Application of Nicotiana benthamiana NbTSG101 gene in regulating plant resistance to viruses and transgenic plant breeding methods

Abstract

The present invention discloses an application of the NbTSG101 gene of Nicotiana benthamiana in regulating plant antiviral resistance and a transgenic plant cultivation method, wherein the viruses are turnip mosaic virus (TuMV), tomato yellow leaf curl virus (TYLCV) and tobacco mosaic virus (TMV); the transcript sequence of the NbTSG101 gene is shown in SEQ ID NO: 1. The present invention introduces a gene knockout vector carrying a target gene target into a target plant through an Agrobacterium transformation method, and obtains a Nicotiana benthamiana plant with a NbTSG101 gene mutation, the offspring of the mutant Nicotiana benthamiana plant has a normal growth state, can significantly reduce the infection of TuMV, TYLCV and TMV, and has a broad-spectrum antiviral effect.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to application of Nicotiana benthamiana NbTSG101 gene in regulating plant resistance to viruses and a method for cultivating transgenic plants. Background Art

[0002] Turnip mosaic virus (TuMV) belongs to the Potyvirus genus of the Potyviridae family. It has a wide host range and is distributed throughout North America, Europe, Asia and other parts of the world. It can infect at least 43 dicotyledonous plants and is one of the most important plant viruses in agricultural production. Under natural conditions, TuMV mainly infects cruciferous crops and vegetables such as rapeseed, cabbage, Chinese cabbage, and broccoli. Infected plants will show symptoms such as wilt, mosaic, mottled, and dwarfed. It can cause serious yield reduction and economic losses. TuMV not only has a wide host range, but can also be transmitted through multiple routes. For example, it can be transmitted by aphids in a non-persistent manner, and can also be transmitted through friction inoculation or sap contact.

[0003] Tomato yellow leaf curl virus (TYLCV) belongs to the genus Begomovirus of the family Geminiviridae. It can infect tobacco, tomatoes, peppers and other Solanaceae crops. Infected crops will show obvious symptoms such as dwarfing, leaf curling and yellowing, which seriously leads to crop yield reduction, huge economic losses and harms agricultural production. Currently, TYLCV is the most serious plant virus that harms tomato production in the world.

[0004] Tobacco mosaic virus (TMV) belongs to the genus Tobamovirus. It is a serious and widely distributed virus. In addition to harming tobacco, it can also infect Solanaceae plants such as tomatoes, eggplants, potatoes, peppers, and Solanum nigrum. In addition, it can infect more than 300 species of plants in 30 families such as Cucurbitaceae, Cruciferae, Leguminosae, and Asteraceae. The global losses caused by tobacco mosaic virus alone amount to more than 100 million US dollars each year, and no good antiviral agent has been developed yet.

[0005] The above three viruses are viruses that seriously harm crops in my country's agricultural production. Currently, there is a lack of effective chemical agents for prevention and control, and there are no effective antiviral crop varieties available.

[0006] Plant viruses live in the host as parasites, so general chemical pesticides are not suitable for the prevention and control of viral diseases. In nature, there are many vectors for plant viruses. The effect of using chemical agents to control virus-transmitting insects is unsatisfactory, and it also causes serious excessive pesticide residues and environmental pollution. Nowadays, the main methods of prevention and control in agriculture are to remove susceptible plants and kill plant virus-transmitting insects. For this type of prevention and control method, the efficiency is low and there are many problems in terms of manpower. Therefore, the most effective and important method for virus prevention and control is to create antiviral materials and breed antiviral varieties. Through the CRISPR-Cas9 system, researchers have the ability to perform site-directed mutations on endogenous genes in plants. Through this technology, it is possible to achieve specific knockout of host disease-susceptible genes to obtain virus-resistant crops, and the obtained offspring plants do not contain transgenics, which is more easily accepted by the public in food safety. Therefore, identifying disease-susceptible genes with broad-spectrum effects is the key to obtaining antiviral varieties. Summary of the invention

[0007] The first objective of the present invention is to provide an application of Nicotiana benthamiana NbTSG101 gene in regulating plant resistance to viruses.

[0008] The second object of the present invention is to provide a method for cultivating Nicotiana benthamiana NbTSG101 gene knockout plants.

[0009] The present invention is based on CRISPR-Cas9-mediated gene editing tools. Through a large amount of preliminary screening work, a gene NbTSG101 in Nicotiana benthamiana that is susceptible to a broad spectrum of viruses was identified, and further a broad-spectrum, highly effective antiviral material was obtained through transgenic technology. The creation and use of this disease-resistant material will play an important role in the green prevention and control of plant viral diseases.

