Brassica rapa tolerance to bolting and flowering related gene BrAHL24, BrGLK2 and application thereof

Abstract

The application discloses a Chinese cabbage bolting and flowering resistance related gene BrAHL24, BrGLK2 and application thereof, and belongs to the technical field of biotechnology.The Chinese cabbage bolting and flowering resistance related gene is a Chinese cabbage BrAHL24a gene, a Chinese cabbage BrAHL24b gene, a Chinese cabbage BrGLK2a gene or a Chinese cabbage BrGLK2b gene.The application clones the Chinese cabbage BrAHL24 gene or the Chinese cabbage BrGLK2 gene, and identifies the function of the gene by using a transgenic mode, finds the effect of the gene on controlling bolting and flowering time of cruciferous plants, and finds that overexpression of the Chinese cabbage BrAHL24a gene, the Chinese cabbage BrAHL24b gene, the Chinese cabbage BrGLK2a gene or the Chinese cabbage BrGLK2b gene can significantly delay bolting and flowering of cruciferous plants such as Arabidopsis thaliana and Chinese cabbage, and has a good application prospect in genetic engineering breeding.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biotechnology, and particularly relates to Brassica campestris syn. B. rapa related genes BrAHL24 and BrGLK2 and application thereof. BACKGROUND

[0002] Brassica campestris syn. B. rapa belongs to Cruciferae Brassica crops, and mainly includes two groups of (Chinese) cabbage and (non-heading) Chinese cabbage, the former includes loose-leaf Chinese cabbage, semi-heading Chinese cabbage, flower heart Chinese cabbage and heading Chinese cabbage, and the latter includes (common) Chinese cabbage, flowering Chinese cabbage, purple Chinese cabbage, Chinese celery, celery, and bunching Chinese cabbage. They are not only important vegetables and oil crops, and have high economic value in production, but also have close genetic relationship with Arabidopsis thaliana, and have important research significance in plant basic science. Among them, non-heading Chinese cabbage can be produced throughout the year in China, and is favored by growers and consumers. Due to short growth cycle, high multiple cropping index, high yield, good quality and good taste, non-heading Chinese cabbage accounts for a high proportion of production and consumption in China, especially in southern China. Most of non-heading Chinese cabbage takes leaf and tender stem as edible organs during the vegetative growth period, and a few takes Chinese celery as edible organs (flowering Chinese cabbage and purple Chinese cabbage).

[0003] Heading and flowering is an important sign of annual or biennial herbaceous plants entering reproductive growth, and is affected by many endogenous factors and exogenous environmental factors. Taking Arabidopsis thaliana as an example, the flowering process is affected by photoperiod, hormones, vernalization, autonomous and age pathways, and is regulated by a series of secondary factors such as external temperature, light quality, soil salinity, sugar accumulation and plant age. Arabidopsis thaliana has a close relationship with other Cruciferae plants. The germinated seeds of Chinese cabbage can be headed and flowered after a period of low temperature treatment (vernalization process). However, due to improper variety selection, cultivation period or unsuitable cultivation environment, the substances stored in the plant vegetative organs are transferred to the reproductive organs, which promotes early heading and flowering, resulting in reduction of product yield and quality. Therefore, wintering, early spring and high mountain plateau cultivation varieties are prone to premature heading. For Chinese cabbage varieties that mainly take leaf and tender stem as food, screening of late-heading varieties with low-temperature vernalization tolerance and late development transition is the key to breeding.

[0004] In the prior art, there are many studies on the mechanism of bolting and flowering of plants. For example, the Chinese patent document with publication number CN111996200A discloses the application of Arabidopsis TGA7 gene in regulating the flowering period of plants. The Arabidopsis TGA7 gene point mutant plant delays flowering compared with the wild type plant. The Chinese patent document with publication number CN106701782A discloses the application of Arabidopsis gene SPOC1 in regulating the flowering period of plants. The invention found that the Arabidopsis plant with SPOC1 gene knocked out delays flowering compared with the wild type plant. However, the above studies are only applicable to regulating the flowering period of Arabidopsis, and it is unknown whether they can be applied to other plants.

