedral scaffold, and the underlined sequence and the sequence represented by lowercase letters can also bind to the fuel chain F.

[0027] T2: SH-(CH2)6-GCTTAGCACTTGCGTTACATGAATCGATGCTGATGCTGGCATGCAGACTACACTG, used for the construction of DNA tetrahedral scaffolds;

[0028] T3: SH-(CH2)6-TAACGCAAGTGCTAAGCTTGAGCTCTAGAACGACTTTCCTGCACTAGCTCTTACG, used for the construction of DNA tetrahedral scaffolds;

[0029] T4: SH-(CH2)6- TACATTCTCCAGTGAAGCGCAAGTCGTTCTAGAGCTCAACAGTGTAGTCTGCATGC ccgacgcaaggatccaactgacgta CGTATCTGGAGCAAGTAGCAAT, where the underlined sequence is used for the construction of the DNA tetrahedral scaffold, the lowercase letter sequence is used for binding to DNA1, and the sequence following the lowercase letter sequence is used for binding to the signal molecule chain AP (DNA modified with the signal molecule).

[0030] Where SH represents a mercapto group, (CH2)6 is an alkyl group that serves as a linker, and S-(CH2)6- is used to form a gold-sulfur bond with the gold electrode, so that DT is adsorbed on the electrode.

[0031] The sequence of DNA1 is: TACGTCAGTTGGATCCTTGCGTCGG;

[0032] The sequence of DNA2 is: CTACGTCAGCGACCTGAACGAGGACTTGATTTCTT;

[0033] The sequence of fuel chain F is: TACGTCAGTTGGATCCCTACGTCAGCGACCTGAACGAGGAC;

[0034] The DNA sequence modified with the signaling molecule is: ATTGCTACTTGCTCCAGATACG-Ru, where Ru is Ru(bpy). 3 2+ signaling molecules.

[0035] Of course, the specific sequences mentioned above are specific target sequences used to detect genetically modified maize. If other target sequences are used, they can also be detected. It is only necessary to replace the sequence fitness that binds to the target sequence.

[0036] This invention also provides a kit for gene sequence detection, comprising:

[0037] A gold electrode coupled with a DT probe, wherein the DT probe is a DNA tetrahedral structure formed by annealing four single-stranded DNA strands of T1, T2, T3, and T4;

[0038] A triple-stranded DNA complex prepared from three DNA strands: T1, DNA1, and DNA2;

[0039] Fuel chain F;

[0040] CRISPR / Cas12a;

[0041] crRNA and S1, S2, used to activate the trans-cleavage activity of CRISPR / Cas12a

[0042] The T1 sequence comprises the following parts arranged in sequence: T1-1 for binding to the target sequence, T1-2 for binding to a portion of DNA2, T1-3 for binding to a portion of DNA1, T1-4 for constructing the DNA tetrahedral scaffold, and T1-5 for binding to the fuel chain F.

[0043] Among them, T1-1 and T1-2 have partial sequence overlap, so when the target sequence binds to T1-1, the binding force between DNA2 and T1-2 weakens and causes it to fall off.

[0044] The sequence T1-5 consists of the sequences T1-2 and T1-3;

[0045] T2 and T3 sequences are used to construct DNA tetrahedral scaffolds;

[0046] The T4 sequence comprises the following parts arranged in sequence: T4-1 for constructing the DNA tetrahedral scaffold, T4-2 for binding to DNA1, and T4-3 for binding to DNA modified with signaling molecules.

[0047] The DNA tetrahedral scaffold in the DNA tetrahedral structure is assembled from T1-4, T2, and T3 sequences in the T1 sequence and T4-1 sequence in the T4 sequence. T1-1, T1-2, and T1-3 of the T1 sequence extend from the vertices of the DNA tetrahedral scaffold away from the gold electrode, while T4-2 and T4-3 of the T4 sequence extend from one of the vertices near the gold electrode.

[0048] One end of the T2 and T3 sequences, and the T4-1 end of the T4 sequence, are each modified with a coupling group for coupling with the gold electrode.