[0010] The present invention introduces a CRISPR vector carrying the NbTSG101 target into a target plant through the Agrobacterium transformation method, and the obtained Nicotiana benthamiana NbTSG101 gene knockout plant can significantly reduce the infection of turnip mosaic virus (TuMV), tomato yellow leaf curl virus (TYLCV) and tobacco mosaic virus (TMV), and effectively control their damage.

[0011] Specifically, the technical solution adopted by the present invention is as follows:

[0012] Application of the Nicotiana benthamiana NbTSG101 gene in regulating plant antiviral resistance: by mutating the Nicotiana benthamiana NbTSG101 gene to resist infection by plant viruses; wherein the viruses are turnip mosaic virus TuMV, tomato yellow leaf curl virus TYLCV and tobacco mosaic virus TMV, and the transcript sequence of the NbTSG101 gene is shown in SEQ ID NO:1.

[0013] Specifically: by constructing a knockout vector of the Nicotiana benthamiana NbTSG101 gene, that is, designing a gRNA specifically targeting NbTSG101 for the PAM site near the 5' end of the Nicotiana benthamiana gene coding region sequence, and constructing the pCambia1300-BKG-g1 vector; using sterile cultured Nicotiana benthamiana leaves as callus tissue, using Agrobacterium-mediated T-DNA for genetic transformation, and introducing the knockout vector into the target plant, the obtained Nicotiana benthamiana plants with NbTSG101 gene mutations can significantly reduce the infection of TuMV, TYLCV and TMV.

[0014] A method for cultivating NbTSG101 transgenic plants resistant to TuMV, TYLCV and TMV: a gene knockout vector carrying a NbTSG101 gene target site is introduced into a target plant by Agrobacterium transformation to obtain plants with NbTSG101 gene mutations in Nicotiana benthamiana.

[0015] The specific steps include:

[0016] (1) Designing a gRNA that can specifically target the endogenous gene NbTSG101 of Nicotiana benthamiana to obtain a gRNA target sequence as shown in SEQ ID NO: 2; designing primers for PCR amplification to clone and obtain an NbTSG101-gRNA fragment; wherein the primers are NbTSG101-gRNA-F and NbTSG101-gRNA-R, and the sequences are shown in SEQ ID NO: 3-4, respectively;

[0017] (2) Linearize the BKG vector with restriction endonuclease Eco31I and purify and recover it;

[0018] (3) Use T4 DNA ligase to connect the linearized BKG vector and the double-stranded gRNA;

[0019] (4) Transform DH5α Escherichia coli, screen and identify positive clones, sequence the plasmids of positive clones, and obtain the BKG vector with the gRNA correctly inserted;

[0020] (5) Mix 1 μl of the recombinant plasmid and 50 μl of competent Agrobacterium and transfer them into an electroporation cup. Use an electroporation device at 2500 V for transformation. After recovery, spread them on a resistant medium to screen for Agrobacterium that has been transformed with the recombinant plasmid.

[0021] (6) Infect tobacco leaves with Agrobacterium carrying the recombinant plasmid, obtain callus tissue through differentiation culture, and then obtain seedlings through rooting culture, which are then transferred for further culture;

[0022] (7) After the seedlings continue to grow stably, leaf samples are taken and DNA is extracted using the CTAB method; PCR amplification is performed using the primer pair M13-F and BKG-gRNA-R with the extracted DNA as a template to determine whether the exogenous CRISPR-Cas9 sequence has been transferred into the plant; the sequences of the primers M13-F and BKG-gRNA-R are shown in SEQ ID NOs: 5-6, respectively;

[0023] (8) On the positive transgenic material, primers BKG-NbTSG101-F and BKG-NbTSG101-R were used to clone the gene target sequence of Nicotiana benthamiana NbTSG101, and gene-edited strains were screened by sequencing and kept for seed; the sequences of BKG-NbTSG101-F and BKG-NbTSG101-R are shown in SEQ ID NOs: 7-8, respectively.

[0024] Compared with the prior art, the outstanding effects of the present invention are:

[0025] The present invention discovered a new virus-susceptible gene NbTSG101 in tobacco, and introduced a CRISPR vector carrying the NbTSG101 target into a target plant through an Agrobacterium transformation method, and knocked out the NbTSG101 gene in Nicotiana benthamiana through transgenic knockout. The obtained NbTSG101 gene knockout plants can significantly reduce the diseases caused by TuMV, TYLCV and TMV.

[0026] The application of the Nicotiana benthamiana NbTSG101 gene in regulating plant antiviral resistance and the transgenic plant breeding method described in the present invention will be further described below in conjunction with the accompanying drawings and specific examples. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Schematic diagram for the construction of NbTSG101 gene knockout vector;

[0028] Figure 2 The mutant form of NbTSG101 gene knockout Nicotiana benthamiana (A) and mutant phenotype (B);

[0029] Figure 3 Knockout of the NbTSG101 gene enhanced the disease resistance of Nicotiana benthamiana to turnip mosaic virus (TuMV), tomato yellow leaf curl virus (TYLCV) and tobacco mosaic virus (TMV).