[0005] Studies have shown that overexpression of members of the AHL family of plants can cause changes in hypocotyl length, such as Arabidopsis AHL22, which can bind to the AT-rich DNA sequence of the FT gene promoter, or recruit histone deacetylase HDA1 and HDA6, thereby changing the histone methylation level and acetylation level of FT gDNA. Golden2-like (GLK) belongs to the GARP transcription factor family, and has two functionally redundant homologous genes: GLK1 and GLK2. Due to the serious functional redundancy of the two genes, only obvious phenotypes can be observed in glk1glk2 double mutants. Overexpression of Arabidopsis GLK gene in Arabidopsis can also cause various changes, such as upward development of leaves and stress response caused by anthocyanin accumulation. At present, most of the researches on AHL family genes and GLK2 genes are concentrated in the researches on model plants (such as Arabidopsis, rice and tomato). However, there is no research on whether these two genes are involved in the bolting and flowering process of Brassica rapa. SUMMARY

[0006] The present application provides the application of Brassica rapa bolting and flowering related genes in delaying the bolting and flowering process of Brassicaceae plants. The Brassica rapa bolting and flowering related genes are Brassica rapa BrAHL24a gene, Brassica rapa BrAHL24b gene, Brassica rapa BrGLK2a gene or Brassica rapa BrGLK2b gene. Overexpression of Brassica rapa BrAHL24a gene, Brassica rapa BrAHL24b gene, Brassica rapa BrGLK2a gene or Brassica rapa BrGLK2b gene in the recipient Brassicaceae plants can delay the bolting and flowering time of the recipient plants, providing valuable resources for breeding new plant varieties.

[0007] The specific technical solutions adopted are as follows:

[0008] The application provides application of a Chinese cabbage anti- bolting and flowering related gene in delaying bolting and flowering of Brassicaceae plants.

[0009] The Chinese cabbage anti-bolting and flowering related gene is introduced into the Brassicaceae plants by an Agrobacterium-mediated method to obtain a transgenic line with overexpression of the corresponding gene, and it is found that changes in expression of the Chinese cabbage BrAHL24a gene, the Chinese cabbage BrAHL24b gene, the Chinese cabbage BrGLK2a gene or the Chinese cabbage BrGLK2b gene can obviously change the bolting and flowering time of the plants, specifically, delay the bolting and flowering of the plants, wherein the Brassicaceae plants can be Arabidopsis thaliana, Chinese cabbage or other varieties of Brassica rapa, that is, the gene is applied to breeding of Brassicaceae vegetables, and has a good application prospect.

[0010] Overexpression of at least one of the Chinese cabbage BrAHL24a gene, the Chinese cabbage BrAHL24b gene, the Chinese cabbage BrGLK2a gene and the Chinese cabbage BrGLK2b gene can delay the bolting and flowering of the Brassicaceae plants.

[0011] Further preferably, the Brassicaceae plants are Chinese cabbage, and experiments prove that overexpression of at least one of the Chinese cabbage BrAHL24a gene, the Chinese cabbage BrAHL24b gene, the Chinese cabbage BrGLK2a gene and the Chinese cabbage BrGLK2b gene can obviously delay the bolting and flowering of the Chinese cabbage, and help to lay a foundation for creating new Chinese cabbage materials and breeding new varieties.

[0012] The Chinese cabbage BrAHL24a gene, the Chinese cabbage BrAHL24b gene, the Chinese cabbage BrGLK2a gene or the Chinese cabbage BrGLK2b gene is connected into a plant overexpression vector to construct a recombinant overexpression vector, and then the recombinant overexpression vector is transformed into a receptor plant, wherein the plant overexpression vector is pAC004, the recombinant overexpression vector is transformed into Agrobacterium, and then the obtained recombinant Agrobacterium is used to infect the receptor plant.

[0013] The application also provides application of the Brassica rapa L. tolerance to bolting and flowering related gene in plant breeding, screening of the Brassica rapa L. BrAHL24a gene, the Brassica rapa L. BrAHL24b gene, the Brassica rapa L. BrGLK2a gene or the Brassica rapa L. BrGLK2b gene overexpressed plant, and breeding purpose is to delay bolting and flowering time.

