Markers for lung-specific metastasis of breast cancer and pharmaceutical compositions and applications thereof

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to a marker for lung-specific metastasis of breast cancer, and its pharmaceutical composition and application. This patent study found that RGCC is highly expressed in breast cancer lung-specific metastatic cells, and further activates AMPKα2 and downstream signals by affecting the activity of PLK1 kinase, thereby regulating oxidative phosphorylation and fatty acid oxidation involved in TNBC lung-specific metastasis; indicating that RGCC can be used as a biomarker for lung-specific metastasis of breast cancer, and the RGCC / PLK1 / AMPK2 axis can be used as an important therapeutic target for lung metastasis of breast cancer. This patent also provides a pharmaceutical composition for preventing or treating lung-specific metastasis of breast cancer, which targets RGCC and is used in combination with PLK1 inhibitors, AMPK activity inhibitors, chemotherapy regimens, etc., which can effectively inhibit the metastasis of breast cancer cells to the lungs, reduce lung metastatic nodules, and prolong the survival of breast cancer patients with lung metastasis.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a marker for lung-specific metastasis of breast cancer, a pharmaceutical composition and application thereof. Background Art

[0002] Breast cancer is the most common fatal malignancy in women worldwide, and triple-negative breast cancer (TNBC) is the most aggressive and worst-prognostic subtype of all breast cancer subtypes. More than 90% of the mortality rate of TNBC patients is attributed to cancer metastasis with different organ metastatic sites, among which the lungs are a common site of TNBC metastasis. However, the exact mechanism of TNBC metastasis, especially the driving factors, is still unclear to those skilled in the art. Therefore, identifying the key regulatory factors that drive metastasis and in-depth research will help explore more effective metastasis targeting strategies and drug development.

[0003] Distant metastasis of tumors is an extremely challenging process, and only a few disseminated tumor cells (DTCs) can survive in secondary sites. As a fundamental feature of malignant tumors, metabolic reprogramming plays a key role in cancer progression and metastasis. These disseminated tumor cells acquire advantageous features to maintain evolution during dissemination and colonization through metabolic reprogramming. Mitochondria, as major players in cellular energy metabolism, play many key functions in tumor progression. For example, it has been reported that PGC-1α-mediated mitochondrial biogenesis and oxidative phosphorylation play an important role in breast cancer metastasis. Unlike normal prostate cancer cells, prostate cancer cells gradually shift to mitochondrial oxidative phosphorylation-dependent metabolism during pathological changes. However, it is unclear whether mitochondrial metabolism is generally active in metastatic tumor cells, especially in organ metastatic tumors.

[0004] AMPK is a heterotrimeric complex that can be activated under conditions of energy metabolic stress, allowing it to act as a cellular energy sensor. Typically, phosphorylation of a threonine residue (Thr172) in AMPKα2 (AMPK complex subunit) induces high AMPK activity. Previous studies have shown that AMPK is a tumor suppressor, but an increasing number of studies seem to challenge this traditional concept. AMPK promotes tumor cell survival during energy stress through its primary function of maintaining NADPH. Another study found that AMPK-mediated PDHA (pyruvate dehydrogenase complex) phosphorylation drives tumor lung metastasis. However, whether the activation of AMPK contributes to the colonization and survival of tumor cells in distant organ sites and the underlying regulatory mechanisms of AMPK activity remain to be elucidated.

[0005] RGCC, also known as RGC32, is a complement response gene. The expression of RGCC is stimulated and induced by a variety of factors, including complement, growth factors, cytokines, proangiogenic factors, and hormones, and plays a major role in cell migration, differentiation, and fibrosis. In addition, RGCC promotes the entry of aortic smooth muscle cells into the S phase by directly binding to CDK1 and enhancing its kinase activity. Another study showed that RGCC can improve glucose excursion under carbohydrate stress by regulating glucose metabolism-related genes (GFPT1, GLUT2, and GLP2R) to maintain blood glucose homeostasis. Aberrant expression of RGCC has been observed in a variety of primary malignant tumors, either encouraging or preventing tumor growth in different malignant environments. In human lung cancer LTE cells, downregulation of RGCC significantly reduced the proliferation, migration, and invasion of LTE cells. In contrast, RGCC induces G2 / M arrest and inhibits the growth of glioma cells. To date, the functional role of RGCC in tumor organ metastasis has been rarely reported. Summary of the invention

[0006] In view of this, one of the purposes of the present invention is to provide a use of RGCC in preparing a marker for diagnosing lung-specific metastasis of breast cancer. RGCC is highly expressed in lung-specific metastatic cells of breast cancer and can serve as a potential diagnostic factor for lung metastasis of TNBC.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] Application of RGCC in the preparation of markers for diagnosing lung-specific metastasis of breast cancer.

[0009] Furthermore, the Gene ID of RGCC in the NCBI database is 28984.

[0010] Furthermore, the breast cancer is triple-negative breast cancer.

[0011] Furthermore, the RGCC is specifically upregulated in cells of lung-specific metastasis of breast cancer.

[0012] Furthermore, the breast cancer lung-specific metastatic cells are lung-tropic metastatic triple-negative breast cancer cells.

[0013] The second object of the present invention is to provide a reagent for detecting the expression level of RGCC and its use in preparing a product for the prognosis diagnosis of lung-specific metastasis of breast cancer.

[0014] To achieve the above object, the present invention adopts the following technical solutions:

[0015] Application of a reagent for detecting RGCC expression level in the preparation of a product for prognostic diagnosis of lung-specific metastasis of breast cancer.

[0016] Furthermore, the reagent for detecting the expression level of RGCC is a reagent for detecting the expression level of RGCC mRNA and / or protein.

[0017] The third purpose of the present invention is to provide an application of an RGCC inhibitor in the preparation of a therapeutic drug for the lung metastasis of breast cancer cells. This patent study found that RGCC is a key driving factor for lung-specific metastatic TNBC and can serve as an important therapeutic target for lung-specific metastasis of breast cancer.

[0018] To achieve the above object, the present invention adopts the following technical solutions:

[0019] Use of RGCC inhibitors in the preparation of therapeutic drugs for lung metastasis of breast cancer cells.

