Method for preparing organic fertilizer by deep fermentation of livestock and poultry manure and straw

Abstract

The present invention discloses a method for preparing organic fertilizer by deep fermentation of livestock and poultry manure and straw, comprising: mixing livestock and poultry manure and straw at a weight ratio of 1:3, adjusting the carbon-nitrogen ratio to 25:1, and simultaneously inoculating microbial agents, with an inoculation amount of 3% by weight and a water content of 60%; obtaining pre-fermented materials; adding the pre-fermented materials to an intelligent closed high-temperature aerobic fermentation tank, and after fermentation begins, stirring and fermenting for 5 to 16 days at a fermentation temperature of 60 to 70°C under the condition that a blower provides oxygen; and preparing organic fertilizer by granulation of the fermented finished product. The present invention adopts closed high-temperature fermentation in an intelligent closed high-temperature aerobic fermentation tank, and the fermentation method is pollution-free fermentation in the tank; and the strain of the microbial agent used is derived from the high-temperature dominant bacterial community in the natural fermentation process of straw composting, and after long-term screening and domestication, it can effectively promote the fermentation production process of organic fertilizer with straw and livestock and poultry manure as the main raw materials, and improve the production efficiency and fertilizer effect of organic fertilizer.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a method for preparing organic fertilizer by deep fermentation of livestock and poultry excrement and straw. Background Art

[0002] Organic fertilizers are rich in organic nutrients such as humic acid and amino acids, as well as inorganic nutrients such as nitrogen, phosphorus, and potassium. They have always played an important role in the development of agriculture in my country. Organic fertilizers generally refer to organic solid wastes, such as livestock and poultry manure, straw, cakes and meal, agricultural and sideline products, and solid wastes produced by food processing, which are obtained by microbial fermentation and complete decomposition. In actual operation, most organic fertilizers are prepared with livestock and poultry manure and straw as the main materials. Due to the huge scale of my country's breeding industry, the amount of livestock and poultry manure produced in my country each year is also very alarming; the amount of crop straw produced in my country is also very high. The traditional way of dealing with crop straw is mainly incineration, which will cause serious air pollution. At present, the preparation of organic fertilizers with livestock and poultry manure, straw and other materials has become an effective way to recycle livestock and poultry manure and straw.

[0003] Straw is a general term for the stems and leaves (ears) of mature crops. Straw is rich in nitrogen, phosphorus, potassium, calcium, magnesium and organic matter, and is a multi-purpose renewable biological resource. Livestock and poultry manure mainly refers to a type of rural solid waste produced in the livestock and poultry farming industry, including pig manure, cow manure, sheep manure, chicken manure, duck manure, etc. In agricultural production, straw and livestock and poultry manure are often mixed and fermented as organic fertilizer and put into farmland for reuse. However, the existing method of mixed fermentation of straw and livestock and poultry manure is generally traditional composting fermentation. Composting fermentation uses a compost turning machine to turn the compost, which results in large nutrient loss. In addition, the composting fermentation is open and polluted, the stacking site is large, and it cannot be deodorized, resulting in an unpleasant odor in the entire environment. In addition, the organic matter content and NPK content of the organic fertilizer prepared by traditional composting fermentation are low, which cannot meet the production needs of organic fertilizer. Summary of the invention

[0004] An object of the present invention is to solve at least the above problems and / or disadvantages and to provide at least the advantages which will be described hereinafter.

[0005] In order to achieve these purposes and other advantages according to the present invention, a method for preparing organic fertilizer by deep fermentation of livestock and poultry manure and straw is provided, comprising the following steps:

[0006] Step 1: mix livestock and poultry manure and straw at a weight ratio of 1:3, adjust the carbon-nitrogen ratio to 25:1, and simultaneously inoculate microbial agents at an inoculation amount of 3% by weight and adjust the water content to 60% to obtain pre-fermented materials;

[0007] Step 2: Add the pre-fermented materials into an intelligent closed high-temperature aerobic fermentation tank. After the fermentation starts, the fermentation temperature is 60-70° C. and stirred for fermentation for 5-16 days under the condition that a blower provides oxygen. The fermented product is granulated to obtain organic fertilizer.