[0014] The application also provides a method for delaying bolting and flowering of Brassicaceae plants, comprising the following steps:

[0015] (1) connecting the Brassica rapa L. BrAHL24a gene, the Brassica rapa L. BrAHL24b gene, the Brassica rapa L. BrGLK2a gene or the Brassica rapa L. BrGLK2b gene into a plant overexpression vector to construct a recombinant overexpression vector;

[0016] (2) transforming the recombinant overexpression vector constructed in step (1) into a Brassicaceae plant as a receptor plant.

[0017] The plant overexpression vector can be pAC004.

[0018] In step (2), the recombinant overexpression vector is transformed into Agrobacterium, and then the obtained recombinant Agrobacterium is used to infect receptor plant cells

[0019] Compared with the prior art, the application has the following beneficial effects:

[0020] (1) The application clones the Brassica rapa L. BrAHL24 gene or the Brassica rapa L. BrGLK2 gene, and identifies the function of the gene by using a transgenic method, finds the effect of the gene on controlling bolting and flowering time of Brassicaceae plants, and finds that overexpression of at least one of the Brassica rapa L. BrAHL24a gene, the Brassica rapa L. BrAHL24b gene, the Brassica rapa L. BrGLK2a gene and the Brassica rapa L. BrGLK2b gene can significantly delay bolting and flowering of Brassica rapa L. and other Brassicaceae plants, and the Brassica rapa L. tolerance to bolting and flowering related gene is overexpressed in the receptor plant by means of genetic engineering technology, the flowering process is delayed, and the quality of Brassicaceae vegetables is ensured, which has good application prospect in genetic engineering breeding.

[0021] (2) The application lays a research foundation for subsequent elucidation of the genetic basis and molecular mechanism of Brassica rapa L. flowering transition, has certain theoretical significance, and experiments prove that the method can delay the bolting and flowering process of Brassica rapa L., and also has certain application potential in delaying the bolting and flowering process of Brassicaceae plants. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1A and B in Fig. 1 are PCR electrophoretograms of two copies of Brassica rapa BrAHL24 and BrGLK2 genes (Brassica rapa BrAHL24a gene, Brassica rapa BrAHL24b gene, Brassica rapa BrGLK2a gene and Brassica rapa BrGLK2b gene) in the genome, wherein M is a DNA marker.

[0023] Figure 2 A in Fig. 2 is the expression profile analysis result of Brassica rapa BrAHL24a gene and Brassica rapa BrAHL24b gene, and B is the expression profile analysis result of Brassica rapa BrGLK2a gene and Brassica rapa BrGLK2b gene.

[0024] Figure 3 Fig. 3 is a schematic diagram of recombinant overexpression vectors pAC004-BrAHL24a, pAC004-BrAHL24b, pAC004-BrGLK2a and pAC004-BrGLK2b.

[0025] Figure 4 A in Fig. 4 is the PCR detection result of BrAHL24a and BrAHL24b transgenic Brassica rapa plants; B is the relative expression amount analysis result of BrAHL24a in BrAHL24a transgenic Brassica rapa plants; C is the relative expression amount analysis result of BrAHL24b in BrAHL24b transgenic Brassica rapa plants; D is the PCR detection result of BrGLK2a and BrGLK2b transgenic Brassica rapa plants; E is the relative expression amount analysis result of BrGLK2a in BrGLK2a transgenic Brassica rapa plants; F is the relative expression amount analysis result of BrGLK2b in BrGLK2b transgenic Brassica rapa plants; 1, 2, 3 and 4 represent the positive line numbers selected, and CK is a control.

[0026] Figure 5 Fig. 5 is the bolting and flowering observation and time statistics of transgenic lines (35S: :BrAHL24a, 35S: :BrAHL24b, 35S: :BrGLK2a and 35S: :BrGLK2b) and control plants, wherein A is a phenotype diagram, B is a statistical diagram, and a and b represent significant difference at the level of 5%. DETAILED DESCRIPTION

[0027] The present application is further illustrated by the following examples and figures. It should be understood that these examples are intended to illustrate the present application and are not intended to limit the scope of the present application.

