CRISPR-dCas9-based gene-targeted demethylation methods and their applications

By designing lentiviral infection technology using sgRNA and fusion proteins, precise demethylation of specific genes in esophageal cancer cells was achieved, solving the problem of lack of gene targeting in existing drugs, restoring gene function, significantly inhibiting the proliferation of esophageal cancer cells and slowing tumor growth.

CN115960900BActive Publication Date: 2026-04-03SUN YAT SEN UNIVERSITY CANCER CENTER (CANCER HOSPITAL AFFILIATED TO SUN YAT SEN UNIVERSITY CANCER RESEARCH INSTITUTE OF SUN YAT SEN UNIVERSITY)
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-16
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

Existing DNA methylation drugs lack gene targeting, resulting in unsatisfactory efficacy and questionable safety in the treatment of esophageal squamous cell carcinoma. They are also difficult to precisely reverse gene expression silencing caused by promoter hypermethylation modification.

Method used

We designed sgRNA and fusion proteins, and used lentiviruses to infect cells to precisely demethylate the target genomic DNA using demethylation functional elements. Combined with drug screening, we achieved targeted demethylation.

Benefits of technology

It achieved stable demethylation of specific genes, restored gene function, significantly inhibited the proliferation of esophageal cancer cells, and slowed tumor growth in mouse models, providing a more reliable treatment option.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115960900B_ABST
    Figure CN115960900B_ABST
Patent Text Reader

Abstract

This invention provides a system for gene-targeted demethylation and its applications. By designing sgRNA and vectors capable of expressing both localizing and demethylating functional elements, and through lentiviral cell infection in conjunction with drug screening, the localizing functional elements, guided by the sgRNA, recognize target genomic DNA. The demethylating functional elements then demethylate the target genomic DNA, providing a precise epigenetic editing technology that reverses gene expression silencing caused by promoter hypermethylation, restores normal gene function, and regulates epigenetic modifications. This offers more treatment options for diseases caused by abnormal epigenetic modifications.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to a system for gene-targeted demethylation and its application. Background Technology

[0002] DNA methylation plays a crucial role in the development and progression of esophageal squamous cell carcinoma (ESCC), and many aberrantly methylated genes have been reported as diagnostic and prognostic biomarkers for ESCC patients. Because DNA methylation is reversible, it holds significant potential in the treatment of ESCC. Clinicians primarily use DNA methyltransferase inhibitors (DNMTis) to treat cancer patients with abnormal DNA methylation. Commonly used clinical drugs include azacitidine and decitabine, which can reverse the silencing of tumor suppressor gene expression by inhibiting DNA methylation, thus exhibiting good tumor suppression effects. They have shown some efficacy in the treatment of hematological malignancies, but acquired resistance is common, and their effectiveness in the treatment of solid tumors is not ideal. These drugs only target and inhibit DNA methyltransferases, lacking gene targeting and unable to target specific genes. They may disrupt the normally normal methylation state and transcription levels of other genes; therefore, the efficacy and safety of these drugs require further investigation.

[0003] CRISPR-Cas9 is a versatile and efficient technology for precise editing of specific sites on the genome. Guided by sgRNA within the cell, the Cas9 endonuclease protein recognizes target genomic DNA through base pairing and cleaves the DNA between 3-4 bases upstream of the NGG sequence using its active domain, resulting in double-strand break (DSB). The broken DNA can be repaired through non-homologous end joining or homologous recombination, thus achieving targeted gene knockout. The LentiCRISPR plasmid, developed by Feng Zhang of the Broad Institute based on CRISPR-Cas9 technology, is a plasmid suitable for lentiviral packaging. Its advantages include: 1. Stable knockout of targeted genes can be achieved through lentiviral infection of cells; 2. Successfully infected cells can be screened for drugs, making the process convenient and easy to perform. The dCas9 (nuclease “dead” Cas9) protein is a mutant of the Cas9 protein, specifically, the RuvC1 and HNH nuclease activity regions of the Cas9 endonuclease are simultaneously mutated, causing it to lose its DNA cleavage activity. Therefore, the dCas9 protein completely loses its endonuclease activity, retaining only its ability to be guided into the genome by gRNA. Tet1CD is the smallest functional unit capable of DNA demethylation. By using the LentiCRISPR plasmid, the Cas9 protein was further modified by removing its nuclease activity from the CRISPR / Cas9 base, creating dCas9. This dCas9 was then ligated to Tet1CD to form the fusion protein dCas9-Tet1CD, enabling targeted DNA demethylation guided by intracellular sgRNA.