[0020] The study found that CEBPA was negatively correlated with RGCC in lung-specific metastasis, and promoting CEBPA overexpression helped to downregulate RGCC, thereby inhibiting the metastasis of breast cancer cells to the lung.

[0021] Furthermore, the RGCC inhibitor includes a CEBPA promoter.

[0022] A fourth object of the present invention is to provide a combined use of an RGCC inhibitor and a PLK1 inhibitor in the preparation of a drug for inhibiting lung metastasis of breast cancer cells.

[0023] RGCC, which is highly expressed in TNBC cells, directly binds to and stimulates the kinase activity of PLK1, resulting in phosphorylation of AMPKα2 to regulate mitochondrial oxidative phosphorylation (OXPHOS) and fatty acid oxidation, thereby promoting lung metastasis; therefore, breast cancer cell metastasis to the lung can be effectively inhibited by inhibiting RGCC expression, PLK1 kinase activity, oxidative phosphorylation, and fatty acid oxidation.

[0024] A fifth object of the present invention is to provide a pharmaceutical composition for preventing or treating lung-specific metastasis of breast cancer.

[0025] To achieve the above object, the present invention adopts the following technical solutions:

[0026] A pharmaceutical composition for preventing or treating lung-specific metastasis of breast cancer, comprising any one or more of the following combinations:

[0027] 1) Drugs targeting RGCC and / or RGCC inhibitors;

[0028] 2) CEBPA accelerator;

[0029] 3) PLK1 kinase inhibitors;

[0030] 4) AMPK activity inhibitors;

[0031] 5) Oxidative phosphorylation inhibitors and / or fatty acid oxidation inhibitors;

[0032] 6) Paclitaxel and / or carboplatin.

[0033] Furthermore, the pharmaceutical composition is used in the preparation of products for inhibiting the metastasis of breast cancer cells to the lungs, reducing lung metastatic nodules, and prolonging the survival of breast cancer patients with lung metastasis.

[0034] The mortality of breast cancer patients is almost always caused by metastasis, and organ tropism (organ specificity) is an important feature of tumor metastasis and spread. Although some pioneering studies on organ-specific metastasis have been conducted by technicians in this field, the precise molecular mechanism of metastasis is still seriously insufficient. This patent study found that RGCC plays a key role in the lung metastasis of TNBC. RGCC is highly expressed in TNBC lung-specific metastatic cells, which affects the activity of PLK1 kinase, leading to downstream AMPKα2 phosphorylation, thereby regulating oxidative phosphorylation and fatty acid oxidation involved in TNBC lung-specific metastasis. This patent identified RGCC as a key driver of lung-specific metastatic TNBC and as a potential diagnostic factor for TNBC lung metastasis, and the newly identified RGCC / PLK1 / AMPK2 axis is a therapeutic target for TNBC lung metastasis. At the same time, targeting RGCC and its downstream signals in combination with chemotherapy regimens can synergistically inhibit lung metastasis and bring significant therapeutic benefits to the treatment of TNBC lung metastasis.

[0035] The beneficial effects of the present invention are:

[0036] 1. The present invention is the first to discover that RGCC is specifically upregulated in lung-tropic TNBC cells and plays a key regulatory role in their lung-specific metastasis process. RGCC can be used as a potential diagnostic factor for TNBC lung metastasis.

[0037] 2. This patent clearly states that the RGCC / PLK1 / AMPK2 axis is a therapeutic target for TNBC lung metastasis; RGCC is highly expressed in breast cancer lung-specific metastatic cells, and by affecting the activity of PLK1 kinase, it further activates AMPKα2 and downstream signals, thereby regulating oxidative phosphorylation and fatty acid oxidation involved in TNBC lung-specific metastasis. RGCC-driven OXPHOS and fatty acid oxidation have great potential value as important therapeutic targets for breast cancer lung-specific metastasis. This patent provides a new direction for the prevention, treatment and prognosis of TNBC lung metastasis.

[0038] 3. This patent study found that RGCC expression is enhanced in lung metastasis of multiple malignant tumors such as TNBC, colorectal cancer, osteosarcoma, pancreatic cancer and prostate cancer. Various data show that the increase of RGCC in lung-specific metastasis is closely related to the poor prognosis of TNBC. RGCC is a driving factor for lung metastasis of breast cancer and other solid tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 A is a schematic diagram showing the establishment of an organ metastasis mouse model of triple-negative breast cancer (TNBC) cells; Figure 1 B is a representative bioluminescent image of MDA-MB-231 cells metastasizing to the lung among major organs; Figure 1 C is a volcano plot of gene expression changes between lung metastatic cells (LM3) and parental cells (P); left: 4T1, right: MDA-MB-231; Figure 1 D is the heat map; Figure 1 E is a graph showing the relative fold expression of RGCC mRNA in different metastatic organs; P: parental; LM3 / HM3 / BM3: third lung / liver / brain metastatic cells; Figure 1 F is a graph showing the results of Western blot analysis of RGCC protein levels in metastatic 4T1 cells derived from various organ injuries and parental cells;

[0040] Figure 2 A- Figure 2 C is a dataset based on the TCGA database, analyzing human breast cancer subtypes with different organ metastases ( Figure 2 A) and BC patients ( Figure 2 B. Figure 2 C) Result graph of RGCC expression; in the box plot, the middle line represents the median, and the bottom and top lines correspond to the 25th and 75th percentiles; Figure 2 D- Figure 2 F is a graph showing the analysis results based on microarray data sets from different metastatic solid tumors; Figure 2 G is the Kaplan-Meier analysis result graph;

[0041] Figure 3 A- Figure 3 D is a representative bioluminescence imaging of lung metastasis after intravenous injection of RGCC knockout TNBC cells or control cells for one month ( Figure 3 A. Figure 3 C) Lung surface nodules and H&E images ( Figure 3 B. Figure 3 D) Figure 3 E- Figure 3 H is a representative bioluminescence imaging of lung metastasis after intravenous injection of RGCC-overexpressing TNBC cells or control cells for one month ( Figure 3 E. Figure 3 G), lung surface nodules and H&E images ( Figure 3 F. Figure 3 H); Figure 3 I is Figure 3 A- Figure 3 H represents the Kaplan-Meier survival analysis results of TNBC metastatic mice;