[0028] Example 1 Construction of Brassica rapa BrAHL24a overexpression vector and Brassica rapa BrAHL24b overexpression vector

[0029] (1) Take leaf tissue samples of Chinese cabbage ('byq97-02' Chinese cabbage or varieties available in the market) and extract total RNA using TRIzol reagent. The synthesis of cDNA was completed using the TAKARA reverse transcription kit. The specific method is as follows: 2 μL of 5×gDNA Eraser Buffer, 1 μL of gDNA Eraser, 1 μg of RNA, and RNase-free H2O were added to 10 μL. The reaction solution was incubated at 42℃ for 2 min to remove genomic DNA. 4 μL of 5×Primer Script Buffer, 1 μL of RT Primer Mix, 1 μL of Primer Script RT Enzyme Mix, and 4 μL of RNase-free H2O were added to the reaction solution in the previous step. After mixing, the reaction was carried out at 37℃ for 20 min and then at 85℃ for 5 s to complete the synthesis of cDNA. The cDNA was stored at -20℃.

[0030] (2) Using the cDNA from Chinese cabbage leaves as a template, the target fragment of the BrAHL24 gene was obtained by PCR amplification with high-fidelity enzyme using the primers in Table 1. Figure 1 The two copies of BrAHL24 were named BrAHL24a and BrAHL24b, respectively. The expression characteristics of these two copies in different tissues were analyzed. The results showed that BrAHL24a had the highest expression abundance in roots, followed by stems and hypocotyls; BrAHL24b had the highest expression abundance in roots, followed by inflorescences and hypocotyls. Figure 2 A in the middle.

[0031] (3) Figure 1 The target fragment corresponding to A in the sequence was recovered, ligated to pMD18T, and sequenced. The nucleotide sequence of the *BrAHL24a* gene of *Brachial cauliflower* is shown in SEQ ID No. 1, and the nucleotide sequence of the *BrAHL24b* gene of *Brachial cauliflower* is shown in SEQ ID No. 2. After confirming the target sequences, they were amplified and recovered again using these sequences as templates, and then digested with the corresponding restriction endonucleases. The digestion system was as follows: Buffer 4 μL, approximately 2 μg of recovered PCR product, 2 μL each of KpnI and SaII enzymes, and double-distilled water to a final volume of 40 μL. After incubation at 37°C for 1 h, the digestion product was recovered. The pAC004 vector was also digested and recovered using the same method, and then ligated with the digestion product of the gene. The reaction system was as follows: 1 μL of 10×Buffer, 1 μL of T4 ligase, and the molar ratio of the recovered gene fragment to the digested pAC004 vector fragment was approximately 3:1, with a total amount of approximately 0.5 μg. Double-distilled water was added to a final volume of 10 μL, and the mixture was ligated overnight at 4°C before transformation into *E. coli*. After PCR testing and sequencing of positive colonies to confirm correct ligation, the bacterial culture was amplified and plasmids were extracted. Figure 3), and the recombinant overexpression vectors pAC004-BrAHL24a and pAC004-BrAHL24b were obtained and stored at -20°C for later use.

[0032] Table 1 Primers used for PCR amplification of the CDS sequence of the Brassica rapa BrAHL24 gene

[0033]

[0034]

[0035] Example 2 Genetic transformation of Brassica rapa by vacuum infiltration

[0036] (1) Transformation of Agrobacterium with the recombinant overexpression vector

[0037] The vectors pAC004-BrAHL24a, pAC004-BrAHL24b and pAC004 empty vector obtained in Example 1 were introduced into Agrobacterium GV3101 by the following method: the thawed competent cells of Agrobacterium were mixed with 5 μL of the plasmid obtained in Example 1, and then incubated in an ice bath for 10 min, reacted in liquid nitrogen for 5 min, and incubated in a water bath at 28°C for 5 min; 1 mL of liquid LB medium without any antibiotic was added in a clean bench, and the mixture was incubated at 28°C on a shaker at 200 rpm for 4-5 h; centrifuged at 10,000 rpm for 1 min, most of the supernatant was discarded, and the remaining about 100 μL was used to resuspend the bacterial cells, which were then spread on solid LB plates containing Rif (rifampicin, 50 mg·L -1 ) and Kan (kanamycin, 50 mg·L -1 ); after being placed vertically at 28°C for 30 min, the plates were incubated upside down for 1-2 d. After the positive colonies were detected by PCR, the strains were resuspended with 25% glycerol LB, and the Agrobacterium GV3101 strains containing the pAC004-BrAHL24a plasmid, the pAC004-BrAHL24b plasmid or the pAC004 empty vector plasmid were obtained and stored at -75°C for later use.