[0008] Preferably, the livestock and poultry manure is one or more of pig manure, cow manure, chicken manure and duck manure.

[0009] Preferably, the bacteria in the microbial agent are one or more of Bacillus elongatus, Bacillus subtilis and Bacillus brevis.

[0010] Preferably, the classification name of the elongated lysinibacillus is Lysinibacillus macroides SWUST-1, which has been registered and deposited in the General Microbiology Center of the China National Microorganism Culture Collection on May 12, 2022, with a deposit number of CGMCC No.M24857, and a deposit address of Beijing, China; the classification name of the bacillus is Bacillus sp.SWUST-3, which has been registered and deposited in the General Microbiology Center of the China National Microorganism Culture Collection on May 12, 2022, with a deposit number of CGMCC No.M 24858, and a deposit address of Beijing, China; the classification name of the brevibacillus is Brevibacillus sp.SWUST-2, which has been registered and deposited in the General Microbiology Center of the China National Microorganism Culture Collection on May 12, 2022, with a deposit number of CGMCC No.M24859, and a deposit address of Beijing, China.

[0011] Preferably, the DNA gene sequence of the Lysinibacillus macroides SWUST-1 is as shown in SEQ ID NO.1.

[0012] Preferably, the DNA gene sequence of the Bacillus sp. SWUST-3 is as shown in SEQ ID NO.2.

[0013] Preferably, the DNA gene sequence of Brevibacillus sp. SWUST-2 is as shown in SEQ ID NO.3.

[0014] Preferably, the elongated lysine Bacillus adopts the elongated lysine Bacillus secondary seed liquid, and the preparation method thereof is as follows: using an inoculation loop to pick two loops of elongated lysine Bacillus (Lysinibacillus macroides SWUST-1) slant seeds in a 250mL triangular flask filled with 50mL nutrient broth medium, culturing at 37°C, 150r / min, for 18h to obtain the elongated lysine Bacillus primary seed liquid; inoculating the lysine Bacillus primary seed liquid in 250mL optimized culture medium at an inoculation amount of 3% (v / v), culturing at 37°C, 150r / min, and shaking the flask for 30h to obtain the elongated lysine Bacillus secondary seed liquid;

[0015] The bacillus adopts a secondary seed liquid of bacillus, and the preparation method thereof is as follows: using an inoculation loop to pick two rings of bacillus (Bacillus sp. SWUST-3) slant seeds and placing them in a 250mL triangular flask filled with 50mL nutrient broth medium, culturing at 37°C, 150r / min, for 18h to obtain a primary seed liquid of bacillus; inoculating the primary seed liquid of bacillus in 250mL nutrient broth medium at an inoculation amount of 6% (v / v), culturing at 37°C, 150r / min, and shaking the flask for 30h to obtain a secondary seed liquid of bacillus

[0016] The brevis bacillus adopts brevis bacillus secondary seed liquid, and the preparation method thereof is as follows: using an inoculation loop to pick two rings of brevis bacillus (Brevibacillus sp.SWUST-2) slant seeds in a 250mL triangular flask filled with 50mL nutrient broth medium, culturing at 37°C, 150r / min, for 18h to obtain brevis bacillus primary seed liquid; inoculating the brevis bacillus primary seed liquid in 250mL nutrient broth medium at an inoculation amount of 6% (v / v), culturing at 37°C, 150r / min, and shaking the flask for 30h to obtain brevis bacillus secondary seed liquid.

[0017] Preferably, the composition of the optimized culture medium is: CMC-Na 5.0g, (NH4)2SO4 2.0g, K2HPO4 1.0g, MgSO4·7H2O 0.5g, NaCl 0.5g, FeSO4·7H2O 0.1g, distilled water 1000mL, pH 7.0-7.2.

[0018] Preferably, when the bacteria in the microbial agent are a mixture of Bacillus elongatus, Bacillus and Bacillus brevis, the secondary seed liquid of Bacillus elongatus, the secondary seed liquid of Bacillus brevis and the secondary seed liquid of Bacillus brevis are combined in a ratio of 1-1.5:2:2 to obtain a microbial composite agent; the total colony count of the composite bacterial liquid reaches 2.5×10 9 CFU / mL.