[0049] Preferably, the target sequence used for detection in the kit is a specific fragment of transgenic maize MON810, with the sequence CGACCTGAACGAGGACtttcggtagcc;

[0050] The sequences of T1, T2, T3, and T4 in the DT probe are as follows:

[0051] T1: GGCTACCGAAAGTCCTCGTTCAGGTCGCTGACGTAGGGATCCAACTGACGTAGCTTCACTGAGAATGTAGAGCATCAGCATCGATTACTCTCGTAAGAGCTAGTGCAG,

[0052] T2: SH-(CH2)6-GCTTAGCACTTGCGTTACATGAATCGATGCTGATGCTGGCATGCAGACTACACTG,

[0053] T3: SH-(CH2)6-TAACGCAAGTGCTAAGCTTGAGCTCTAGAACGACTTTCCTGCACTAGCTCTTACG,

[0054] T4: SH-(CH2)6-TACATTCTCAGTGAAGCGCAAGTCGTTCTAGAGCTCAACAGTGTAGTCTGCATGCCCGACGCAAGGATCCAACTGACGTACGTATCTGGAGCAAGTAGCAAT;

[0055] Where SH represents a mercapto group, and (CH2)6 is...

[0056] The sequence of DNA1 is: TACGTCAGTTGGATCCTTGCGTCGG;

[0057] The sequence of DNA2 is: CTACGTCAGCGACCTGAACGAGGACTTGATTTCTT;

[0058] The sequence of fuel chain F is: TACGTCAGTTGGATCCCTACGTCAGCGACCTGAACGAGGAC;

[0059] The DNA sequence modified with the signaling molecule is: ATTGCTACTTGCTCCAGATACG-Ru, where Ru is Ru(bpy). 3 2+ signaling molecules.

[0060] The sequences of crRNA, S1, and S2 used to activate CRISPR / Cas12a activity in this application can be designed according to those reported in the prior art. For example, the sequence of crRNA is: UAAUUUCUACUAAGUGUAGAUCCACGACUGAGCCUCUUACUA.

[0061] The sequence of S1 is: CGACTATGTTTACCACGACTGAGCCTCTTACTA;

[0062] The sequence of S2 is: TAGTAAGAGGCTCAGTCGTGGTAAACATAGT.

[0063] The ECL biosensor constructed in this study uses a DT probe as a backbone, on which an enzyme-free entropy-driven chain displacement reaction isothermally amplifies the target. The trans-cleavage activity of CRISPR-Cas12a, which specifically cleaves single strands, is then utilized to detect specific fragments from transgenic plants. Figure 1 The specific principles behind this biosensor were explained.

[0064] Modifying an ECL biosensor onto a gold electrode and replacing traditional linear single-stranded DNA or hairpin DNA with a DT probe enhances the biosensor's stability and reduces non-specific adsorption, thus creating an excellent anti-interference sensing platform. A single-stranded DNA L extends from the DT apex, far from the electrode. After hybridizing with DNA1 and DNA2, it forms a triple-stranded substrate complex, which then undergoes further entropy-driven reactions. In the presence of a target, the target hybridizes with the unbound toehold1 region on the single-stranded L, forming an intermediate. At this point, the binding between DNA2 and L is weak and cannot maintain adsorption, so DNA2 is spontaneously released. The exposed new toehold2 region binds to the fuel chain F, displacing DNA1 and the target. The target then participates in subsequent strand displacement reactions to generate more DNA1. DNA1 and the signaling molecule AP hybridize with the capture DNA extending from the other vertex near the electrode. Because CRISPR-Cas12a, once activated, non-specifically cleaves the single strand, the double strand formed by DNA1 and AP cannot be cleaved, resulting in a large accumulation of signaling molecules on the electrode and generating a very high ECL signal. When no target is present, a complete double strand cannot form, and CRISPR-Cas12a cleaves the single strand, preventing signaling molecules from accumulating on the electrode and resulting in the loss of the ECL signal. The ECL intensity is related to the target concentration. Based on this biosensor, quantitative detection of specific target sequences in transgenic plants can be achieved. Compared to traditional PCR amplification, entropy-driven reactions do not require enzymes and can achieve cyclic amplification of the target in a simple one-step operation, making it a simple and rapid amplification method.

[0065] This invention constructs a CRISPR / Cas12a-mediated electrochemical biosensor that can sensitively and efficiently detect target gene sequences in transgenic plants through entropy-driven cascade amplification. Given that entropy-driven amplification is an isothermal process that does not require any nucleases, this biosensor offers significant advantages in terms of cost, efficiency, and sensitivity.