[0038] (2) Infiltration transformation of Brassica rapa

[0039] Two days before the infection, the Agrobacterium GV3101 strains containing the pAC004-BrAHL24a plasmid, the pAC004-BrAHL24b plasmid or the pAC004 empty vector plasmid were taken out from the ultra-low temperature freezer, and the strains were inoculated on solid LB selection plates containing Rif (50 mg·L -1 ) and Kan (50 mg·L -1 ) using a loop in a clean bench, and the strains were activated. After inoculation, the plates were sealed and incubated in an incubator at 28°C upside down for 36 h. Single colonies were picked and inoculated in 15 mL of LB medium containing Rif (50 mg·L -1), kanamycin (50 mg / L) -1 In a liquid culture medium containing antibiotics, place the culture medium in a shaker at 28°C and 200 rpm for 12 hours to prepare an Agrobacterium stock solution, which is then stored at 4°C. One day before infection, take 1 mL of the stock solution and incubate it in 50 mL of liquid LB medium (containing antibiotics) at 28°C until the OD value reaches 1.0.

[0040] On the day of infection, remove the open flowers of the cabbage after bolting and flowering, and peel the buds of the unopened flowers; centrifuge the bacterial solution at room temperature (4000 rpm, 10 min), add 50 mL of 1 mM MgCl2 5% sucrose solution, add 40 μL of surfactant Silwet77 to a final volume fraction of 0.02%, mix well and transfer to a 50 mL centrifuge tube.

[0041] During infection, immerse the cabbage inflorescence in a centrifuge tube containing the above-mentioned bacterial solution, and vacuum the tube for 10 minutes, releasing the gas once during the process. After removing the inflorescence, wipe off the bacterial solution, place it horizontally in a seed tray lined with damp paper towels, and keep it in the dark for 24 hours. After pollination, turn it upright and return it to the artificial climate chamber. Cultivate it upright for about 30 days, then stop watering, bag the seeds, and collect them according to the number of plants.

[0042] (3) Screening and detection of transgenic positive Chinese cabbage plants

[0043] Sampling: The cabbage seeds treated in step (2) of this embodiment were sown in the substrate. After a true leaf grew, half of the cotyledon was taken for DNA extraction.

[0044] DNA extraction: DNA was extracted using a simplified DNA extraction method. First, a DNA extraction buffer was prepared by taking 0.5 mL of 20% SDS solution (0.5 mol·L⁻¹). -1 0.5 mL of EDTA aqueous solution, 1 mol·L⁻¹ -1 Tris-HCl buffer (pH 9.0) 2 mL, 2 mol·L⁻¹ -1 Add 2 mL of LiCl solution and double-distilled water to a final volume of 10 mL, mix well, and it is ready for use. Then, take about 0.1 g of sample and place it in a 2 mL centrifuge tube, add 200 μL of extraction buffer and one magnetic bead, grind in a grinder (65 Hz, 120 s), remove the magnetic bead from the centrifuge tube, and centrifuge at 13000 rpm for 5 min; transfer 100 μL of supernatant to a new 1.5 mL centrifuge tube, add 100 μL of isopropanol, quickly and gently invert to mix, let stand at room temperature for 5 min, and then centrifuge at 13000 rpm for 10 min; discard the supernatant, wash the precipitate with 1 mL of 70% ethanol, centrifuge at 13000 rpm for 3 min, and discard the supernatant; repeat the washing once, invert the centrifuge tube on absorbent paper, blow dry the ethanol, and add 50 μL of double-distilled water to dissolve the DNA.

[0045] PCR detection: PCR detection was performed using specific primers (Table 2) for the overexpression vector, and the PCR system was as follows: T5 Mix 12.5 μL, 0.5 μL of forward and reverse primers (see Table 2) respectively, 2 μL of DNA template, double distilled water to 25 μL, 98℃ 3 min, 35 cycles (98℃ 10 s, 55℃ 10 s, 72℃ 15 s), 72℃ 3 min, 4℃ preservation. The length of the amplified fragment was identified by 1.2% agarose gel electrophoresis, and only the positive plants were used for subsequent experiments.