[0004] Therefore, it is necessary to provide a precise epigenetic editing technology to reverse gene expression silencing caused by promoter hypermethylation modification, restore normal gene function, regulate the way epigenetic modifications are made, and provide more options for the treatment of esophageal squamous cell carcinoma. Summary of the Invention

[0005] In view of this, the present invention designs sgRNA and vectors that can express localization and demethylation functional elements. By infecting cells with lentiviruses and combining drug screening, the localization functional elements, guided by sgRNA, recognize target genomic DNA, and then the demethylation functional elements are used to demethylate the target genomic DNA. This provides a precise epigenetic editing technology that reverses gene expression silencing caused by promoter hypermethylation modification, restores normal gene function, and regulates the mode of epigenetic modification, providing more options for the treatment of diseases caused by abnormal epigenetic modification.

[0006] A first aspect of the present invention provides sgRNAs for gene-targeted demethylation, including sgZNF154-1, sgZNF154-2 and / or

[0007] sgZNF154-3; wherein sgZNF154-1 includes the forward sequence as shown in SEQ ID NO:13 and the reverse sequence as shown in SEQ ID NO:14, sgZNF154-2 includes the forward sequence as shown in SEQ ID NO:15 and the reverse sequence as shown in SEQ ID NO:16, and sgZNF154-3 includes the forward sequence as shown in SEQ ID NO:17 and the reverse sequence as shown in SEQ ID NO:18.

[0008] A second aspect of the present invention provides a complex for gene-targeted demethylation, which is mainly formed by the interaction of sgRNA and fusion protein as described in the first aspect of the present invention, wherein the fusion protein includes a localization functional element and a demethylation functional element.

[0009] In one embodiment of the present invention, the positioning functional element has the function of targeting and binding DNA but has no catalytic activity, including Cas protein, zinc finger protein or TALENs protein, or their functional domains, or combinations thereof.

[0010] In a preferred embodiment of the present invention, the positioning functional element includes dCas9, dCpf1, dCas12, dCas13, dCms1, dMAD7, or their functional domains, or combinations thereof.

[0011] In a preferred embodiment of the present invention, the positioning functional element includes dCas9 or its functional domain.

[0012] In one embodiment of the present invention, the demethylation functional element has the function of converting methylated cytosine into unmethylated cytosine, including ROS1, TET, DME, DML, or a combination thereof.

[0013] In a preferred embodiment of the present invention, the positioning functional element includes Tet1, Tet2, Tet3 or their functional domains, or a combination thereof.

[0014] In a preferred embodiment of the present invention, the positioning functional element includes Tet1 or its functional domain.

[0015] In one embodiment of the present invention, the positioning functional element and the demethylation functional element are connected by one or more of the following components: peptide bond, linker peptide, nuclear positioning signal, epitope tag, or combination thereof.

[0016] A third aspect of the present invention provides a vector for gene-targeted demethylation, comprising sgRNA as described in the first aspect of the present invention and a nucleic acid sequence encoding a fusion protein as described in the second aspect of the present invention.

[0017] In one embodiment of the present invention, the nucleic acid sequence encoding the fusion protein is shown in SEQ ID NO:29.

[0018] A fourth aspect of the present invention provides host cells for gene-targeted demethylation, comprising sgRNA as described in the first aspect of the present invention, a complex as described in the second aspect of the present invention, and / or a vector as described in the third aspect of the present invention.

[0019] The fifth aspect of this invention provides a demethylation method for gene targeting, comprising the following steps:

[0020] 1) Design candidate sgRNAs targeting the ZNF154 promoter region;

[0021] 2) Link the sgRNA obtained in step 1) to the nucleic acid sequence encoding the fusion protein as described in the second aspect of the present invention, and construct a vector targeting the demethylation of the ZNF154 promoter;

[0022] 3) Package host cells containing the vector obtained in step 2);

[0023] 4) Add the host cells obtained in step 3) to esophageal cancer cells, and screen for drugs to obtain cells that have been successfully demethylated;

[0024] 5) Screen and verify vectors or vector combinations with good demethylation effects.

[0025] In one embodiment of the present invention, the nucleic acid sequence encoding the fusion protein in step 2) is shown in SEQ ID NO:29.

[0026] In one embodiment of the present invention, the host cell in step 3) is a 293T cell.

[0027] In one embodiment of the present invention, the esophageal cancer cells in step 4) are Kyse30 cells.

[0028] In one embodiment of the present invention, the drug in step 4) is puromycin.