[0030] Among them, (A) TuMV-GFP was infiltrated and inoculated into wild-type and NbTSG101 knockout plants of N. benthamiana, and virus accumulation in systemic leaves was observed under UV light on the 6th day; (B) Samples of the same diseased site of different plants inoculated with TuMV-GFP were taken for qRT-PCR detection. (C) TYLCV was infiltrated and inoculated into wild-type and NbTSG101 knockout plants of N. benthamiana, and systemic leaf phenotypes were observed on the 10th day; (D) Samples of the same diseased site of different plants inoculated with TYLCV were taken for qPCR detection; (E) TMV-GFP was infiltrated and inoculated into wild-type and NbTSG101 knockout plants of N. benthamiana, and virus accumulation in systemic leaves was observed under UV light on the 6th day; (F) Samples of the same diseased site of different plants inoculated with TMV-GFP were taken for qRT-PCR detection. DETAILED DESCRIPTION

[0031] A method for cultivating NbTSG101 transgenic plants resistant to TuMV, TYLCV and TMV, wherein a gene knockout vector carrying a NbTSG101 gene target site is introduced into a target plant through Agrobacterium transformation to obtain plants with NbTSG101 gene mutations in Nicotiana benthamiana. The transcript sequence of the NbTSG101 gene is shown in SEQ ID NO:1.

[0032] The specific steps include:

[0033] (1) Designing a gRNA that can specifically target the endogenous gene NbTSG101 of Nicotiana benthamiana, and obtaining the gRNA target sequence: CAGTTTGTGAATCCGTCCG, as shown in SEQ ID NO: 2; designing primers for PCR amplification, and cloning the NbTSG101-gRNA fragment; wherein the primers are NbTSG101-gRNA-F and NbTSG101-gRNA-R, and the sequences are shown in SEQ ID NO: 3-4, respectively;

[0034] NbTSG101-gRNA-F:tgattgcagtttgtgaatccgtccg;

[0035] NbTSG101-gRNA-R:aaaccggacggattcacaaactgca;

[0036] (2) Then anneal the obtained primers to obtain double-stranded DNA using the method of Bio-Tech Annealing Buffer for DNA Oligos (D0251). Anneal the NbTSG101-gRNA-F / R described in step (1) to synthesize double-stranded DNA, and the specific steps are as follows:

[0037] ① Mix NbTSG101-gRNA-F / R dry powder with ddH 2 O configuration is 50 μM;

[0038] ②Configure the reaction system in the PCR tube:

[0039] <![CDATA[ddH 2 The]]> 4μL Annealing Buffer for DNA Oligo 2μL Oligo A 2μL Oligo B 2μL Total 10μL

[0040] ③ Use PCR instrument to control the temperature: 95℃ for 2 minutes; decrease 0.1℃ every 8 seconds to 25℃; temporarily store at 4℃ for 5 minutes;

[0041] ④The annealed product is used for subsequent connection.

[0042] (3) The BKG vector was digested and connected with the above product by T4 ligase, and then transferred into DH5α Escherichia coli. The bacterial solution was plated on a culture plate selected by kanamycin. After positive identification, the plasmid was extracted to obtain the recombinant plasmid. The schematic diagram of the NbTSG101 gene knockout vector construction is shown in the figure. Figure 1 shown.

[0043] (4) Mix 1 μl of the recombinant plasmid and 50 μl of competent Agrobacterium and transfer them into an electroporation cup. Use an electroporation device at 2500 V for transformation. After recovery, spread them on a resistant medium to screen for Agrobacterium that has been transformed with the recombinant plasmid.

[0044] (5) Infect tobacco leaves with Agrobacterium carrying the recombinant plasmid, obtain callus tissue through differentiation culture, and then obtain seedlings through rooting culture, which are then transferred for further culture;

[0045] (6) After the seedlings continue to grow stably, leaf samples are taken and DNA is extracted using the CTAB method; PCR amplification is performed using the primer pair M13-F and BKG-gRNA-R with the extracted DNA as a template to determine whether the exogenous CRISPR-Cas9 sequence has been transferred into the plant; the sequences of the primers M13-F and BKG-gRNA-R are shown in SEQ ID NOs: 5-6, respectively;

[0046] M13-F:gttgtaaaacgacggccag;

[0047] BKG-gRNA-R: ggccatttgtctgcagaattgg;

[0048] (7) Using primers BKG-NbTSG101-F and BKG-NbTSG101-R on the positive transgenic material, the gene target sequence of NbTSG101 of Nicotiana benthamiana was cloned, and the gene-edited strains were screened by sequencing and kept as seeds; the sequences of BKG-NbTSG101-F and BKG-NbTSG101-R are shown in SEQ ID NOs: 7-8, respectively;

[0049] BKG-NbTSG101-F:attatttggcttatggaatcttaccc;

[0050] BKG-NbTSG101-R:gctagggctagggttagg;

[0051] (8) Among the positive edited materials obtained, two mutant Nicotiana benthamiana materials were screened. Figure 2 As shown in A, the first material introduced an insertion mutation of base C in the target sequence and was named Cas9-NbTSG101-1. The second material had a deletion mutation of 5 bases in the target sequence and was named Cas9-NbTSG101-2.