[0042] Figure 4 A is the recognition motif (top) and schematic diagram (bottom) of CEBPA in the RGCC promoter analyzed using the JASPAR database; Figure 4 B is a graph showing the Pearson correlation analysis results using the TCGA-TNBC dataset; Figure 4 C is the result of luciferase activity of 293T and MDA-MB-231 / LM3 cells; Figure 4 D is a graph showing the results of the ChIP assay; Figure 4 E is the result of qRT-PCR assay for the regulation of CEBPA on RGCC; Figure 4 F is the result of Western blot analysis of the regulation of CEBPA on RGCC; Figure 4 G is the MSP detection result graph; Figure 4 H is the survival method data graph of CEBPA methylation levels in BC tumors and normal tissues; Figure 4 I is the Kaplan-Meier survival curve of BC patients based on the high or low methylation level of CEBPA promoter CpG island;

[0043] Figure 5 A is the Venn diagram; Figure 5 B is the mass spectrometry identification result of potential proteins interacting with RGCC; Figure 5 C is a graph showing the results of Co-IP assay; Figure 5 D is the result of IF co-staining; Figure 5 E is the molecular dynamics simulation analysis result diagram; Figure 5 F is the minimum energy docking phase diagram of RGCC and PLK1; Figure 5 G is the Western blot analysis result of PLK1 protein level under RGCC knockdown or overexpression; Figure 5 H is a graph showing the results of PLK1 kinase assay;

[0044] Figure 6 A is the KEGG pathway analysis result diagram; Figure 6 B is a diagram showing the analysis results of the phospho-site database; Figure 6 C is the result diagram of gene set enrichment analysis (GSEA); Figure 6 D is a graph showing the results of an in vitro kinase activity test; Figure 6E is a test result diagram showing that the RGCC / PLK1 axis promotes lung metastasis by activating AMPKα2;

[0045] Figure 7 A is a flow chart of the hypothetical AMPKα2 model that promotes lung metastasis through oxidative phosphorylation and fatty acid oxidation; Figure 7 B is the result of measuring mitochondrial membrane potential by JC-1 staining; Figure 7 C is the result of detecting mitochondrial oxygen consumption rate using Seahorse XF24 extracellular flux analyzer; Figure 7 D is a graph showing the results of fatty acid oxidation detected using a microplate reader; Figure 7 E is a graph showing the results of detecting the NADPH / NADP+ ratio using a microplate reader; Figure 7 F is the result graph of measuring ROS level by DCFH-DA probe; Figure 7 G is a graph of orthotopic metastasis of RGCC knockout MDA-MB-231 / LM3 cells with or without treatment with an OXPHOS inhibitor (IACS-10759) or a fatty acid oxidation inhibitor (Etomoxir; 7 mice per group);

[0046] Figure 8 A is the IC of paclitaxel and carboplatin 50 Test result graph; Figure 8 B is the cell viability test result of paclitaxel and carboplatin; Figure 8 C is the treatment plan for mice; Figure 8 D is the overall survival rate of mice injected with MDA-MB-231 / LM3 / shNC or MDA-MB / 231 / LM3 / shRGCC with or without the combined administration of paclitaxel / carboplatin, n = 7 mice per group; Figure 8 E is a representative lung surface nodule and H&E image of mice in each group, with 7 mice in each group, and the scale bar represents 200 μm; Figure 8 F is a statistical graph of mouse body weight, n = 7-9 / group; Figure 8 G is a statistical graph of the liver / body weight ratio of mice, n=7-9 / group; Figure 8 H is the statistical graph of spleen / body weight of mice, n=7-9 / group;

[0047] Fig. 9 A is a heat map; Fig. 9 B is a representative bioluminescent imaging of mouse 4T1 breast cancer cell metastasis to the lung in major organs of mice injected with 4T1 cells in the fat pad for 30 days; Fig. 9 C is a graph showing the Western blot analysis of RGCC expression in parental and derivative cells (231:MDA-MB-231);

[0048] Figure 10-11This is the result of Western blotting detection; Fig.10 The results of knockdown of RGCC in 4T1 and 231 lung metastatic cells; Fig.11 Overexpression of RGCC by lentiviral vector in MDA-468 and HCC1806 cells; Figure 12-Figure 15 This is a diagram of the Transwell analysis results; Figure 12-13 This is the invasion of cells after knocking down RGCC; Figure 14-15 The invasion of cells after overexpression of RGCC.

[0049] Fig.16 It is a Venn diagram;

[0050] Fig.17 Figure 1 is the result of qRT-PCR assay;

[0051] Fig.18 is the critical prognostic index map;

[0052] Fig.19 A is the result of detecting basal respiration using the Seahorse XF24 extracellular flux analyzer; Fig.19 B is a graph showing evaluation of cell viability by CCK8 assay.

[0053] In the above figures, * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001. DETAILED DESCRIPTION

[0054] The technical solution of the present invention will be further described clearly and completely in conjunction with specific embodiments below. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments. Therefore, based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work belong to the protection scope of the present invention.

[0055] In the embodiment of the present invention, the cell culture scheme is as follows: mouse TNBC cell line 4T1, human TNBC cell lines MDA-MB-231, MDA-MB-468, BT-549, Hs578T and HCC1806 were obtained from the American Type Culture Collection (ATCC, USA); 4T1 and HCC1806 cells were cultured in 1640 medium (Thermo Fisher Scientific) containing 10% FBS (HyClone) and 1% penicillin / streptomycin (Shanghai Biotim, China), and other cells were cultured in DMEM medium (Gibco, USA) containing 10% FBS and 1% penicillin and streptomycin; all cell lines were cultured at 37°C with 5% CO 2In vivo imaging was performed with engineered 4T1, MDA-MB-231, HCC1806, and MDA-MB-468 cells expressing luciferase.

[0056] In the examples of the present invention, all animal experiments were authorized by the Animal Care Ethics Committee of Chongqing Medical University.

[0057] In the present embodiment, the invasive transwell analysis scheme is as follows: tumor cells (2×10 4 ) were seeded in 200 μl of serum-free medium into wells of 8 μm pore Boyden chambers (Becton, Dickinson, USA) coated with Matrigel (1:7.5, Millipore, USA), and 500 μl of complete medium was added to the lower chamber; after 18 h of culture, the Transwell membranes were fixed with 4% paraformaldehyde, stained with 0.5% crystal violet, and counted under a microscope; all experiments were repeated 3 times.