[0066] A sensor combining electrochemiluminescence (ECL) with CRISPR / Cas12a alters the ECL signal output by introducing a target, thereby causing changes in energy transfer in the ECL luminescent material on the electrode surface. Since the ECL signal is generated without external light stimulation, it reduces background interference while maintaining high sensitivity. The detection system exhibits good stability and reproducibility, which is crucial for the effective large-scale screening of genetically modified crops in resource-scarce regions. We anticipate that this method may provide a potential platform for the detection of genetically modified crops. Attached Figure Description

[0067] Figure 1 This is a schematic diagram of a CRISPR / Cas12a-mediated entropy-driven ECL electrochemical biosensor used in transgenic maize MN810 without PCR.

[0068] Figure 2 This is a 3' flanking sequence diagram of the transgenic maize Mon810.

[0069] Figure 3 The image shows the PAGE characterization results of DT, where lane 1 is T1, lane 2 is T1+T2, lane 3 is T1+T2+T3, and lane 4 is T1+T2+T3+T4.

[0070] Figure 4 Linear plot of ECL modified with different DT concentrations on GE.

[0071] Figure 5 ECL linear plots for different target incubation times.

[0072] Figure 6 ECL linear plot for different signaling molecules after incubation time.

[0073] Figure 7 ECL-potential curves for different target concentrations are shown, where (a) 1 fM, (b) 10 fM, (c) 100 fM, (d) 1 pM, (e) 10 pM, and (f) 100 pM.

[0074] Figure 8 The calibration curve is shown for ECL intensity versus lgCMON810. Detailed Implementation

[0075] Example 1

[0076] To ensure reliable detection, we selected target DNA located in the flanking sequence of the Mon8103' sequence in transgenic maize. For example... Figure 2As shown, the uppercase letters are the sequences of cryA(b), the lowercase letters are the sequences flanking the plant genome, and the sequences in the boxes are the targets we have selected.

[0077] Table 1 shows the sequences used. The nucleotide AP linking the signal molecule Ru(bpy)32+ was purchased from Sangon Biotech (Shanghai) Co., Ltd.; the remaining nucleotides synthesized and purified by high performance liquid chromatography (HPLC) were purchased from Hangzhou Youkang Biotechnology Co., Ltd. (Hangzhou, China).

[0078] Table 1. All sequences used in this biosensor

[0079]

[0080]

[0081] I. Preparation of DNA Tetrahedrons

[0082] DNA tetrahedra are assembled using a simple annealing technique. First, 10 μL of each of the four single-stranded DNA strands (T1, T2, T3, T4) is dissolved in TBE buffer (containing 10 mM TCEP and 50 mM MgCl2, pH 7.4) and treated at room temperature for 30 min to reduce disulfide bonds. Then, equimolar amounts of the four DNA strands are mixed, the mixture is incubated at 95 °C for 5 min, and then rapidly cooled to 4 °C to form a stable DNA tetrahedral structure.

[0083] II. Entropy-driven chain displacement reaction

[0084] First, four DNA strands—T1, DNA1, DNA2, and F—were dissolved separately in TBE buffer (containing 10 mM Tris-HCl, 50 mM NaCl, 10 mM MgCl2, pH 7.4) to obtain stock solutions. Then, equal volumes of T1, DNA1, and DNA2 of the same concentration were mixed to prepare a final concentration of 2.5 μM. The resulting mixture was then incubated at 95 °C for 5 min, followed by slow cooling to room temperature to form a triple-stranded DNA complex. Next, different concentrations of target DNA (the DNA to be detected) and F were mixed with the triple-stranded DNA complex and incubated at 25 °C for 2 h to obtain the entropy-driven strand displacement reaction solution.

[0085] III. Fabrication of ECL Biosensors

[0086] First, the gold electrode (GE) was polished using alumina powders of 1 mm, 0.3 mm, and 0.05 mm thickness, respectively. Then, the electrode was immersed in a piranha solution (a mixture of 98% H₂SO₄ and 30% H₂O₂ in a 7:3 ratio) for 30 min, followed by ultrasonic rinsing with alternating ethanol and deionized water for 5 min. After cleaning, the electrode was activated with 0.1 M H₂SO₄, and continuous scanning was performed from -0.8 V to 0.8 V at a scan rate of 0.1 V / s. The electrode was considered active when the characteristic peak signal of the cyclic voltammetry (CV) stabilized.