[0029] In one embodiment of the present invention, step 5) of the screening and verification includes: a) digital PCR detection of the methylation rate of the ZNF154 promoter, b) qPCR detection of the mRNA level of ZNF154, and c) CCK8 cell proliferation assay to verify the inhibitory effect of the vector or vector combination on the proliferation of Kyse30 cells.

[0030] The sixth aspect of the present invention provides the use of sgRNA as described in the first aspect of the present invention, complex as described in the second aspect of the present invention, and / or host cell as described in the third aspect of the present invention, host cell as described in the fourth aspect of the present invention, and / or method as described in the fifth aspect of the present invention in the demethylation modification of target nucleic acid.

[0031] The seventh aspect of the present invention provides the use of sgRNA as described in the first aspect of the present invention, complexes as described in the second aspect of the present invention, and / or host cells as described in the third aspect of the present invention, host cells as described in the fourth aspect of the present invention, and / or methods as described in the fifth aspect of the present invention in the preparation of a kit for demethylating target nucleic acids.

[0032] The beneficial effects of this invention are as follows:

[0033] 1) This invention designs sgRNA and vectors that can express localization and demethylation functional elements. The localization functional elements guided by sgRNA recognize target genomic DNA, and the demethylation functional elements are used to demethylate the target genomic DNA, thereby accurately and effectively achieving stable demethylation of target genomic DNA.

[0034] 2) This invention introduces LentiCRISPR plasmids that can be used for lentiviral packaging, and achieves stable knockout of targeted genes by infecting cells with lentiviruses. Cells that are successfully infected by the virus can be screened with drugs, which is convenient and easy to operate.

[0035] 3) It can precisely demethylate the ZNF154 promoter, exhibiting good demethylation effect and effectively inhibiting the proliferation of esophageal cancer Kyse30 cells: This invention screened and verified the pLentiCRISPR-dCas9-Tet1CD-sgZNF154-1 vector and the pLentiCRISPR-dCas9-Tet1CD-sgZNF154-1 / 2 / 3 vector combination with good demethylation effect through systematic experiments such as digital PCR detection of ZNF154 promoter methylation rate, qPCR detection of ZNF154 mRNA level, and CCK8 cell proliferation experiment. Among them, after demethylating Kyse30 cells with the sgZNF154-1 / 2 / 3 combination, the methylation rate of ZNF154 promoter was reduced by 8% compared with the control group, and the ZNF154 mRNA level was upregulated by 20 times compared with the control group. Subcutaneous tumorigenesis experiments in mice showed that Kyse30 cells treated with the sgZNF154-1 / 2 / 3 combination for demethylation had a significantly slower growth rate compared to the control group. The methylation rate of the ZNF154 promoter was downregulated by about 10%-20% compared to the control group, and the mRNA level of ZNF154 was upregulated by about 200 times compared to the control group. Attached Figure Description

[0036] Figure 1 A schematic diagram illustrating the construction of plasmid pLentiCRISPR-dCas9-Tet1CD provided in an embodiment of the present invention;

[0037] Figure 2 A structural diagram of the sequence of plasmid pLentiCRISPR-dCas9-Tet1CD provided in an embodiment of the present invention;

[0038] Figure 3 This is a schematic diagram showing the positions of the eight sgRNAs in the ZNF154 promoter region provided in an embodiment of the present invention;

[0039] Figure 4 The image shows the results of digital PCR detection of the methylation rate of the ZNF154 promoter after demethylation treatment of the eight plasmids provided in this embodiment of the invention;

[0040] Figure 5 The following is a graph showing the results of qPCR detection of ZNF154 mRNA expression levels after demethylation of the ZNF154 promoter by the eight plasmids provided in this embodiment of the invention.

[0041] Figure 6Figure 1 shows the effect of demethylating Kyse30 cells with plasmid pLentiCRISPR-dCas9-Tet1CD-sgZNF154-1 alone, as provided in this embodiment of the invention, on their proliferation.

[0042] Figure 7 The figure shows the effect of demethylation of the plasmid pLentiCRISPR-dCas9-Tet1CD-sgZNF154-1 / 2 / 3 combination provided in this embodiment of the invention on the proliferation of Kyse30 cells.

[0043] Figure 8 The figure shows the results of digital PCR detection of the methylation rate of the ZNF154 promoter after demethylation treatment of Kyse30 cells with the plasmid pLentiCRISPR-dCas9-Tet1CD-sgZNF154-1 / 2 / 3 combination provided in the embodiments of the present invention.

[0044] Figure 9 The image shows the results of qPCR detection of ZNF154 mRNA expression level after demethylation treatment of Kyse30 cells with the plasmid pLentiCRISPR-dCas9-Tet1CD-sgZNF154-1 / 2 / 3 provided in this embodiment of the invention.