[0058] In the examples of the present invention, the RNA preparation, qRT-PCR and RNA sequencing methods are as follows: total RNA was extracted using TRIzol reagent (Takara, Japan), and then cDNA was synthesized using PrimeScript RT kit (Takara, Japan); quantitative PCR was performed using SYBR Premix Ex Taq II kit (Takara, Japan); second-generation RNA sequencing was performed by Shengyin Biotechnology (Shanghai, China), and differential gene expression (DEG) analysis was performed using the DESeq2 software package.

[0059] The target sequences of RGCC and shRNA NC sequences used in this study are as follows:

[0060] shNC: 5'-TTCTCCGAACGTGTCACGT-3', as shown in SEQ ID NO.1; RGCC#1(Mus): 5'-GCCAAATTAGG TGACACTAAA-3', as shown in SEQ ID NO.2; RGCC#2(Mus): 5'-CGAAGACTTCATTGCCGATCT-3', as shown in SEQ ID NO.3; RGCC#1(Homo): 5'-CCUGCAGUUUGAUGCUGAUTT-3', as shown in SEQ ID NO.4; RGCC#2(Ho mo): 5'-CAGAUUCACUUUAUAGGAA-3', as shown in SEQ ID NO.5.

[0061] In the embodiment of the present invention, the Western blot analysis protocol is as follows: TNBC cells were lysed in RIPA buffer (Beyotime, China) to extract total protein; equal amounts of protein were subjected to SDS-PAGE and transferred to PVDF membrane (Bio-Rad, USA); the membrane was blocked with 5% skim milk at room temperature for 1 hour and incubated with primary antibody at 4°C overnight; the membrane was then incubated with horseradish peroxidase-coupled secondary antibody at room temperature for 2 hours and immunoblotted by enhanced chemiluminescence system (Bio-Rad, Hercules, EDA The primary antibodies used were as follows: RGCC (1:1000; #30125; SAB), CEBPA (1:500; ab40764; Abcam), PLK1 (1:1000, MG67093; abmart), AMPKα2 (1:1000: 18167-1-AP; Proteintech), P-AMPK (Thr172) (1:1000, #50081; Cell Signaling), β-actin (1:1000); all experiments were repeated 3 times.

[0062] In the examples of the present invention, the establishment of stable cell lines and plasmid schemes are as follows:

[0063] Lentiviral expression vectors of RGCC and control shRNA NC were obtained from GenePharma (Shanghai, China); breast cancer cells (4T1-LM3 and 231-LM3) were transduced with lentivirus at 4 μg / ml polyamine, and stable cell lines were selected by G418 (Beyotime, China) according to the manufacturer's instructions.

[0064] In the present embodiment, all primers used in the qRT-PCR experiment are as follows:

[0065] RGCC (Homo): F: 5'-AACAGACTCTACCCCAGCTCT-3', as shown in SEQ ID NO. 6; R: 5'-GGCTTCTAGC TCTTTTGTGTCT-3', as shown in SEQ ID NO. 7. RGCC (Mus): F: 5'-CTCCAACCAACTCCTCTCC-3', as shown in SEQ ID NO. 8; R: 5'-GACCCCAAACTCCTTGCT-3', as shown in SEQ ID NO. 9.

[0066] CEBPA (Homo): F: 5'-GCCAAGAAGTCGGTGGACAA-3', as shown in SEQ ID NO. 10; R: 5'ATTGTCACTG GTCAGCTCCA-3', as shown in SEQ ID NO. 11. CEBPA (Mus): F: 5'-GAGCCCCCTCTGAGTCAG-3', as shown in SEQ ID NO. 12; R: 5'-GCAAAAACATCTTGTTGAG-3', as shown in SEQ ID NO. 13.

[0067] β-actin (Homo): F: 5'-GCCGAGGACTTTGATTGC-3', as shown in SEQ ID NO. 14; R: 5'-CCTGTGTG GACTTGGGAGA-3', as shown in SEQ ID NO. 15. β-actin (Mus): F: 5'-GCTATGCTCTCCCTCACG-3', as shown in SEQ ID NO. 16; R: 5'-ACGCACGATTTCCCTCT-3', as shown in SEQ ID NO. 17.

[0068] For RGCC overexpression, breast cancer cells (MDA-MB-468 and HCC1806) were transfected with RGCC wild-type or mutant plasmids (Genechem, China) using polyamine transfection, and stable cell lines were selected by puromycin; HEK293T and 231-LM3 cells were used to generate stable RGCC-overexpressing cell lines by retroviral infection; to obtain the pGL3 RGCCWT reporter or the pGL3 RGCC MUT reporter, the promoter containing the CEBPA wild-type binding site (WT) and mutant binding site (MUT) was cloned into the pGL3 luciferase reporter vector (GenePharma, China).

[0069] In the example of the present invention, the cell viability determination method is as follows: cells are seeded on a 96-well plate at a density of 1000 / well and cultured for a specific time; cell viability is measured using a cell counting kit-8 (Beyotime, China) according to the manufacturer's instructions.

[0070] In the present embodiment, the immunohistochemistry (IHC) protocol is as follows: IHC staining is performed using tissue sections of patients or mice according to the manufacturer's protocol. Specifically, the tissue sections were dewaxed in xylene to extract antigens, blocked with goat serum, and then incubated with RGCC (1:150) and p-AMPK (1:1.50) at 4°C overnight; after incubating the sections with secondary antibodies at room temperature for 1 hour, the sections were stained with a DAB kit (Beyotime, China), and images were captured.

[0071] In the present example, cells were treated according to the manufacturer's protocol, and then mitochondrial membrane potential (ΔΨm) and oxygen consumption rate (OCR) were measured.

[0072] In the present embodiment, the detection method of fatty acid oxidation, NADPH and ROS in cells is as follows: fatty acid oxidation is detected using a commercially available kit (ab222944, Abcam); cells are treated according to the manufacturer's protocol, and the ROS and NADPH levels of cells are detected by a NAPDH kit (S0179, Beyotime) and a ROS kit (SO033S; Beyotime); all tests are performed strictly according to the instructions in the kit manual.