[0019] The present invention at least includes the following beneficial effects: the present invention adopts closed high-temperature fermentation in an intelligent closed high-temperature aerobic fermentation tank, the fermentation method is pollution-free fermentation in the tank, under the condition that the blower provides oxygen, aerobic microorganisms multiply rapidly, the material temperature rises rapidly, and enters the high-temperature period on the same day, the temperature can reach 60°C-70°C, in this stage organic matter is decomposed, water is rapidly reduced, pathogens and weed seeds are killed, and the harmlessness and stabilization of the material and the reduction treatment are achieved; and the strain of the adopted microbial agent is derived from the high-temperature dominant bacterial community in the natural fermentation process of straw composting, and after long-term screening and domestication, it can effectively promote the fermentation production process of organic fertilizer with straw and livestock and poultry manure as the main raw materials, improve the production efficiency and fertilizer efficiency of organic fertilizer, and at the same time improve the harmless treatment effect of straw and manure.

[0020] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is the dyed hydrolysis circle in the initial screening process of the strain of the present invention;

[0022] Figure 2 This is the glucose standard curve in the rescreening process of the strain of the present invention. DETAILED DESCRIPTION

[0023] The present invention is further described in detail below in conjunction with the accompanying drawings so that those skilled in the art can implement the invention with reference to the description.

[0024] It should be understood that terms such as “having”, “including” and “comprising” used herein do not specify the existence or addition of one or more other elements or combinations thereof.

[0025] Embodiment 1:

[0026] A method for preparing organic fertilizer by deep fermentation of livestock and poultry manure and straw, comprising the following steps:

[0027] Step 1: Mix pig manure and straw at a weight ratio of 1:3, adjust the carbon-nitrogen ratio to 25:1, and simultaneously inoculate Bacillus elongatus lysine inoculum at an inoculation amount of 3% by weight and adjust the water content to 60% to obtain a pre-fermented material;

[0028] Step 2: Add the pre-fermented materials into an intelligent closed high-temperature aerobic fermentation tank. After the fermentation starts, the fermentation temperature is kept at 65° C. and stirred for 12 days under the condition that a blower provides oxygen. The fermented product is granulated to obtain organic fertilizer.

[0029] The preparation method of the elongated lysine bacillus inoculum comprises the following steps: using an inoculation loop to pick two loops of elongated lysine bacillus slant seeds and placing them in a 250mL triangular flask filled with 50mL of nutrient broth medium, culturing at 37°C, 150r / min, for 18h to obtain a first-level seed solution of the elongated lysine bacillus; inoculating the first-level seed solution of the elongated lysine bacillus in an inoculation amount of 3% (v / v) in 250mL of an optimized culture medium (5.0g of CMC-Na, 2.0g of (NH4)2SO4, 1.0g of K2HPO4, 0.5g of MgSO4·7H2O, 0.5g of NaCl, 0.5g of FeSO4·7H2O, etc.); 0.1g, distilled water 1000mL, pH value 7.0-7.2), 37°C, 150r / min, shake flask culture for 30h to obtain the secondary seed solution of Bacillus elongatus, i.e., Bacillus elongatus lysinic acid agent; the classification name of the Bacillus elongatus lysinic acid Bacillus macroides SWUST-1, which was registered and deposited in the General Microbiological Center of China National Microbiological Culture Collection on May 12, 2022, with the deposit number CGMCC No.M24857; the DNA gene sequence of the Bacillus elongatus lysinic acid Bacillus macroides SWUST-1 is shown in SEQ ID NO.1.