[0045] Figure 10 The figure shows the results of digital PCR detection of the methylation rate of the ZNF154 promoter after demethylation treatment of Kyse30 cells with a DNA methyltransferase inhibitor, as provided in this embodiment of the invention.

[0046] Figure 11 The figure shows the results of qPCR detection of ZNF154 mRNA expression level after demethylation treatment of Kyse30 cells with DNA methyltransferase inhibitor provided in this embodiment of the invention.

[0047] Figure 12 This is a photograph and weighing result of subcutaneous tumors in mice after subcutaneous injection of demethylated cells Kyse30, provided in an embodiment of the present invention.

[0048] Figure 13 The image shows the results of digital PCR detection of the methylation rate of the ZNF154 promoter in subcutaneous tumors after subcutaneous injection of demethylated cells Kyse30 into mice, as provided in an embodiment of the present invention.

[0049] Figure 14 The image shows the results of qPCR detection of ZNF154 mRNA expression level in subcutaneous tumors after injecting demethylated cells (Kyse30) into mice, as provided in this embodiment of the invention. Detailed Implementation

[0050] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer.

[0051] This invention designs sgRNA and vectors that can express localization and demethylation functional elements. By infecting cells with lentiviruses and combining this with drug screening, the localization functional elements, guided by sgRNA, recognize target genomic DNA, and then the demethylation functional elements demethylate the target genomic DNA. This provides a precise epigenetic editing technology that reverses gene expression silencing caused by promoter hypermethylation modification, restores normal gene function, and regulates the mode of epigenetic modification, providing more options for the treatment of diseases caused by abnormal epigenetic modification.

[0052] The sgRNAs in the gene-targeted demethylation system provided by this invention include sgZNF154-1, sgZNF154-2, and / or

[0053] sgZNF154-3; wherein sgZNF154-1 includes the forward sequence as shown in SEQ ID NO:13 and the reverse sequence as shown in SEQ ID NO:14, sgZNF154-2 includes the forward sequence as shown in SEQ ID NO:15 and the reverse sequence as shown in SEQ ID NO:16, and sgZNF154-3 includes the forward sequence as shown in SEQ ID NO:17 and the reverse sequence as shown in SEQ ID NO:18.

[0054] The complex in the gene-targeted demethylation system provided by the present invention is mainly formed by the interaction of ZNF154-targeting sgRNA and fusion protein. The ZNF154-targeting sgRNA includes the aforementioned sgZNF154-1, sgZNF154-2 and / or sgZNF154-3, and the fusion protein includes a localization functional element and a demethylation functional element.

[0055] Preferably, the positioning functional element has the function of targeting and binding DNA but has no catalytic activity, including Cas protein, zinc finger protein or TALENs protein, or their functional domains, or combinations thereof.

[0056] More preferably, the positioning functional element includes dCas9, dCpf1, dCas12, dCas13, dCms1, dMAD7, or their functional domains, or combinations thereof.

[0057] More preferably, the positioning functional element includes dCas9 or its functional domain.

[0058] Preferably, the demethylating functional element has the function of converting methylated cytosine into unmethylated cytosine, including ROS1, TET, DME, DML, or a combination thereof.

[0059] More preferably, the positioning functional element includes Tet1, Tet2, Tet3 or their functional domains, or a combination thereof.

[0060] More preferably, the positioning functional element includes Tet1 or its functional domain.

[0061] Preferably, the positioning functional element and the demethylation functional element are connected by one or more of the following components: peptide bond, linker peptide, nuclear positioning signal, epitope tag, or a combination thereof.

[0062] The vector in the gene-targeted demethylation system provided by the present invention includes a ZNF154-targeting sgRNA and a nucleic acid sequence encoding a fusion protein, wherein the ZNF154-targeting sgRNA includes the aforementioned sgZNF154-1, sgZNF154-2 and / or sgZNF154-3.

[0063] Preferably, the nucleic acid sequence encoding the fusion protein is shown in SEQ ID NO:29.

[0064] The host cell in the gene-targeted demethylation system provided by the present invention includes the aforementioned sgRNA, complex and / or vector targeting ZNF154.