[0073] In the examples of the present invention, the bioinformatics analysis method is as follows: the microarray data consulted in the present invention are collected from the gene expression comprehensive data set, with accession numbers of GSE14020, GSE32489, GSE5327, GSE32981, GSE34153, GSE74685 and GSE68468; the gene set obtained from GSEA (https: / / www.broadlnstitute.org / gsea / ) and gene set enrichment analysis (GSEA) analysis was performed using GSEA software.

[0074] In the examples of the present invention, the statistical analysis method is as follows: data are expressed as mean ± S, D. SPSS software program (version 20.0) and GraphPad Prism (version 8.0) were used for statistical analysis; Kaplan–Meier analysis was used for survival analysis of mice or patients; Pearson correlation coefficient was used to test the correlation between RGCC expression and other RNAs; P < 0.05 was considered statistically significant.

[0075] In the embodiment of the present invention, the Gene ID of RGCC in NCBI is 28984.

[0076] In the embodiment of the present invention, PROMO database: http: / / alggen.lsi.upc.es / ; JASPAR database: http: / / jaspar.genereg.net / .

[0077] In the examples of the present invention, the CEBPA methylation-specific primers and non-methylation-specific primers involved in this study were designed through the methyprimer online website (http: / / www.urogene.org / methprimer / ) and synthesized by Sangon Biotech (Shanghai, China).

[0078] Example 1. Establishment of mouse organ metastasis model and clinical prognosis analysis of TNBC

[0079] 1. Establishment of the experimental metastasis model of triple-negative breast cancer: 4T1 and MDA-MB-231 cells were used as parental cells and 1×10 6 cells / mouse were inoculated into the fourth mammary fat pad, and then spontaneous organ metastasis mice were selected for primary culture; when the cells formed stable clones, they were inoculated into new mice to induce specific organ degeneration; after three rounds of screening, a cell line with high organ degeneration was finally obtained.

[0080] like Figure 1 As shown in A, the present invention uses luciferase-labeled TNBC cell lines 4T1 and MDA-MB-231 to generate organ-specific metastatic derivatives of TNBC by repeated fat pad injections and in vivo transfer clone selection / expansion; the resulting subpopulations are named according to their organ of origin and generation.

[0081] 2. Bioluminescence imaging (BLI): Mice were anesthetized and given the substrate D-luciferin (150 mg / kg) by intraperitoneal injection; after imaging, the photon flux of each mouse was calculated by Living Image software v.2.50.

[0082] like Figure 1 B, Fig. 9 As shown in B, LM3 derivatives (e.g., MDA-MB-231 / LM3, third-generation lung metastatic cells) have significant lung-specific, rather than other organ-specific metastatic potential as examined by in vivo bioluminescence imaging (BLI), indicating that a successful TNBC lung-tropic metastasis mouse model was established.

[0083] 3. RNA Sequencing Analysis

[0084] To determine the gene expression patterns associated with lung metastatic behavior, RNA sequencing analysis was performed in this example, including two lung metastatic cells (4T1-LM3, 231-LM3) and their corresponding parental cells (4T2-P, 231-P). Figure 1 As shown in C, with a cutoff threshold of fold change >2.0 and P < 0.05, a total of 181 genes were commonly up-regulated and 353 genes were down-regulated in 4T1 / LM3, while a total of 381 genes were up-regulated and 269 genes were down-regulated in MDA-MB-231 / LM3.

[0085] Heat map Figure 1 D and Fig. 9 As shown in A, this figure shows the changes in 40 genes. Figure 1 D shows the 20 most up-regulated or down-regulated genes between MDA-MB-231 / LM3 and MDA-MB / 231 / P cells; Fig. 9 A shows the 20 most up- and down-regulated RNAs between 4T1 / LM3 and 4T1 / P cells; RGCC was the most significantly upregulated in metastatic derivatives compared to parental cells. Of note, expression of RGCC was only detected in lung metastatic derivatives, but not in brain or liver metastases, as detailed in Figure 1 E- Figure 1 F. In addition, RGCC protein increased in lung metastases with successive generations of screening, as detailed in Fig. 9 C. The above data suggest the potential role of RGCC in promoting TNBC metastasis to the lung.

[0086] 4. Expression of RGCC in TCGA database (RNAseq data) of BC patients

[0087] In order to further understand the clinical significance of RGCC in breast cancer lung-specific metastasis, this example analyzed the expression of RGCC in the TCGA database of BC patients. Figure 2 As shown in A, RGCC is most highly expressed in TNBC compared with other breast cancer subtypes. Further analysis of the breast cancer cohort data from the Gene Expression Omnibus (GEO) showed that high levels of RGCC were associated with lung metastasis rather than metastasis to other organs, as detailed in Figure 2 B- Figure 2 C. The present invention also studied other tumors associated with lung metastasis from multiple public datasets, and the increase of RGCC was shared in lung metastasis of multiple solid tumors (such as colorectal cancer, osteosarcoma, pancreatic cancer and prostate cancer), but not in metastasis of other organs, such as Figure 2 D- Figure 2 As shown in F, RGCC mRNA expression was increased in lung metastases compared with other organ metastases or primary tumors. In addition, clinical statistical analysis revealed a negative correlation between RGCC expression and overall survival in TNBC patients, as detailed in Figure 2 G. The above data reveal that the increase of RGCC in lung-specific metastasis of breast cancer is closely related to the poor prognosis of patients.

[0088] Example 2. RGCC promotes TNBC metastasis to the lung

[0089] To understand whether RGCC has a causal role in lung-tropic metastasis, it was stably knocked down in LM3 populations (4T1 / LM3 / RGCC KD, MDA-MB-231 / LM3 / RCCC KD) (see Fig.10 ) and overexpressed in selected TNBC cell lines (MDA-MB-468 / RGCC, HCC1806 / RGCC) (see Fig.11 ) to track its metastasis in mice by bioluminescence imaging, e.g. Figure 3 A- Figure 3 H. Deletion of RGCC in LM3 significantly reduced lung metastatic nodules compared with control mice ( Figure 3 A- Figure 3 D), prolonged the survival of mice carrying lung metastases ( Figure 3 I, left). However, ectopic RGCC in MDA-MB-468 and HCC1806 resulted in more aggressive metastatic activity, as detailed in Figure 3 E- Figure 3 I. Consistent with the results that RGCC increase promotes lung metastasis in vivo, the cell invasion ability of RGCC-deficient cells was significantly lower than that of control cells, and ectopic RGCC overexpression increased cell invasion in vitro. Figure 12-Figure 15 The above data indicate that RGCC is essential for lung metastasis of TNBC cancer cells.