[0046] Table 2 Primers used for PCR detection of transgenic cabbage

[0047] Primer name Primer sequence (5’-3’) BrAHL24_004_detect_F CGGATTCCATTGCCCAGCTA BrAHL24a_004_detect_R TCCCGCGTGATGATAATCGG BrAHL24b_004_detect_R TGGAGATCCAGGCTGACGTA 004_F CAATGACCGCTGTTATGCGG 004_R TAAATAGCTGCGCCGATGGT

[0048] Real-time fluorescent quantitative PCR analysis of the relative expression amount of BrAHL24a and BrAHL24b genes in transgenic cabbage plants: The leaves of the positive lines detected by PCR after transplanting were taken into 1.5 mL EP tubes, labeled, and then quickly fixed in liquid nitrogen. After all the samples were taken, total RNA was extracted and cDNA was synthesized, and then qRT-PCR analysis was performed. The primers used for qRT-PCR analysis were designed by Primer Premier 5, as shown in Table 3. The reaction system was 15 μL: 7.5 μL of SYBR Green MasterMix, 0.3 μL of forward and reverse primers, 1 μL of template, and 5.9 μL of double distilled water. The qRT-PCR reaction process was 95℃: 30 s, 40 cycles (95℃: 5 s, 55℃: 45 s). The specificity of the reaction was determined by melting curve, the internal reference gene was BrUBC10, and the relative expression amount of the gene was calculated by 2 -ΔΔCt Method.

[0049] Table 3 Primers used for qRT-PCR analysis of transgenic cabbage plants

[0050] Primer name Primer sequence (5’-3’) BrAHL24a_qRT_F AGAGGAAGATGAGATGCAAACA BrAHL24a_qRT_R TAACCCTTGATGAGCCGACATA BrAHL24b_qRT_F CACAGGGTTAAGCGTTTATCTC BrAHL24b_qRT_R GCATCTCATCTTCCTCTAAGGG BrUBC10_F GGGTCCTACAGACAGTCCTTAC BrUBC10_R ATGGAACACCTTCGTCCTAAA

[0051] The results are shown as A, B and C in Figure 4 , indicating that the BrAHL24 gene in the transgenic lines (35S: :BrAHL24a, 35S: :BrAHL24b) was overexpressed.

[0052] Example 3 Statistics of bolting and flowering time of transgenic lines (35S: :BrAHL24a, 35S: :BrAHL24b)

[0053] Seeds of transgenic Chinese cabbage plants overexpressing the BrAHL24a or BrAHL24b gene obtained in Example 2 were germinated overnight at 28°C and then sown in 72-well trays. After 15 days, they were transferred to 15-well trays. The bolting and flowering time of the transgenic plants was statistically analyzed, with the transgenic Chinese cabbage plants transformed with the pAC004 vector serving as the control plants (CK). The results are as follows: Figure 5 As shown in A and B, the bolting and flowering time of transgenic plants overexpressing BrAHL24a and BrAHL24b was significantly delayed.

[0054] Example 4: Construction of Chinese cabbage BrGLK2a and BrGLK2b overexpression vectors

[0055] (1) cDNA was extracted from cabbage leaf tissue using the method described in Example 1.

[0056] (2) Using the cDNA from Chinese cabbage leaves as a template, the target fragment of the BrGLK2 gene was obtained by PCR amplification with high-fidelity enzyme using the primers in Table 4. Figure 1 The two copies of BrGLK2 were named BrGLK2a and BrGLK2b, respectively. The expression characteristics of these two copies in different tissues and organs were analyzed. The results showed that BrGLK2a had the highest expression abundance in leaves, followed by stems and shoot apical meristems; BrGLK2b had the highest expression abundance in shoot apical meristems, followed by stems and leaves. Figure 2 (B in the middle).