[0030] Embodiment 2:

[0031] A method for preparing organic fertilizer by deep fermentation of livestock and poultry manure and straw, comprising the following steps:

[0032] Step 1: Mix pig manure and straw at a weight ratio of 1:3, adjust the carbon-nitrogen ratio to 25:1, and simultaneously inoculate Bacillus inoculant at an inoculation amount of 3% by weight and adjust the water content to 60% to obtain pre-fermented material;

[0033] Step 2: adding the pre-fermented materials into an intelligent closed high-temperature aerobic fermentation tank, and after fermentation begins, stirring and fermenting for 12 days at a fermentation temperature of 65° C. under the condition that a blower provides oxygen; and granulating the fermented product to obtain organic fertilizer;

[0034] The preparation method of the bacillus inoculant is as follows: using an inoculation loop to pick two rings of bacillus slant seeds and put them in a 250mL triangular flask filled with 50mL nutrient broth medium, 37°C, 150r / min, and culture for 18h to obtain a first-level bacillus seed solution; inoculating the first-level bacillus seed solution in 250mL nutrient broth medium at an inoculum amount of 6% (v / v), 37°C, 150r / min, and shaking the flask for 30h to obtain a second-level bacillus seed solution, i.e., a bacillus inoculant; the bacillus is classified and named as Bacillus sp. SWUST-3, which has been registered and deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on May 12, 2022, with a deposit number of CGMCC No. M 24858; the DNA gene sequence of the bacillus sp. SWUST-3 is shown in SEQ ID NO. 2;

[0035] Embodiment 3:

[0036] A method for preparing organic fertilizer by deep fermentation of livestock and poultry manure and straw, comprising the following steps:

[0037] Step 1: Mix pig manure and straw at a weight ratio of 1:3, adjust the carbon-nitrogen ratio to 25:1, and simultaneously inoculate Bacillus brevis inoculant at an inoculation amount of 3% by weight and adjust the water content to 60% to obtain pre-fermented material;

[0038] Step 2: adding the pre-fermented materials into an intelligent closed high-temperature aerobic fermentation tank, and after fermentation begins, stirring and fermenting for 12 days at a fermentation temperature of 65° C. under the condition that a blower provides oxygen; and granulating the fermented product to obtain organic fertilizer;

[0039] The preparation method of the brevis bacillus inoculant is as follows: pick two rings of brevis bacillus slant seeds with an inoculation loop and place them in a 250mL triangular flask filled with 50mL nutrient broth medium, culture at 37°C, 150r / min, and culture for 18h to obtain a brevis first-level seed solution; inoculate the brevis first-level seed solution in 250mL nutrient broth medium at an inoculation rate of 6% (v / v), culture at 37°C, 150r / min, and shake the flask for 30h to obtain a brevis second-level seed solution; that is, the brevis bacillus inoculant; the brevis bacillus is classified and named as Brevibacillus sp. SWUST-2, which has been registered and preserved in the General Microbiological Center of the China Microbiological Culture Collection Administration on May 12, 2022, with a preservation number of CGMCC No. M 24859; the DNA gene sequence of the brevis bacillus sp. SWUST-2 is shown in SEQ ID NO.3.

[0040] Embodiment 4:

[0041] A method for preparing organic fertilizer by deep fermentation of livestock and poultry manure and straw, comprising the following steps:

[0042] Step 1: Mix pig manure and straw at a weight ratio of 1:3, adjust the carbon-nitrogen ratio to 25:1, and simultaneously inoculate a composite microbial agent at an inoculation amount of 3% by weight and adjust the water content to 60% to obtain a pre-fermented material;

[0043] Step 2: adding the pre-fermented materials into an intelligent closed high-temperature aerobic fermentation tank, and after fermentation begins, stirring and fermenting for 12 days at a fermentation temperature of 65° C. under the condition that a blower provides oxygen; and granulating the fermented product to obtain organic fertilizer;