[0090] Example 3. RGCC is negatively regulated by CEBPA

[0091] 1. To explore the potential mechanism of RGCC upregulation in lung-specific metastasis, this example performed bioinformatics analysis using the PROMO database to determine the potential transcription factors (TFs) of the RGCC gene and identified an overlapping TF (CEBPA), such as Fig.16 In accordance with this finding, CEBPA (inhibitors 1, 2) was reduced in both LM3 derivatives, as detailed in Fig.17 This example uses the JASPAR database for further analysis to reveal a potential CEBPA binding consensus sequence (E1) in the RGCC promoter, see Figure 4 A.

[0092] 2. Dual luciferase reporter assay and chromatin immunoprecipitation (CHIP) analysis

[0093] pGL3 RGCC WT reporter or pGL3 RGCC MUT reporter was transferred into cells using Lipofectamine 3000, and Renilla luciferase reporter vector (PRL-TK vector) was used as a control; cell lysates were collected, and Renilla and firefly luciferase activities were measured using a dual-luciferase reporter assay system (Promega, USA); ChIP assays were performed using cebpa and IgG antibodies using a ChIP kit (Thermo, MA, USA) according to the manufacturer's instructions; co-precipitated RNA was used for cDNA synthesis and quantified by qRT-PCR; ChIP primer sequences used in this study are shown below:

[0094] CEBPA (Mus):

[0095] F: 5'-AGGGGAACTTAGAACCTTGTGGGAA-3', as shown in SEQ ID NO.18; R: 5'-AGGCTTCCTTCTGATGG CCAACCCA-3', as shown in SEQ ID NO.19.

[0096] CEBPA(Homo):

[0097] F: 5'-AGATTGCGCACCATTAGAAGTGGGT-3', as shown in SEQ ID NO.20; R: 5'-TTAGAAACAAGGGACCT GTCCAGGC-3', as shown in SEQ ID NO.21.

[0098] RGCC levels were negatively correlated with CEBPA in the TCGA database, such as Figure 4 B. Luciferase activity showed that CEBPA regulated RGCC transcripts in 293T and MDA-MB-231 / LM3 cells; luciferase reporter evaluation results showed that the transcriptional activity of RGCC was significantly reduced in CEBPA-overexpressing cells, see for details Figure 4 C; Chromatin immunoprecipitation analysis validated the binding affinity of CEBPA to the RGCC promoter in MDA-MB-231 / LM3 transfected with CEBPA or control vector; further confirmed the results of luciferase activity assay, see Figure 4 D. Accordingly, CEBPA overexpression significantly reduced RGCC mRNA in 4T1-LM3 and 231-LM3 cells (see Figure 4 E) and protein expression (see Figure 4 F).

[0099] 3. Methylation-specific PCR (MSP)

[0100] Cell genomic DNA was extracted according to the manufacturer's instructions and modified with bisulfite 1 μg. MSP reaction system 20 μl; after final product exposure, the product was subjected to agarose gel electrophoresis and photographed with a gel imager (Bio-Rad, USA) for documentation; all experimental primers used for MSP are as follows:

[0101] CEBPA-Left-M: TTGGAGATTAGAGTTAGGAGACGT, as shown in SEQ ID NO.22; CEBPA-right-M: ACACGA AATAAAAATAAAAAACGAA, as shown in SEQ ID NO.23;

[0102] CEBPA-Left-U: TTTGGAGATTAGAGTTAGGAGATGT, as shown in SEQ ID NO.24; CEBPA-right-U: ACACA AAATAAAAATAAAAAACAAA, as shown in SEQ ID NO.25.

[0103] Among them, M: Methylation primer (methylation-specific primer); U: Unmethylation primer (unmethylation-specific primer).

[0104] CEBPA is downregulated in a variety of cancers as a tumor suppressor, which is confirmed by epigenetic regulation of DNA methylation in leukemia. Analysis of the SurvivalMeth database revealed two methylation sites on the CEBPA promoter. Using probes targeting these methylation sites, methylation levels in tumors were significantly higher than in normal tissues, see Figure 4 H. According to the best critical prognostic index (see Fig.18 ), the survival probability of BC patients in the high-risk group is significantly lower than that in the low-risk group, see Figure 4 I. This example uses methylation-specific polymerase chain reaction detection (MSP) to detect hypermethylation of the CEBPA promoter in MDA-MB-231 / LM3 cells compared to parental cells, and treatment of cells with the demethylating drug descitabine can reduce the hypermethylation level in MDA-MB / 231 / LM3, see Figure 4 G. The above results indicate that the reduction of CEBPA in lung-specific metastasis contributes to the upregulation of RGCC.

[0105] Example 4. RGCC stimulates PLK1 kinase activity

[0106] 1. In vitro PLK1 Kinase Assay

[0107] The specific PLK1 kinase activity with or without RGCC was measured using a universal kinase activity kit (R&D Systems) according to the manufacturer's instructions. The kinase activity depends on the amount of ADP generated in the kinase reaction, which can be determined by the concentration of inorganic phosphate released by ADP and the coupling rate of the kinase reaction. The kinase reaction was stopped using malachite green reagent and the optical density was measured at 600 nm to determine the amount of phosphorylated AMPK.

[0108] 2. Immunoprecipitation and LC-MS / MS

[0109] (1) Immunoprecipitation: Immunoprecipitation assay was performed using magnetic protein A / G immunoprecipitation beads (B23202, Bimake); RGCC and PLK1 antibodies were used for immunoprecipitation. Specifically, after lysis on ice for 30 minutes with NP40 (P0013F, Beyotime), the cells were centrifuged at 12000g for 30 minutes; the supernatant was then collected; a small amount of lysate was used as the input group; immunoprecipitation reaction was performed according to the manufacturer's protocol; after immunoprecipitation, the beads were washed and analyzed by Western Blot.