[0065] The demethylation method of the gene-targeted demethylation system provided by this invention includes the following steps:

[0066] 1) Design candidate sgRNAs targeting the ZNF154 promoter region;

[0067] 2) Link the sgRNA obtained in step 1) to the nucleic acid sequence encoding the fusion protein as described in the second aspect of the present invention, and construct a vector targeting the demethylation of the ZNF154 promoter;

[0068] 3) Package host cells containing the vector obtained in step 2);

[0069] 4) Add the host cells obtained in step 3) to esophageal cancer cells, and screen for drugs to obtain cells that have been successfully demethylated;

[0070] 5) Screen and verify vectors or vector combinations with good demethylation effects.

[0071] Preferably, the nucleic acid sequence encoding the fusion protein in step 2) is shown in SEQ ID NO:29.

[0072] Preferably, the host cell in step 3) is a 293T cell.

[0073] Preferably, the esophageal cancer cells in step 4) are Kyse30 cells.

[0074] Preferably, the drug in step 4) is puromycin.

[0075] Preferably, the screening and verification in step 5) includes: a) digital PCR detection of the methylation rate of the ZNF154 promoter, b) qPCR detection of the mRNA level of ZNF154, and c) CCK8 cell proliferation assay to verify the inhibitory effect of the vector or vector combination on the proliferation of Kyse30 cells.

[0076] To more clearly demonstrate the technical solution of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0077] Example 1: Construction of plasmid LentiCRISPR-dCas9-Tet1CD

[0078] 1. PCR primers were designed for the Cas9-free nucleic acid sequence on the LentiCRISPR plasmid (Zhang Lab, pXPR_001) and the dCas9-Tet1CD nucleic acid sequence on the pdCas9-Tet1-CD plasmid (Addgene, plasmid#83340). Homologous arms were added to each primer, and PCR amplification was performed according to the PCR primer sequences, reaction systems, and reaction procedures shown in Tables 1, 2, and 3.

[0079] Table 1. PCR primer sequences (including homologous arms)

[0080]

[0081] Table 2 PCR reaction system

[0082] Template plasmid 20ng Upstream primer (10 μM) 1μL Downstream primer (10 μM) 1μL PrimeSTAR Mix (2x) 20μL Deionized water to 40μL

[0083] Table 3 PCR Procedure

[0084]

[0085] 2. Perform in vitro homologous recombination on the PCR purified product obtained in step 1 using homologous recombination enzymes (e.g., ...). Figure 1 (As shown in the figure), the reaction system for transformation and in vitro homologous recombination is shown in Table 4.

[0086] Table 4. Reaction system for in vitro homologous recombination

[0087]

[0088]

[0089] Note: X and Y are calculated as follows:

[0090] 1) 50–100 ng of carrier corresponds to twice the amount of inserted fragment;

[0091] 2)pmols=(weight in ng)x 1,000 / (base pairs x 650daltons)

[0092] 3) Volume (μL) = Mass / Concentration

[0093] Bacterial transformation was performed by incubation at 37°C for 30 minutes. Single clones were picked and sequenced. After amplification, plasmids were extracted using the Tiangen plasmid extraction kit and named LentiCRISPR-dCas9-Tet1CD. Its sequence map is shown below. Figure 2 As shown.

[0094] Example 2: Construction of the demethylated plasmid pLentiCRISPR-dCas9-Tet1CD-sgZNF154 targeting the ZNF154 promoter

[0095] 1. Eight candidate sequences targeting the ZNF154 promoter region were designed based on the target gene sequence, as follows: AGGTTGGTGCAAAGGGTCCC (SEQ ID NO:5), AGCTTCGCTTTTACTCCAAG (SEQ ID NO:6), GACCCTTTGCACCAACCTCT (SEQ ID NO:7), TGTAGTTTTCATAGATCCCG (SEQ ID NO:8), TGGAGTAAAAGCGAAGCTCC (SEQ ID NO:9), GGAGTAAAAGCGAAGCTCCA (SEQ ID NO:10), TCGCTTTTACTCCAAGAGGT (SEQ ID NO:11), and AATGGCTTATCCAAGTCCTA (SEQ ID NO:12). Sticky ends for ligation reaction were added to the above eight candidate sequences to synthesize Cas9 sgRNA sequences, as shown in Table 5.

[0096] Table 5. Cas9 sgRNA sequences targeting the ZNF154 promoter region.