[0057] (3) Figure 1 The target fragment corresponding to B in the sequence was recovered, ligated to pMD18T, and sequenced. The nucleotide sequence of the *Brago salsa* BrGLK2a gene is shown in SEQ ID No. 3, and the nucleotide sequence of the *Brago salsa* BrGLK2b gene is shown in SEQ ID No. 4. After confirming the target sequences, they were amplified again using these sequences as templates, recovered, and then digested with the corresponding restriction endonucleases. The digestion system was as follows: Buffer 4 μL, approximately 2 μg of recovered PCR product, 2 μL each of KpnI and SaII enzymes, and double-distilled water to a final volume of 40 μL. After incubation at 37°C for 1 h, the digestion product was recovered. The pAC004 vector was also digested and recovered using the same method, and then ligated with the gene digestion product. The reaction system was as follows: 1 μL of 10×Buffer, 1 μL of T4 ligase, and the molar ratio of the recovered gene fragment to the digested pAC004 vector fragment was approximately 3:1, with a total volume of approximately 0.5 μg. Double-distilled water was added to a final volume of 10 μL, and the mixture was ligated overnight at 4°C before transformation into *E. coli*. After PCR testing and sequencing of positive colonies to confirm correct ligation, the bacterial culture was amplified and plasmids were extracted. Figure 3), and recombinant overexpression vectors pAC004-BrGLK2a and pAC004-BrGLK2b were obtained and stored at -20°C for later use.

[0058] Table 4 Primers used for PCR amplification of CDS sequence of Brassica rapa BrGLK2 gene

[0059] Primer name Primer sequence (5’-3’) BrGLK2a_CDS_F ATGATGTTAACTGTGTCGCC BrGLK2a_CDS_R AGGAAGAGGAGGAACAT BrGLK2b_CDS_F ATGTTAACTGTGTCTCCTCT BrGLK2b_CDS_R AGGAAGAGGAGGAACAT

[0060] Example 5 Genetic transformation of Brassica rapa by vacuum-infiltration method

[0061] (1) Transformation of Agrobacterium with recombinant overexpression vector

[0062] The vectors pAC004-BrGLK2a, pAC004-BrGLK2b and pAC004 empty vector obtained in Example 4 were transformed into Agrobacterium GV3101 according to the method in Example 2, and Agrobacterium GV3101 strains containing pAC004-BrGLK2a plasmid, pAC004-BrGLK2b plasmid or pAC004 empty vector plasmid were obtained and stored at -75°C for later use.

[0063] (2) Transformation of Brassica rapa by vacuum-infiltration method

[0064] Brassica rapa was transformed by vacuum-infiltration method using Agrobacterium GV3101 strains containing pAC004-BrGLK2a plasmid, pAC004-BrGLK2b plasmid or pAC004 empty vector plasmid according to Example 2, and the seeds were collected and numbered after the plants were grown.

[0065] (3) Screening and detection of transgenic positive Brassica rapa plants

[0066] Sampling: The Brassica rapa seeds treated in step (2) of this example were sown in the medium, and after a true leaf was grown, half of the cotyledons were taken for DNA extraction.

[0067] DNA extraction: DNA was extracted according to the method in Example 2.

[0068] Detection of transgenic positive plants: PCR detection was performed using specific primers (Table 5) for the overexpression vector, and the PCR system was as follows: T5 Mix 12.5 μL, forward and reverse primers (see Table 5) each 0.5 μL, DNA template 2 μL, double distilled water to 25 μL, 98°C for 3 min, 35 cycles (98°C for 10 s, 55°C for 10 s, 72°C for 15 s), 72°C for 3 min, 4°C for 3 min. The length of the amplified fragment was identified by 1.2% agarose gel electrophoresis, and only the positive plants were used for subsequent experiments.

[0069] Table 5 Primers used for PCR detection of transgenic Brassica rapa

[0070] Primer name Primer sequence (5’-3’) BrGLK2a_004_detect_F1 AGGTGGCTCCTACAAATGCC BrGLK2a_004_detect_R1 ATGTCGTCGGAGATTCCAGC BrGLK2a_004_detect_F2 TGGCTGGTGTAAGCCTGAAG BrGLK2a_004_detect_R2 TAGTCCGGGACGTCATAGGG 004_F CAATGACCGCTGTTATGCGG 004_R TAAATAGCTGCGCCGATGGT