[0110] (2) LC-MS / MS analysis: 231-LM3 cells stably expressing RGCC were immunoprecipitated with anti-RGCC agarose beads. 4 HCO 3 The products were digested with PH8.0 digestion buffer at 37°C overnight; after desalting the hydrolyzed peptides, the peptide samples were diluted to 1 g / L on BUFF; the sample volume was set to 5 L and the scan mode was collected for 60 minutes; mass spectrometry data were collected using a Triple TOF 5600+ LC / MS system (AB SCIEX, USA); the peptide samples were dissolved in 2% acetonitrile and 0.1% formic acid and analyzed using a Triple TOF 5600plus mass spectrometer coupled to an Eksigent nano LC system (AB SCIEX, USA); for protein identification, the uniprot database was searched using the Paragon algorithm in protein Pilot; for the identified protein results, specific filtering criteria were selected, and peptides with scores >1.3 (above 95% confidence) were considered to be credible peptides, and proteins containing at least one unique peptide were retained.

[0111] According to previous studies, RGCC binds to protein kinases and enhances their kinase activity. To investigate the molecular mechanism of RGCC in lung-specific metastasis, bioinformatics analysis was performed using the Inbio discover, String, and Biogrid databases to predict the target genes of RGCC, such as Figure 5 As shown in A, the study found four potential RGCC targets, including protein kinases PLK1 and CDK1.

[0112] We isolated RGCC-associated protein complexes in MDA-MB-231 / LM3 cells and characterized them using affinity purification and liquid chromatography-tandem mass spectrometry. Figure 5 B is the mass spectrometry identification result of potential proteins interacting with RGCC. Figure 5 As shown in B, PLK1 was identified in the prey list; Figure 5C is a Co-IP assay result diagram to confirm the direct interaction between RGCC and PLK1 in MDA-MB-231 / LM3 cells using anti-RGCC or anti-PLK1 antibodies, respectively. The results show that RGCC directly binds to PLK1 in MDA-MB-231 / LM3 cells; Figure 5 D is the result of IF co-staining; the results of immunofluorescence staining showed that RGCC and PLK1 were mainly co-localized in the cytoplasm of 4T1 / LM3 and MDA-MB-231 / LM3 cells.

[0113] In order to understand whether RGCC would affect the kinase activity of PLK1, the ligand structure with the most favorable binding free energy and reasonable orientation was selected as the optimal docking conformation, such as Figure 5 As shown in E, RGCC and PLK1 are stably bound. In addition, PLK1 protein and RGCC protein can form a stable hydrogen bond interaction network. The hydrogen bond interaction amino acid sites include LEU-491 and HIS-56, TYR-417 and ASP-36, PHE-535 and HIS-47 and other amino acid residues. For details, see Figure 5 F, they contribute to the formation of a stable complex between RGCC and PLK1 (binding energy: -79.81 kcal / mol); after 20 ns simulation, the binding conformation is stable. It is worth noting that the results of Western blot analysis of PLK1 protein levels under RGCC knockdown or overexpression showed that the expression of PLK1 did not change significantly with RGCC silencing or overexpression, see Figure 5 G. Under this premise, the kinase activity was tested and the results were as follows Figure 5 As shown in Figure H, the data show that RGCC has a great effect on the kinase activity of PLK1, and the EC50 (concentration required to achieve 50% maximum activation) value of PLK1 is low (0.01936 μM). The above results show that RGCC can effectively promote the kinase activity of PLK1.

[0114] Example 5. RGCC / PLK1 axis promotes lung metastasis by activating AMPKα2

[0115] This example further studied the downstream targets mediated by the RGCC / PLK1 axis and analyzed the relevant gene expression profiles of RGCC knockout and control in the brain organoid cohort from the GEO database (GSE157684). Figure 6A is the KEGG pathway analysis result, showing the RGCC-related signals analyzed by SangerBox using the microarray data set GSE157684. The results show that based on the KEGG pathway enrichment analysis, RGCC may be mainly responsible for regulating the AMPK and oxidative phosphorylation signaling pathways. At the same time, by analyzing the phospho-site database, it was found that the AMPK signaling pathway overlaps with the potential phosphorylation substrates of PLK1 ( Figure 6 B), SangerBox enriched the important pathways related to PLK1 based on the potential phosphorylated proteins of PLK1.

[0116] Previous studies have also shown that PLK1 can phosphorylate AMPKα2 (the catalytic subunit of AMPK), and phosphorylated AMPKα1 stimulates strong AMPK signaling, which leads to metabolic reprogramming by promoting catabolism, especially oxidative phosphorylation and fatty acid oxidation. It is worth noting that the results of GSEA analysis showed that enhanced RGCC was positively correlated with oxidative phosphorylation and fatty acid oxidation, that is, RGCC expression was positively correlated with fatty acid oxidation and oxidative phosphorylation, see for details Figure 6 C. Therefore, to demonstrate whether RGCC can promote the phosphorylation of AMPKα2 through PLK1, an in vitro kinase activity test was performed, and the data confirmed that the synergistic effect of RGCC and PLK1 significantly increased AMPKα2 phosphorylation, see for details. Figure 6 D. To verify that the RGCC / PLK1 axis promotes lung metastasis by activating AMPKα2, the constructed mixture of MDA-MB-468 / RGCC cells was used to test its metastatic potential in vivo via tail vein injection. Figure 6 As shown in E, mice implanted with RGCC-overexpressing MDA-MB-468 cells had significantly increased lung metastasis compared with mice implanted with control MDA-MB-468 cells; however, in the case of injection of Volasertib (a PLK1 kinase inhibitor) or Dorsomorphin (an AMPK activity inhibitor), lung metastasis in MDA-MB-468 / RGCC-injected mice was significantly reduced. These results suggest that enhanced RGCC activates AMPKα2 in vivo through RGCC-driven PLK1 activity to promote TNBC lung metastasis.