[0097]

[0098]

[0099] 2. Annealing single-stranded sgRNA to form double-stranded sgRNA

[0100] The DNA sequences shown in SEQ ID NO:13 and SEQ ID NO:14, SEQ ID NO:15 and SEQ ID NO:16, SEQ ID NO:17 and SEQ ID NO:18, SEQ ID NO:19 and SEQ ID NO:20, SEQ ID NO:21 and SEQ ID NO:22, SEQ ID NO:23 and SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26, SEQ ID NO:27 and SEQ ID NO:28 were dissolved in deionized water to achieve a final concentration of 10 μM for each sgRNA sequence. The PCR program was as follows: 37℃ for 30 min, 95℃ for 5 min, then decreasing the temperature by 5℃ per minute until reaching 25℃, yielding 8 double-stranded sgRNAs, labeled sgZNF154-1, sgZNF154-2, sgZNF154-3, sgZNF154-4, sgZNF154-5, sgZNF154-6, sgZNF154-7, and sgZNF154-8. The positions of the 8 sgRNAs in the ZNF154 promoter region are as follows: Figure 3 As shown in Table 6.

[0101] Table 6. Double-stranded sgRNA synthesis system

[0102] sgZNF154-sense 4.25μL sgZNF154-antisense 4.25μL T4 PNK 0.5μL 10×T4 PNK Buffer 1μL

[0103] 3. Enzyme digestion of LentiCRISPR-dCas9-Tet1CD

[0104] LentiCRISPR-dCas9-Tet1CD was digested with BsmBI, and the digestion system is shown in Table 7.

[0105] Table 7. BsmBI Enzyme Digestion Reaction System

[0106] LentiCRISPR plasmid 5μg FastDigest BsmBI 3μL FastAP 3μL 10×FastDigest Buffer 6μL water to 60μL

[0107] The reaction conditions were 37℃ for 4-5 hours to obtain the enzyme digestion product. Agarose gel electrophoresis was performed, and bands longer than 10000 bp were collected. The product was then recovered using a TIANGEN DNA purification kit and dissolved in 30 μL of deionized water. The product was labeled pLentiCRISPR-dCas9-Tet1CD, and its nucleic acid sequence is shown in SEQ ID NO:29.

[0108] 4. Construct plasmid pLentiCRISPR-dCas9-Tet1CD-sgZNF154

[0109] The products from steps 2 and 3 were ligated using a rapid ligase kit. The reaction system is shown in Table 8.

[0110] Table 8 Connection Reaction System

[0111] pLentiCRISPR-dCas9-Tet1CD 50ng sgZNF154 1μL 2×Quick Ligase Buffer 5μL Quick Ligase 1μL Deionized water to 11μL

[0112] The reaction was carried out at room temperature for 15 minutes. Then, *E. coli* was transformed, plated, single clones were picked, and sequenced. The successfully sequenced plasmid was pLentiCRISPR-dCas9-Tet1CD-sgZNF154.

[0113] Example 3: Demethylation of the ZNF154 promoter in Kyse30 cells

[0114] 1. Packaged lentivirus containing plasmid pLentiCRISPR-dCas9-Tet1CD-sgZNF154

[0115] Eight demethylated plasmids, pLentiCRISPR-dCas9-Tet1CD-sgZNF154 (1 μg), were incubated at 25°C for 20 min with helper plasmids PXPAX2 (2 μg), PMD.2G (1 μg), X-treme transfection reagent (20 μL), and opti-MEM (500 μL), respectively. The incubator was then added to 293T cells (5 ml of 10% fetal bovine serum DMEM). After 14 h, the medium was replaced with 5% fetal bovine serum DMEM, and the cells were incubated for 48 h. The supernatant was collected, centrifuged at 500 g for 10 min, and filtered through a 0.45 μm filter to obtain the viral solution.

[0116] 2. Obtaining cells that have successfully undergone demethylation

[0117] 1 ml of lentiviral solution was added to Kyse30 cells (cell confluence 50%-60%, 6-well plates, 1640:2 ml of 10% fetal bovine serum). After 12 hours, the culture medium was replaced with normal medium and cultured for 48 hours. Then, culture was continued for 72 hours with medium containing 1 μg / ml puromycin to obtain successfully transfected cells. These cells were then subjected to secondary infection and cultured in normal medium for 24 hours, followed by further culture in puromycin-containing medium for 15 to 20 days.

[0118] During this period, the methylation rate of the ZNF154 promoter was detected by digital PCR (DNA concentration diluted to 5-10 ng / μL), and the results are as follows: Figure 4 As shown, the methylation rates of the ZNF154 promoter after treatment with five sgRNAs (sgZNF154-4, sgZNF154-5, sgZNF154-6, sgZNF154-7, and sgZNF154-8) were 93%, 92%, 91%, 93%, and 97%, respectively, while the methylation rate of the control group was 93%. This indicates that these five sgRNAs had almost no demethylation effect on the ZNF154 promoter. However, the methylation rates of the ZNF154 promoter after treatment with sgZNF154-1, sgZNF154-2, and sgZNF154-3 were 79%, 88%, and 83%, respectively, indicating that sgZNF154-1, sgZNF154-2, and sgZNF154-3 could, to some extent, demethylate the ZNF154 promoter.