[0087] The electrode was rinsed with pure water and dried. Then, the electrode and 10 μL of DT solution (1 μM, DT being the DNA tetrahedron prepared in step one) were incubated overnight at 4°C to modify the gold electrode with DT through Au–S covalent bonding (abbreviated as DT / GE). The electrode was then rinsed three times with PBS buffer (containing 0.1 MkCl, pH 7.4). Afterward, DT / GE was further incubated with 10 μL of entropy-driven chain displacement reaction solution (step two) at 25°C for 2 hours. Subsequently, the electrode was incubated with Ru(bpy)-modified... 3 2+ The signal molecule's DNA (AP) solution (1.5 μM) was incubated at 25 °C for 45 min. Since the tetrahedral structure of DNA effectively reduces non-specific adsorption on the electrode, after each reaction step, simply washing the electrode with PBS buffer is sufficient to remove non-specific adsorption, making the construction of biosensors more efficient and convenient.

[0088] IV. Polyacrylamide gel electrophoresis analysis

[0089] Electrophoresis was performed using a 15% polyacrylamide gel in 1×TBE buffer containing 89 mM Tris-borate electrophoresis buffer, 2 mM EDTA, and pH 8.4. First, the prepared gel was run at 80V for 40 min. Then, 10 μL of various DNA samples (T1, T1+T2, T1+T2+T3, T1+T2+T3+T4) at a concentration of 1 μM (if multiple DNA samples were present, each sample had the same concentration, for a total concentration of 1 μM) were mixed with loading buffer (6×) and loaded into the gel. The gel was then run at a constant potential of 105V for 2.5 h. Subsequently, the gel was stained with ethidium bromide (EB) dilution buffer for 30 min. Finally, the gel was imaged under UV light using a ChemiDoc MP (BioRad) instrument. The results are shown below. Figure 3 As shown, the band size is consistent with expectations, proving the formation of DNA tetrahedrons.

[0090] V. CRISPR / Cas12a cleavage reaction and ECL signal acquisition

[0091] Next, 100 nM CRISPR / Cas12a-crRNA (Cas12a(Cpf1) purchased from Sangon Biotech (Shanghai), product number Z03502) was added to a lysis buffer containing 1 μM each of S1 and S2 (containing 20 mM Tris-HCl, 100 mM KCl, 5 mM MgCl2, 5% glycerol (v / v) and 1 mM DTT). The crRNA and S1 and S2 (sequences shown in Table 1) that activated the CRISPR / Cas12a trans-cleavage activity were based on previous literature (Zhang K, Fan Z, Ding Y, Xie M. A pH-engineering regenerative DNA tetrahedron ECL biosensor for the assay of SARS-CoV-2 RdRp gene based on CRISPR / Cas12a trans-activity. Chem Eng J. 2022 Feb). 1; 429:132472.doi:10.1016 / j.cej.2021.132472.Epub 2021Sep 15.PMID:34539224;PMCID:PMC8440004.). Then, the prepared ECL biosensor was immersed in the above solution for 30 min to allow for complete single-chain cleavage. Finally, the modified electrode was tested in PBS buffer solution (0.1 M, pH 7.4) containing 20 mM of the co-reactant triethylamine (TEA). The addition of triethylamine was to obtain a stable and strong ECL signal. The scan voltage was 0–1.3 V. A three-electrode system was used for testing, with GE as the working electrode, a platinum wire electrode as the counter electrode, and Ag / AgCl as the reference electrode.

[0092] Example 2

[0093] DT concentration optimization.

[0094] The target incubation time was 35 min, and the AP concentration was 1.5 μM.

[0095] We prepared a series of concentrations of DT-modified GE at 0.3 μM, 0.6 μM, 1.0 μM, 1.3 μM, and 1.6 μM, and tested the ECL signal in the presence of 100 fM target DNA (Target sequence in Table 1).

[0096] Depend on Figure 4It can be seen that the ECL signal gradually increases with the increase of DT concentration, reaching its maximum at a concentration of 1 μM. With further increases in concentration, the ECL signal gradually decreases. This is because too low a concentration results in fewer signal molecules captured by DT, leading to a low ECL signal, while too high a concentration affects the hybridization reaction, causing non-specific adsorption and thus a signal decrease. Therefore, the optimal concentration of DT is 1.3 μM.

[0097] Example 3

[0098] Optimize the incubation time for the target.

[0099] The target incubation time is 35 minutes.