[0117] Example 6. RGCC / PLK1 / AMPK2 signaling axis mediates TNBC cell lung metastasis by regulating mitochondrial oxidative phosphorylation and fatty acid oxidation

[0118] As a classic energy sensor, AMPK is involved in regulating metabolic reprogramming, allowing metastatic cancer cells to adapt to the harsh environment with metabolic stress and thrive in secondary sites. Oxidative phosphorylation and fatty acid oxidation have been reported to enhance cancer cell survival and metastasis. Therefore, the present invention proposes a hypothesis that AMPK may promote lung colonization and metastasis of TNBC cells through mitochondrial oxidative phosphorylation and fatty acid oxidation, respectively, see Figure 7 A. On the one hand, RGCC-deficient cells exhibit reduced mitochondrial activity (see Figure 7 B) Decreased mitochondrial oxygen consumption rate (OCR) (see Figure 7 C) and decreased basal respiratory rate (see Fig.19 A); Tumor cells treated with Volasertib or Dorsomorphin showed similar mitochondrial activity, OCR, and basal respiration rate as those obtained in RGCC-deficient cells, see Figure 7 B. Figure 7 C and Fig.19 A. On the other hand, fatty acid oxidation levels were lower in RGCC knockout cells or cells treated with Volasertib or Dorsomorphin (see Figure 7 D), the NADPH / NADP+ ratio decreases (see Figure 7 E), ROS levels increased (see Figure 7 F). The results indicate that RGCC / PLK1 / AMPK2 signaling plays a critical role in OXPHOS and fatty acid oxidation in lung metastatic TNBC cells.

[0119] To understand whether metabolic reprogramming mediated by the RGCC / PLK1 / AMPK2 axis affects the survival of lung metastatic cells, we evaluated the formation of lung metastases by hypothesizing their role in lung metastasis. As expected, RGCC deficiency, inhibition of OXPHOS using ACS-10759 (an inhibitor of oxidative phosphorylation), or inhibition of fatty acid oxidation using etolimus (a fatty acid oxidation inhibitor) significantly reduced cell survival, as detailed in Fig.19 B; In mice implanted with MDA-MB-231 / LM3 cells, the burden of lung colonization and metastasis was significantly reduced after IACS-10759 or etolimus treatment; RGCC knockout combined with IACS-10759 or etolimus further significantly reduced lung metastasis, as shown in Figure 7 G. The above results indicate that oxidative phosphorylation and fatty acid oxidation mediated by the RGCC / PLK1 / AMPK2 signaling axis are essential for the survival of lung-disseminated tumor cells, thereby promoting lung metastasis.

[0120] Example 7. Targeting RGCC combined with paclitaxel / carboplatin to improve the therapeutic effect of lung-specific metastasis

[0121] For orthotopic treatment in mouse models, 1 × 10 6 Cancer cells were injected into the mammary fat pad of each mouse; when the primary tumor xenograft reached approximately 50 mm 3 At 4 pm, mice were intraperitoneally injected with 5 mg / kg carboplatin (MCE; NSC 241240) and 10 mg / kg paclitaxel (MCE; HY-B0015).

[0122] Previous studies have shown that carboplatin / paclitaxel combination therapy is the preferred treatment for metastatic breast cancer, however, the benefits of combination therapy are limited. This example further studies whether targeting RGCC can improve the efficacy of carboplatin-paclitaxel combination therapy in the treatment of TNBC lung metastasis. In this example, a series of dilutions of paclitaxel and carboplatin were used to treat lung-specific metastatic 4T1 / LM3 and MDA-MB-231 / LM3 cells with silenced RGCC and control cells. 50 The values ​​and cell viability were determined by CCK8 (n=3). Figure 8 A and Figure 8 B shows that administration of RGCC-deficient MDA-MB-231 / LM3 cells with serial dilutions of paclitaxel and carboplatin significantly reduced the IC50 value and tumor cell viability compared with RGCC wild-type cells, indicating that RGCC deficiency combined with paclitaxel and carboplatin treatment is beneficial for TNBC patients with lung metastasis.

[0123] To further evaluate the efficiency of carboplatin / paclitaxel combination regimen in targeting RGCC, the mouse model injected with MDA-MB-231 / LM3RGCC engineered cells was used for chemotherapy. The mouse treatment regimen was as follows Figure 8 C. Compared with control mice (labeled as MDA-MB-231 / LM3 / shNC / vector), carboplatin combined with paclitaxel treatment prolonged the survival of mice and reduced lung metastatic nodules; RGCC knockout combined with carboplatin / paclitaxel treatment further improved the lifespan of these mice and reduced lung metastatic nodules, see Figure 8 D and Figure 8 E. All treatment regimens had no significant side effects on the body weight, spleen, or liver volume of nude mice, indicating that the drug treatment was well tolerated and had no obvious toxicity. For details, see Figure 8 F- Figure 8 H; Figure 8 F- Figure 8 Data are expressed as mean ± SD in H. The above findings reveal that the combination of targeting RGCC, carboplatin, and paclitaxel synergistically inhibits lung metastasis and may bring therapeutic benefits to the treatment of lung metastasis in TNBC.

Claims

1. Use of a reagent for detecting RGCC expression levels in the preparation of a product for the prognostic diagnosis of lung-specific metastasis of triple-negative breast cancer.

2. Use of an RGCC inhibitor in the preparation of a therapeutic drug for lung metastasis of triple-negative breast cancer cells, characterized in that: The RGCC inhibitor is RGCC shRNA, and its target sequence is shown in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.

5.

3. The combined use of RGCC inhibitor and PLK1 inhibitor in the preparation of a drug for inhibiting lung metastasis of triple-negative breast cancer cells, wherein: The PLK1 inhibitor is Volasertib; the RGCC inhibitor is RGCC shRNA, and its target sequence is shown in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.

5.

4. Use of a drug targeting RGCC in combination with paclitaxel and carboplatin in the preparation of a pharmaceutical composition for inhibiting metastasis of triple-negative breast cancer cells to the lung, characterized in that: The drug targeting RGCC is RGCC shRNA, and its target sequence is shown as SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.

5.

5. Use of an RGCC inhibitor in the preparation of a product for inhibiting the metastasis of triple-negative breast cancer cells to the lungs, reducing lung metastatic nodules, and prolonging the survival of breast cancer patients with lung metastasis, characterized in that: The RGCC inhibitor is RGCC shRNA, and its target sequence is shown in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.5.

Images