[0119] To further verify the demethylation effect of the above 8 sgRNAs, the mRNA level of ZNF154 was detected by qPCR, and the results are as follows: Figure 5 As shown, only sgZNF154-1 treatment resulted in a significant increase in ZNF154 mRNA levels.

[0120] Conclusion: The plasmid pLentiCRISPR-dCas9-Tet1CD-sgZNF154 can demethylate the promoter of ZNF154 to a certain extent.

[0121] Example 4: Effect of plasmid pLentiCRISPR-dCas9-Tet1CD-sgZNF154 on Kyse30 cell proliferation.

[0122] 1. CCK8 cell proliferation experiment:

[0123] (1) Take logarithmically growing cells, digest them into single cells, centrifuge, resuspend, and count them.

[0124] (2) 1000 cells were seeded into each well of a 96-well plate, with 5 replicates, and cultured for 1 week.

[0125] (3) Change the medium once during the culture period.

[0126] (4) Add 10 μL of CCK8 colorimetric solution to each well, continue culturing for 1 h, and then measure the absorbance at 450 nm using an ELISA reader.

[0127] As a result, compared with the control group (sgNC), sgZNF154-1 (sg1) alone did not significantly inhibit the proliferation of Kyse30 cells.

[0128] (like Figure 6 As shown in the figure, the combined treatment with sgZNF154-1, sgZNF154-2, and sgZNF154-3 significantly inhibited the proliferation of Kyse30 cells (as shown in the figure). Figure 7 (As shown).

[0129] Example 5: Demethylation of ZNF154 promoter in Kyse30 cells by sgZNF154-1 / 2 / 3 combination

[0130] The lentivirus containing plasmid pLentiCRISPR-dCas9-Tet1CD-sgZNF154-1 / 2 / 3 was packaged according to steps 1 and 2 of Example 3, and cells that were successfully demethylated were obtained.

[0131] The methylation rate of the ZNF154 promoter was detected by digital PCR (DNA concentration diluted to 5-10 ng / μL), and the mRNA level of ZNF154 was detected by qPCR. A control experiment was also set up, using the DNA methyltransferase inhibitor 5-aza-2'-deoxycytidine (5-aza-dC) to demethylate Kyse30 cells. The specific steps were as follows: 1) Kyse30 cells were seeded in 6-well plates at a density of 2 × 10⁵ cells / well; 2) 5-aza-2'-deoxycytidine (5-aza-dC) was added to each well to a final concentration of 2 μM; 3) The medium was changed every 2 days, and the cells were induced for 4 days. Cells were then collected and lysed for methylation and mRNA detection.

[0132] As a result, after demethylation treatment of Kyse30 cells using the sgZNF154-1 / 2 / 3 combination, the digital PCR results were as follows: Figure 8 As shown, the methylation rate of the ZNF154 promoter decreased by 8% compared to the control group. The qPCR results are as follows. Figure 9 As shown, the mRNA level of ZNF154 was upregulated 20-fold compared to the control group. After demethylation treatment of Kyse30 cells with the drug, the digital PCR results were as follows... Figure 10As shown, the methylation rate of the ZNF154 promoter decreased by 16% compared to the control group, as indicated by the qPCR results. Figure 11 As shown, the mRNA level of ZNF154 was upregulated by approximately 8000-fold compared to the control group. These results indicate that DNA methyltransferase inhibitors offer higher demethylation efficiency. However, due to their lack of gene targeting, these drugs are currently mainly used for the treatment of hematological malignancies, and their effectiveness in treating solid tumors is not ideal. This application utilizes the sgZNF154-1 / 2 / 3 combination to demethylate Kyse30 cells, employing precise epigenetic editing technology with sgRNA to reverse gene expression silencing caused by promoter hypermethylation, restoring normal gene function. This achieves stable demethylation of the targeted gene through lentiviral cell infection, and demethylated cells are obtained through drug screening, thus providing a convenient and easy-to-operate gene-targeted demethylation technology. Therefore, the plasmid pLentiCRISPR-dCas9-Tet1CD-sgZNF154-1 / 2 / 3 combination provided in this application can more accurately demethylate the ZNF154 promoter and exhibits good methylation activity.