[0044] The preparation method of the composite microbial agent comprises the following steps: using an inoculation loop to respectively pick two loops of slant seeds of elongated lysine bacillus, bacillus and brevis in a 250mL triangular flask filled with 50mL of nutrient broth medium, culturing at 37°C and 150r / min for 18h to respectively prepare the first-level seed liquid of elongated lysine bacillus, the first-level seed liquid of bacillus and the first-level seed liquid of brevis; inoculating the first-level seed liquid of lysine bacillus in 250mL of optimized culture medium (CMC-Na5.0g, (NH4)2SO4 2.0g, K2HPO4 1.0g, MgSO4·7H2O 0.5g, NaCl 0.5g, FeSO4·7H2O 0.5g) at an inoculation amount of 3% (v / v) 0.1 g, 1000 mL of distilled water, pH value 7.0-7.2), 37°C, 150 r / min, shake flask culture for 30 h to obtain a secondary seed liquid of elongated lysine Bacillus; inoculate the primary seed liquid of Bacillus and the primary seed liquid of Bacillus brevis in 250 mL of nutrient broth medium at an inoculum amount of 6% (v / v), 37°C, 150 r / min, shake flask culture for 30 h to obtain a secondary seed liquid of Bacillus and a secondary seed liquid of Bacillus brevis respectively; combine the secondary seed liquid of elongated lysine Bacillus, the secondary seed liquid of Bacillus and the secondary seed liquid of Bacillus brevis in a ratio of 1.5:2:2 to obtain a microbial composite bacterial agent; the total colony count of the composite bacterial liquid reaches 2.5×10 9CFU / mL; the classification name of the elongated lysinibacillus is Lysinibacillus macroides SWUST-1, which has been registered and deposited in the General Microbiology Center of the China Microorganism Culture Collection Administration on May 12, 2022, with a deposit number of CGMCC No.M 24857; the classification name of the bacillus is Bacillus sp.SWUST-3, which has been registered and deposited in the General Microbiology Center of the China Microorganism Culture Collection Administration on May 12, 2022, with a deposit number of CGMCC No.M 24858; the classification name of the brevibacillus is Brevibacillus sp.SWUST-2, which has been registered and deposited in the General Microbiology Center of the China Microorganism Culture Collection Administration on May 12, 2022, with a deposit number of CGMCC No.M 24859. The DNA gene sequence of the Lysinibacillus macroides SWUST-1 is shown in SEQ ID NO. 1. The DNA gene sequence of the Bacillus sp. SWUST-3 is shown in SEQ ID NO. 2. The DNA gene sequence of the Brevibacillus sp. SWUST-2 is shown in SEQ ID NO. 3.

[0045] Comparative Example 1:

[0046] Pig manure and straw were mixed at a weight ratio of 1:3, and the carbon-nitrogen ratio was adjusted to 25:1. At the same time, Bacillus elongatus was inoculated at a weight ratio of 3%, and the moisture content was adjusted to 60%. The temperature and moisture content were monitored regularly to maintain the temperature at 60°C. Water was added to keep the moisture content of the compost at about 60%. The compost was turned over when the temperature dropped significantly, and the compost was turned over 3 times in total. When the temperature no longer increased significantly, the organic fertilizer was obtained after 10 days of decomposition. Its various properties are shown in Table 1.

[0047] The preparation method of the elongated lysine Bacillus inoculum agent is as shown in Example 1.

[0048] Comparative Example 2:

[0049] Pig manure and straw were mixed at a weight ratio of 1:3, the carbon-nitrogen ratio was adjusted to 25:1, and Bacillus inoculant was added at a weight ratio of 3%. The water content was adjusted to 60%, and the temperature and water content were monitored regularly to maintain the temperature at 60°C; water was added to keep the water content of the compost at about 60%, and the compost was turned over when the temperature dropped significantly, and the compost was turned over 3 times in total. When the temperature no longer increased significantly, the organic fertilizer was obtained after 10 days of decomposition; its various properties are shown in Table 1;

[0050] The preparation method of the Bacillus agent is shown in Example 2.

[0051] Comparative Example 3:

[0052] Pig manure and straw were mixed at a weight ratio of 1:3, the carbon-nitrogen ratio was adjusted to 25:1, and Bacillus brevis was added at the same time, the inoculation amount was 3% by weight, the moisture content was adjusted to 60%, the temperature and moisture content were monitored regularly, and the temperature was maintained at 60°C; water was added to keep the moisture content of the compost at about 60%, and the compost was turned over when the temperature dropped significantly, and the compost was turned over 3 times in total. When the temperature no longer increased significantly, the organic fertilizer was obtained after 10 days of decomposition; its various properties are shown in Table 1;

[0053] The preparation method of the Bacillus brevis inoculant is shown in Example 3.