[0071] Real-time quantitative PCR analysis of the relative expression levels of BrGLK2a and BrGLK2b genes in transgenic Chinese cabbage plants: Leaves from positive lines detected by PCR after transplanting were collected in 1.5 mL EP tubes, labeled, and quickly fixed in liquid nitrogen. After all samples were collected, total RNA was extracted and cDNA was synthesized before qRT-PCR analysis. Primers used for qRT-PCR analysis were designed using Primer Premier 5, as shown in Table 6. The reaction system consisted of 15 μL: 7.5 μL of SYBR Green Master Mix, 0.3 μL each of forward and reverse primers, 1 μL template, and 5.9 μL double-distilled water. The qRT-PCR reaction procedure was: 95℃: 30 s, 40 cycles (95℃: 5 s, 55℃: 45 s). The specificity of the reaction was determined by melting curve analysis. The internal control gene was BrUBC10. The relative expression levels of the genes were determined by 2... -ΔΔCt Method calculation.

[0072] Table 6 Primers used for qRT-PCR analysis of transgenic Chinese cabbage plants

[0073] Primer name Primer sequence (5’-3’) BrGLK2a_qRT_F GAGATTAGGGGTAGATAAGGCG BrGLK2a_qRT_R CAGGAAGAGCCATACTTAGCTT BrGLK2b_qRT_F AGTGCCATCTCGGATTTTAGAA BrGLK2b_qRT_R TCTGTGTCACGTTTGGTGTATA BrUBC10_F GGGTCCTACAGACAGTCCTTAC BrUBC10_R ATGGAACACCTTCGTCCTAAA ATGGAACACCTTCGTCCTAAA

[0074] The results are as follows Figure 4 As shown in D, E, and F, the BrGLK2 gene was overexpressed in both transgenic lines (35S::BrGLK2a and 35S::BrGLK2b).

[0075] Example 6: Statistical analysis of bolting and flowering time of transgenic lines (35S::BrGLK2a, 35S::BrGLK2b)

[0076] Seeds of transgenic Chinese cabbage plants overexpressing the BrGLK2a or BrGLK2b gene, obtained in Example 6, were germinated overnight at 28°C and then sown in 72-well trays. After 15 days, they were transferred to 15-well trays. The bolting and flowering time of the transgenic plants was statistically analyzed, with the number of days from bud formation to a bolting height of 1 cm defined as the bolting and flowering time. Transgenic Chinese cabbage plants infused with the pAC004 vector were used as control plants (CK). The results are as follows: Figure 5 As shown in A and B, the bolting and flowering time of transgenic plants overexpressing BrGLK2a and BrGLK2b was significantly delayed.

[0077] The embodiments described above provide a detailed explanation of the technical solutions of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, additions, or similar substitutions made within the scope of the principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Use of a Brassica napus stay-green flowering-related gene to delay bolting and flowering in a Brassicaceae plant, characterized in that, The Brassicaoleracea tolerance-to-ear-formation-and-flowering-related gene is a Brassicaoleracea BrGLK2a gene, which makes the Brassicaceae plant overexpress the Brassicaoleracea BrGLK2a gene, which makes the Brassicaceae plant overexpress the Brassicaoleracea BrGLK2a The nucleotide sequence of the Brassicaoleracea tolerance-to-ear-formation-and-flowering-related gene is shown as SEQ ID No.

3.

2. Use according to claim 1, characterized in that, Chinese cabbage BrGLK2a The gene is ligated into a plant overexpression vector to construct a recombinant overexpression vector, and then the recombinant overexpression vector is transformed into a recipient plant.

3. Use according to claim 2, characterized in that, The plant overexpression vector is pAC004; the recombinant overexpression vector is transformed into Agrobacterium, and then the obtained recombinant Agrobacterium is used to infect the receptor plant.

4. A method for delaying bolting and flowering of a cruciferous plant, characterized by, The cruciferous plant is Brassica rapa, comprising the following steps: (1) The Brassica rapa BrGLK2a gene into a plant overexpression vector, and a recombinant overexpression vector is constructed, wherein the nucleotide sequence of the Brassica rapa BrGLK2a gene is shown as SEQ ID No.

3. (2) The recombinant overexpression vector constructed in step (1) is transformed into the cruciferous plant as the receptor plant.

5. The method of claim 4, wherein, The plant overexpression vector is pAC004; the recombinant overexpression vector is transformed into Agrobacterium, and then the obtained recombinant Agrobacterium is used to infect the receptor plant.

Images