[0100] The incubation time of the target also affects the degree of entropy-driven response, thereby affecting the ECL signal. Figure 5 It is evident that as the incubation time gradually increased from 5 min to 45 min (set at 5 min, 15 min, 25 min, 35 min, and 45 min respectively), the ECL signal gradually strengthened, reaching a stable value at 35 min. Because a shorter incubation time would affect the degree of entropy-driven reaction, thus impacting signal amplification, 35 min is the optimal incubation time for the target.

[0101] Example 4

[0102] Optimization of signal molecule concentration.

[0103] The DT concentration was 1.3 μM, and the target incubation time was 35 min.

[0104] By measuring ECL signals at a series of different AP concentrations (0.5 μM, 1.0 μM, 1.3 μM, 1.5 μM, and 2.0 μM), such as Figure 6 As shown, the ECL intensity increases with increasing AP concentration, reaching equilibrium at 1.5 μM. At such low concentrations, the reaction between AP and DT on the electrode surface is minimal. With increasing concentration, the ECL signal increases, indicating a greater degree of hybridization between the signal molecules and DT.

[0105] Example 5

[0106] To investigate the tolerance of the designed sensor to complex samples, we used the biosensor to detect the target strand (Target sequence in Table 1) of transgenic maize MON810 mixed with a common maize DNA target (sequence TTGACATCGCCATCTTGGTGACCA).

[0107] First, the target chain was mixed with the corresponding non-GMO maize target at a mass ratio of 1:1000, and different concentration gradients were set (the mass ratio of the two targets was fixed at 1:1000 under each concentration gradient). Then, the concentration of the MON81 target in different mixed samples was detected using a biosensor (detection conditions: DT concentration 1.3 μM, target incubation time 35 min, AP concentration 1.5 μM). The recovery results are shown in Table 2, where the amount added is the target content of added MON810, and the detection amount is the actual measured data. This result shows that our designed CRISPR / Cas12a-mediated entropy-driven electrochemical biosensor can be applied to detect GMO maize MON810 in mixed samples. Therefore, our proposed sensor has the potential to be widely used in reality to detect GMO components in complex samples.

[0108] Table 2. Detection and recovery results of MON810 in transgenic maize

[0109]

[0110]

[0111] Example 6

[0112] Under optimal experimental conditions (DT concentration 1.3 μM, target incubation time 35 min, AP concentration 1.5 μM), the analytical performance of this electrochemical biosensor was investigated by detecting a series of target DNA standard solutions with different concentrations (1 fM, 10 fM, 100 fM, 1 pM, 10 pM, and 100 pM). The ECL signal for each of the target DNA concentrations was measured in PBS buffer containing 20 mM TEA.

[0113] like Figure 7 As shown, the ECL signal increases with increasing target DNA concentration. Calibration curves of the ECL signal were plotted with six different target concentrations (pM) on the x-axis and the ECL signal on the y-axis. Figure 8 Within this range, a good linear relationship exists between ECL intensity and target DNA concentration. The linear relationship is: Y = 173.26lg(C Target The correlation coefficient is calculated to be +140.19, with a squared value of R² = 0.9986, where Y is the ECL intensity (au). The calculated limit of detection (LOD) of this biosensor is 3σ / S, where σ is the linear slope and S is the standard deviation of 11 blank tests, which is 3.3fM.