[0054] Comparative Example 4:

[0055] Pig manure and straw were mixed at a weight ratio of 1:3, the carbon-nitrogen ratio was adjusted to 25:1, and a composite microbial agent was added at a weight ratio of 3%. The water content was adjusted to 60%, and the temperature and water content were regularly monitored to maintain the temperature at 60°C. Water was added to maintain the water content of the compost at about 60%, and the compost was turned over when the temperature dropped significantly. The compost was turned over 3 times in total. After the temperature no longer increased significantly, the organic fertilizer was obtained after 10 days of decomposition. The properties of the organic fertilizer are shown in Table 1. The preparation method of the composite microbial agent is shown in Example 4.

[0056] Table 1

[0057]

[0058] The screening and identification process of the elongated lysine Bacillus, Bacillus and Bacillus brevis used in the present invention is as follows:

[0059] 1. Initial screening of strains (high temperature enrichment and high temperature culture)

[0060] Take 10g of fecal sample from the composting process of livestock and poultry feces, put it into a 250mL conical flask filled with 100mL sterile saline under sterile conditions; activate and enrich it in a constant temperature shaking incubator at 50℃ and 150r / min for 24h;

[0061] The activated bacterial solution was diluted with sterile water in sequence until the bacterial solution was diluted to 10 -5 , 10 -6 , 10 -7Three gradients. Take 100 μL of the dilution respectively and add it dropwise to the screening medium (sodium carboxymethyl cellulose CMC-Na 5.0g, ammonium sulfate (NH4)2SO4 2.0g, dipotassium hydrogen phosphate K2HPO4 1.0g, magnesium sulfate heptahydrate MgSO4·7H2O 0.5g, sodium chloride NaCl 0.5g, ferrous sulfate heptahydrate FeSO4·7H2O 0.1g, agar powder 20g, pH 7.0-7.2. After dissolving the above substances, dilute to 1000mL with distilled water. Sterilize at 121℃, 0.1Mpa for 20min), spread evenly, wait for the bacterial solution to dry and fix, put the plate upside down in a constant temperature incubator, and culture at 50℃ for 72h.

[0062] Pick a large and obvious single colony, repeatedly streak it on the plate for isolation and purification, and observe it under Gram staining and electron microscope until there are no foreign bacteria. Take the isolated and purified colony and inoculate it on the screening medium plate at 30℃ and culture it for 72h. After the colony grows, stain it with Congo red for 0.5h, then soak it in 1mol / L sterile saline for 0.5h, and evaluate the enzyme production capacity of the strain based on the diameter of the transparent hydrolysis circle produced by the colony. Generally speaking, the larger the hydrolysis circle, the stronger the enzyme production capacity of the strain (such as Figure 1 ). The obtained strain was mixed with 0.7 mL bacterial solution and 0.3 mL glycerol and stored in a -80°C refrigerator for later use.

[0063] 2. Rescreening of strains (carboxymethyl cellulase activity assay)

[0064] The cellulose-degrading bacteria obtained by the primary screening were inoculated into the fermentation medium (sodium carboxymethyl cellulose CMC-Na 10.0g, ammonium sulfate (NH4)2SO4 2.0g, dipotassium hydrogen phosphate K2HPO4 1.0g, magnesium sulfate heptahydrate MgSO4·7H2O 0.5g, sodium chloride NaCl 0.5g, ferrous sulfate heptahydrate FeSO4·7H2O 0.1g, agar powder 20g, pH 7.0-7.2. After dissolving the above substances, dilute to 1000mL with distilled water. Sterilize at 121°C, 0.1Mpa for 20min), and cultured in a constant temperature shaking incubator at 30°C and 150r / min for 72h. The activity of carboxymethyl cellulase (CMCase) was determined, and the strain with higher enzyme activity was selected as the target strain. The specific steps are as follows:

[0065] 1. Drawing of glucose standard curve

[0066] Take 7 washed and dried 10mL colorimetric tubes, add 2mL of glucose-citrate mixture of 0, 0.04, 0.08, 0.12, 0.16, 0.20, 0.40mg / mL respectively. Then add 1.5mL of DNS reagent, boil in water bath for 10min, rinse with running water, cool, add 1.5mL of distilled water to 5mL, adjust the colorimetric tube to zero at 540nm wavelength with glucose concentration of 0, and measure the absorbance of different glucose concentrations ( Figure 2 ).