[0133] Example 6: Application of ZNF154 promoter-stabilized demethylated Kyse30 cells in mouse functional experiments

[0134] 1. Subcutaneous tumor formation experiment in mice

[0135] Demethylated cells Kyse30 were administered at a rate of 4 × 10⁻⁶. 6 Cells / 200 μL were resuspended in serum-free culture medium or PBS and injected subcutaneously into mice. Tumor size was measured on the body surface starting on day 8 post-injection, every 3 days. Mice were dissected at days 24-28, and subcutaneous tumors were removed, photographed, weighed, and their ZNF154 promoter methylation rate and ZNF154 mRNA expression level were measured. The weighing results are shown below. Figure 12 As shown, demethylated Kyse30 cells exhibited a significantly slower growth rate compared to the control group. Digital PCR was used to detect the methylation rate of the ZNF154 promoter, and the results are as follows... Figure 13 As shown, the methylation rate of the ZNF154 promoter in demethylated cells was downregulated by approximately 10%-20% compared to the control group. qPCR was used to detect the mRNA expression level of ZNF154, and the results are as follows... Figure 14 As shown, the mRNA level of ZNF154 in demethylated cells was upregulated by about 200-fold compared to the control group.

[0136] Conclusion: The combination of plasmids pLentiCRISPR-dCas9-Tet1CD-sgZNF154-1 / 2 / 3 in mice can exhibit better demethylation of the ZNF154 promoter in Kyse30 cells.

[0137] In summary, the present invention utilizes the plasmid pLentiCRISPR-dCas9-Tet1CD-sgZNF154-1 / 2 / 3 combination, employs precise epigenetic editing technology with sgRNA, and employs lentiviral cell infection combined with drug screening to demethylate Kyse30 cells, thereby achieving accurate and stable demethylation of the target gene ZNF154, and subsequently regulating ZNF154 gene expression, providing a new approach and option for the treatment of esophageal cancer.

[0138] The above description is merely a preferred embodiment of the present invention and does not constitute any limitation on the present invention in any form or substance. Any modifications, alterations, and variations made by those skilled in the art without departing from the scope of the present invention using the disclosed technical content are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and variations made to the above embodiments based on the essential technology of the present invention are still within the scope of the present invention.

Claims

1. An sgRNA for gene-targeted demethylation, characterized in that, The sgRNA targets solid tumors of esophageal cancer, including a combination of sgZNF154-1, sgZNF154-2 and sgZNF154-3; The forward and reverse sequences of sgZNF154-1 are shown in SEQ ID NO:13 and SEQ ID NO:14, respectively; the forward and reverse sequences of sgZNF154-2 are shown in SEQ ID NO:15 and SEQ ID NO:16, respectively; and the forward and reverse sequences of sgZNF154-3 are shown in SEQ ID NO:17 and SEQ ID NO:18, respectively.

2. A complex for gene-targeted demethylation, characterized in that, The complex is mainly formed by the interaction of the sgRNA and the fusion protein as described in claim 1, wherein the fusion protein includes a localization functional element and a demethylation functional element.

3. The complex according to claim 2, characterized in that, The localization functional elements have the function of targeting and binding DNA but have no catalytic activity, including Cas proteins, zinc finger proteins or TALENs proteins, or their functional domains, or combinations thereof.

4. The complex according to claim 2, characterized in that, The demethylating functional element has the function of converting methylated cytosine into unmethylated cytosine, including ROS1, TET, DME, DML, or combinations thereof.

5. A vector for gene-targeted demethylation, characterized in that, The vector comprises the sgRNA as described in claim 1 and a nucleic acid sequence encoding the fusion protein as described in claim 2.

6. The carrier as described in claim 5, characterized in that, The nucleic acid sequence encoding the fusion protein is shown in SEQ ID NO:

29.

7. A host cell for gene-targeted demethylation, characterized in that, The host cell includes the sgRNA as described in claim 1, the complex as described in claim 2, and / or the vector as described in claim 5.

8. The application of the sgRNA as described in claim 1, the complex as described in claim 2, the vector as described in claim 5, and / or the host cell as described in claim 7 in non-disease diagnostic and therapeutic purposes during the demethylation modification of the target nucleic acid ZNF154 promoter.

9. The use of the sgRNA of claim 1, the complex of claim 2, the vector of claim 5, and / or the host cell of claim 7 in the preparation of a kit for demethylating the ZNF154 promoter, a target nucleic acid for esophageal cancer.

Citation Information

Patent Citations

  • dCas9-sgLINC00261 system for inhibiting pancreatic cancer progression, construction method and application

    CN112029801A

  • Composition for detecting esophageal cancer and kit and application thereof

    CN113528657A