Claims

1. A gene sequence detection method using an ECL electrochemical biosensor, wherein the ECL electrochemical biosensor includes a gold electrode, and the gold electrode is coupled with a DT probe after activation. The DT probe is a DNA tetrahedral structure formed by annealing four single-stranded DNA molecules (T1, T2, T3, and T4). Its features are, The gene sequence detection method includes the following steps: (1) Prepare a triple-stranded DNA complex by mixing the three DNA strands T1, DNA1 and DNA2, and mix the target to be tested, the fuel chain F and the triple-stranded DNA complex to obtain an entropy-driven chain displacement reaction solution; (2) The ECL electrochemical biosensor is incubated with the entropy-driven chain displacement reaction solution in step (1). After incubation, the ECL electrochemical biosensor is incubated with a DNA solution modified with signal molecules to obtain the incubated ECL electrochemical biosensor. (3) Use crRNA and S1, S2 to activate the trans-cleavage activity of CRISPR / Cas12a and prepare the cleavage reaction solution; the sequence of crRNA is: UAAUUUCUACUAAGUGUAGAUCCACGACUGAGCCUCUUACUA; the sequence of S1 is: CGACTATGTTTACCACGACTGAGCCTCTTACTA; the sequence of S2 is: TAGTAAGAGGCTCAGTCGTGGTAAACATAGT; (4) Immerse the ECL electrochemical biosensor after incubation in step (2) into the cutting reaction solution in step (3) for single-chain cleavage, and then detect the ECL signal intensity. The stronger the ECL signal intensity, the higher the concentration of the target sequence in the object to be detected. The T1 sequence comprises the following parts arranged in sequence: T1-1 for binding to the target sequence, T1-2 for binding to a portion of DNA2, T1-3 for binding to a portion of DNA1, and T1-4 for constructing the DNA tetrahedral scaffold. Among them, T1-1 and T1-2 have partial sequence overlap, so that when the target sequence binds to T1-1, the binding force between DNA2 and T1-2 weakens and the DNA2 falls off. T2 and T3 sequences are used to construct DNA tetrahedral scaffolds; The T4 sequence comprises the following parts arranged in sequence: T4-1 for constructing the DNA tetrahedral scaffold, T4-2 for binding to DNA1, and T4-3 for binding to DNA modified with signaling molecules. The DNA tetrahedral scaffold in the DNA tetrahedral structure is assembled from T1-4, T2, and T3 sequences in the T1 sequence and T4-1 sequence in the T4 sequence. T1-1, T1-2, and T1-3 of the T1 sequence extend from the vertices of the DNA tetrahedral scaffold away from the gold electrode, while T4-2 and T4-3 of the T4 sequence extend from one of the vertices near the gold electrode to capture DNA. One end of the T2 and T3 sequences, and one end of the T4-1 sequence of the T4 sequence are each modified with a coupling group for coupling with the gold electrode. In the presence of a target, the target binds to T1-1, releasing DNA2 and exposing T1-5 to bind to the fuel chain F, displacing DNA1 and the target. The sequence of T1-5 is the same as that of T1-2 and T1-3. DNA1 and the signal molecule hybridize with the captured DNA to form a double strand, which cannot be cleaved by CRISPR-Cas12a. When no target is present, the captured DNA cannot form a complete double strand. CRISPR-Cas12a cuts the single strand, causing the signaling molecules to fail to aggregate on the electrode and lose the ECL signal.

2. The gene sequence detection method according to claim 1, characterized in that, When the gold electrode is coupled with the DT probe, the concentration of the DT probe is 1.0~1.6μM; In step (2), when the ECL electrochemical biosensor is incubated with the entropy-driven chain displacement reaction solution in step (1), the incubation time shall not be less than 35 min; In step (2), when the ECL electrochemical biosensor is incubated with the DNA solution modified with signal molecules, the concentration of the DNA solution modified with signal molecules is 1.3~2.0 μM.

3. The gene sequence detection method according to claim 2, characterized in that, When the gold electrode is coupled with the DT probe, the concentration of the DT probe is 1.3~1.6 μM; In step (2), when the ECL electrochemical biosensor is incubated with the DNA solution modified with signal molecules, the concentration of the DNA solution modified with signal molecules is 1.5~2.0 μM.

4. The gene sequence detection method according to claim 1, characterized in that, The target sequence in the object to be tested is a specific fragment of transgenic maize MON810, with the sequence CGACCTGAACGAGGACtttcggtagcc.

5. The gene sequence detection method according to claim 4, characterized in that, The concentration of the target sequence in the object to be detected ranged from 1 fM to 100 pM; the detection limit was 3.3 fM.

6. The gene sequence detection method according to claim 3, characterized in that, The sequences of T1, T2, T3, and T4 in the DT probe are as follows: T1: GGCTACCGAAAGTCCTCGTTCAGGTCGCTGACGTAGGGATCCAACTGACGTAGCTTCACTGAGAATGTAGAGCATCAGCATCGATTACTCTCGTAAGAGCTAGTGCAG, T2: SH-(CH2)6-GCTTAGCACTTGCGTTACATGAATCGATGCTGATGCTGGCATGCAGACTACACTG, T3: SH-(CH2)6-TAACGCAAGTGCTAAGCTTGAGCTCTAGAACGACTTTCCTGCACTAGCTCTTACG, T4: SH-(CH2)6-TACATTCTCAGTGAAGCGCAAGTCGTTCTAGAGCTCAACAGTGTAGTCTGCATGCCCGACGCAAGGATCCAACTGACGTA CGTATCTGGAGCAAGTAGCAAT; Where SH represents mercapto, and (CH2)6 is an alkyl group that serves as a linker; The sequence of DNA1 is: TACGTCAGTTGGATCCTTGCGTCGG; The sequence of DNA2 is: CTACGTCAGCGACCTGAACGAGGACTTGATTTCTT; The sequence of fuel chain F is: TACGTCAGTTGGATCCCTACGTCAGCGACCTGAACGAGGAC; The DNA sequence modified with the signaling molecule is: ATTGCTACTTGCTCCAGATACG-Ru, where Ru is Ru(bpy)3. 2+ signaling molecules.