[0067] 2. Preparation of crude enzyme solution

[0068] Take 10 mL of fermentation liquid, place it in a clean and dried 50 mL centrifuge tube, centrifuge it at 5000 r / min for 5 min at 4°C, and aspirate the supernatant as the crude enzyme solution.

[0069] 3. Determination of enzyme activity

[0070] The enzyme activity of the fermentation broth was determined by the 3,5-dinitrosalicylic acid colorimetric method. The crude enzyme solution degraded cellulose to produce reducing sugars. The reducing sugars could reduce the nitro group of 3,5-dinitrosalicylic acid to amino groups to generate new amino compounds, and a color reaction occurred that turned the solution yellow. Under certain reducing sugar concentration conditions, the color depth of the mixed solution increased with the increase of reducing sugar concentration, that is, the size of the enzyme activity was positively correlated with the degree of color reaction.

[0071] CMCase activity assay: Take 4 sterilized and dried 10mL colorimetric tubes and number them. Add 1.5mL of citric acid buffer to tube 0 as a blank sample, and add 1.5mL of 1.0% CMC-Na solution to the other three colorimetric tubes. Add 0.5mL of crude enzyme solution to each of the 4 colorimetric tubes, and bathe in 50℃ for 30min. After the bath, add 1.5mL of DNS reagent and bathe in boiling water for 10min. Rinse with tap water and cool quickly. Add 1.5mL of distilled water. Measure its absorbance at a wavelength of 540nm (Table 2).

[0072] Table 2

[0073] Strain number CMCase / U 1# 25.573 2# 12.345 3# 26.692 4# 20.694 5# 27.742 6# 17.807 7# 10.869 8# 16.937 9# 18.165 10# 11.609

[0074] 3. Molecular identification of strains

[0075] The 1#, 3# and 5# strains with high enzyme activity were selected for sequencing and identification. The colony DNA was extracted by the kit method, and 27F (GAGAGTTTGATCCTGGCTCAG) and 1492R (TACGGCTACCTTGTTACGAC) were used as forward and reverse primers for PCR amplification. After electrophoresis, the three strains had amplified bands at about 1500bp. The sequence of the 1# strain is shown in SEQ ID NO.3; the sequence of the 3# strain is shown in SEQ ID NO.1; the sequence of the 5# strain is shown in SEQ ID NO.2; the sequencing results were spliced ​​with ContigExpress, and the inaccurate parts at both ends were removed; the spliced ​​sequences were compared in the NCBI database (blast.ncbi.nlm.nih.gov), 1# strain: Brevibacillus sp.; 3# strain: Lysinibacillus macroides; 5# strain: Bacillus sp.

[0076] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the examples shown and described herein.

Claims

1. A method for preparing organic fertilizer by deep fermentation of livestock and poultry manure and straw, characterized in that: The following steps are involved: Step 1: mix livestock and poultry manure and straw at a weight ratio of 1:3, adjust the carbon-nitrogen ratio to 25:1, and simultaneously add microbial agents at an inoculation amount of 3% by weight and adjust the water content to 60% to obtain pre-fermented materials; Step 2: adding the pre-fermented material into an intelligent closed high-temperature aerobic fermentation tank, and after fermentation begins, stirring and fermenting for 5 to 16 days at a fermentation temperature of 60 to 70° C. under the condition that a blower provides oxygen; and granulating the fermented product to obtain organic fertilizer; The bacteria in the microbial inoculant are a mixture of Bacillus elongatus, Bacillus subtilis and Bacillus brevis; The classification name of the elongated lysinibacillus is Lysinibacillus macroides SWUST-1, which has been registered and deposited in the General Microbiology Center of the China National Microbiological Culture Collection on May 12, 2022, with a deposit number of CGMCC No.M24857; the classification name of the bacillus is Bacillus sp. SWUST-3, which has been registered and deposited in the General Microbiology Center of the China National Microbiological Culture Collection on May 12, 2022, with a deposit number of CGMCC No.M 24858; the classification name of the brevibacillus is Brevibacillus sp. SWUST-2, which has been registered and deposited in the General Microbiology Center of the China National Microbiological Culture Collection on May 12, 2022, with a deposit number of CGMCC No.M24859; The DNA gene sequence of the elongated lysine bacillus (Lysinibacillus macroides SWUST-1) is shown in SEQ ID NO.1; The DNA gene sequence of the Bacillus sp. SWUST-3 is shown in SEQ ID NO.2; The DNA gene sequence of Brevibacillus sp. SWUST-2 is shown in SEQ ID NO.