7. A kit for gene sequence detection, characterized in that, include: A gold electrode coupled with a DT probe, wherein the DT probe is a DNA tetrahedral structure formed by annealing four single-stranded DNA strands of T1, T2, T3, and T4; A triple-stranded DNA complex prepared from three DNA strands: T1, DNA1, and DNA2; Fuel chain F; Cas12a protein; The crRNA and S1 and S2 sequences used to activate the trans-cleavage activity of the Cas12a protein are as follows: crRNA sequence: UAAUUUCUACUAAGUGUAGAUCCACGACUGAGCCUCUUACUA; S1 sequence: CGACTATGTTTACCACGACTGAGCCTCTTACTA; S2 sequence: TAGTAAGAGGCTCAGTCGTGGTAAACATAGT. The T1 sequence comprises the following parts arranged in sequence: T1-1 for binding to the target sequence, T1-2 for binding to a portion of DNA2, T1-3 for binding to a portion of DNA1, and T1-4 for constructing the DNA tetrahedral scaffold. Among them, T1-1 and T1-2 have partial sequence overlap, so that when the target sequence binds to T1-1, the binding force between DNA2 and T1-2 weakens and the DNA2 falls off. T2 and T3 sequences are used to construct DNA tetrahedral scaffolds; The T4 sequence comprises the following parts arranged in sequence: T4-1 for constructing the DNA tetrahedral scaffold, T4-2 for binding to DNA1, and T4-3 for binding to DNA modified with signaling molecules. The DNA tetrahedral scaffold in the DNA tetrahedral structure is assembled from T1-4, T2, and T3 sequences in the T1 sequence and T4-1 sequence in the T4 sequence. T1-1, T1-2, and T1-3 of the T1 sequence extend from the vertices of the DNA tetrahedral scaffold away from the gold electrode, while T4-2 and T4-3 of the T4 sequence extend from one of the vertices near the gold electrode. One end of the T2 and T3 sequences, and the T4-1 end of the T4 sequence, are each modified with a coupling group for coupling with the gold electrode.

8. The kit for gene sequence detection according to claim 7, characterized in that, The target sequence used by the kit to detect is a specific fragment of transgenic maize MON810, with the sequence CGACCTGAACGAGGACtttcggtagcc. The sequences of T1, T2, T3, and T4 in the DT probe are as follows: T1: GGCTACCGAAAGTCCTCGTTCAGGTCGCTGACGTAGGGATCCAACTGACGTAGCTTCACTGAGAATGTAGAGCATCAGCATCGATTACTCTCGTAAGAGCTAGTGCAG, T2: SH-(CH2)6-GCTTAGCACTTGCGTTACATGAATCGATGCTGATGCTGGCATGCAGACTACACTG, T3: SH-(CH2)6-TAACGCAAGTGCTAAGCTTGAGCTCTAGAACGACTTTCCTGCACTAGCTCTTACG, T4: SH-(CH2)6-TACATTCTCAGTGAAGCGCAAGTCGTTCTAGAGCTCAACAGTGTAGTCTGCATGCCCGACGCAAGGATCCAACTGACGTA CGTATCTGGAGCAAGTAGCAAT; Where SH represents mercapto, and (CH2)6 is an alkyl group that serves as a linker; The sequence of DNA1 is: TACGTCAGTTGGATCCTTGCGTCGG; The sequence of DNA2 is: CTACGTCAGCGACCTGAACGAGGACTTGATTTCTT; The sequence of fuel chain F is: TACGTCAGTTGGATCCCTACGTCAGCGACCTGAACGAGGAC; The DNA sequence modified with the signaling molecule is: ATTGCTACTTGCTCCAGATACG-Ru, where Ru is Ru(bpy)3. 2+ signaling molecules.

Images