3.

2. The method for preparing organic fertilizer by deep fermentation of livestock and poultry manure and straw as claimed in claim 1, characterized in that: The livestock and poultry manure is one or more of pig manure, cow manure, chicken manure and duck manure.

3. The method for preparing organic fertilizer by deep fermentation of livestock and poultry manure and straw as claimed in claim 1, characterized in that: The elongated lysine bacillus adopts the elongated lysine bacillus secondary seed liquid, and the preparation method thereof is as follows: using an inoculation loop to pick two loops of elongated lysine bacillus (Lysinibacillus macroides SWUST-1) slant seeds in a 250mL triangular flask filled with 50mL nutrient broth medium, culturing at 37°C, 150r / min, for 18h to obtain the elongated lysine bacillus primary seed liquid; inoculating the lysine bacillus primary seed liquid in 250mL optimized culture medium at an inoculation amount of 3% (v / v), culturing at 37°C, 150r / min, and shaking the flask for 30h to obtain the elongated lysine bacillus secondary seed liquid; The bacillus adopts a secondary seed liquid of bacillus, and the preparation method thereof is as follows: using an inoculation loop to pick two rings of bacillus (Bacillus sp. SWUST-3) slant seeds and placing them in a 250mL triangular flask filled with 50mL nutrient broth medium, culturing at 37°C, 150r / min, for 18h to obtain a primary seed liquid of bacillus; inoculating the primary seed liquid of bacillus in 250mL nutrient broth medium at an inoculation amount of 6% (v / v), culturing at 37°C, 150r / min, and shaking the flask for 30h to obtain a secondary seed liquid of bacillus The Brevibacillus sp. adopts Brevibacillus sp. secondary seed liquid, and the preparation method thereof is as follows: using an inoculation loop to pick two rings of Brevibacillus sp. SWUST-2 slant seeds into a 250 mL conical flask filled with 50 mL nutrient broth medium, culturing at 37° C., 150 r / min, for 18 hours to obtain Brevibacillus sp. primary seed liquid; The primary seed solution of Bacillus brevis was inoculated into 250 mL of nutrient broth medium at an inoculum amount of 6% (v / v), and cultured in a shaking flask at 37° C. and 150 r / min for 30 h to obtain the secondary seed solution of Bacillus brevis.

4. The method for preparing organic fertilizer by deep fermentation of livestock and poultry manure and straw as claimed in claim 3, characterized in that: The composition of the optimized culture medium is: CMC-Na 5.0g, (NH4)2SO4 2.0g, K2HPO4 1.0g, MgSO4·7H2O 0.5g, NaCl 0.5g, FeSO4·7H2O 0.1g, distilled water 1000mL, pH value 7.0-7.

2.

5. The method for preparing organic fertilizer by deep fermentation of livestock and poultry manure and straw as claimed in claim 3, characterized in that: When the bacteria in the microbial agent are a mixture of Bacillus elongatus, Bacillus and Bacillus brevis, the secondary seed liquid of Bacillus elongatus, the secondary seed liquid of Bacillus brevis and the secondary seed liquid of Bacillus brevis are combined in a ratio of 1-1.5:2:2 to obtain a microbial composite agent; the total colony count of the composite agent reaches 2.5×10 9 CFU / mL.

Images