[0052] (9) The transgenic strains were obtained through screening. The mutation of NbTSG101 had no effect on the normal growth of Nicotiana benthamiana. Figure 2 B).

[0053] (10) The two NbTSG101 gene mutants obtained in this study were inoculated with a GFP-fluorescent Turnip mosaic virus (TuMV-GFP) infectious clone, a TYLCV infectious clone, and a GFP-fluorescent Tobacco mosaic virus (TMV-GFP) infectious clone. The two mutant plants showed a stronger antiviral phenotype than the wild type ( Figure 3 ).

[0054] TuMV-GFP and TMV-GFP were inoculated into wild-type Nicotiana benthamiana and NbTSG101 knockout plants, and virus accumulation in systemic leaves was observed under UV light on the 6th day. Figure 3 A, 3E; Similarly, TYLCV inoculated N. benthamiana wild type and NbTSG101 gene knockout plants, phenotypic changes were observed on the 10th day, as shown in Figure 3 C; and samples were taken from the same diseased part of different plants for qRT-PCR and qPCR detection. The results are shown in Figure 3 As shown in B, 3D, and 3F, the accumulation of viral RNA of TuMV-GFP, TYLCV, and TMV-GFP was significantly lower in the two NbTSG101 gene knockout strains than in the wild type.

[0055] The embodiments described above are merely descriptions of preferred implementation modes of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of Nicotiana benthamiana NbTSG101 gene in regulating plant antiviral resistance, characterized in that: By mutating the NbTSG101 gene of Nicotiana benthamiana to resist infection by plant viruses; wherein the viruses are Turnip mosaic virus TuMV, Tomato yellow leaf curl virus TYLCV and Tobacco mosaic virus TMV, the transcript sequence of the NbTSG101 gene is shown in SEQ ID NO: 1; and the plant is Nicotiana benthamiana; A gRNA specifically targeting NbTSG101 was designed for the PAM site near the 5' end of the coding region sequence of the NbTSG101 gene of Nicotiana benthamiana, and the pCambia1300-BKG-g1 vector was constructed. The gene knockout vector was introduced into the target plants. The obtained Nicotiana benthamiana NbTSG101 gene mutant plants can significantly reduce the infection of TuMV, TYLCV and TMV.

2. The use of the Nicotiana benthamiana NbTSG101 gene in regulating plant antiviral properties according to claim 1, characterized in that: The callus tissue was made from the leaves of Nicotiana benthamiana cultured aseptically, and the gene knockout vector was introduced into the target plant by using Agrobacterium transformation.

3. A method for cultivating NbTSG101 transgenic plants resistant to TuMV, TYLCV and TMV viruses, characterized in that: By using the Agrobacterium transformation method, a gene knockout vector carrying the NbTSG101 gene target site is introduced into the target plant to obtain a Nicotiana benthamiana plant with a NbTSG101 gene mutation; the transcript sequence of the NbTSG101 gene is shown in SEQ ID NO: 1; The following steps are involved: (1) designing a gRNA that can specifically target the endogenous gene NbTSG101 of Nicotiana benthamiana to obtain a gRNA target sequence as shown in SEQ ID NO: 2; designing primers to synthesize two single-stranded gRNAs, and then annealing them to synthesize complementary double-stranded gRNAs; (2) Linearize the BKG vector with restriction endonuclease Eco31I and purify and recover it; (3) Use T4 DNA ligase to connect the linearized BKG vector and the double-stranded gRNA; (4) Transform DH5α Escherichia coli, screen and identify positive clones, sequence the plasmids of positive clones, and obtain the BKG vector with the gRNA correctly inserted; (5) Mix 1 μl of the recombinant plasmid and 50 μl of competent Agrobacterium and transfer them into an electroporation cup. Use an electroporation device at 2500 V for transformation. After recovery, apply the mixture onto a resistant culture medium to screen for Agrobacterium that has been transformed with the recombinant plasmid. (6) Infect tobacco leaves with Agrobacterium carrying the recombinant plasmid, obtain callus tissue through differentiation culture, and then obtain seedlings through rooting culture, which are then transferred for further culture; (7) After the seedlings grow stably, leaf samples are taken and DNA is extracted using the CTAB method; the extracted DNA is used as a template and PCR amplification is performed using primers M13-F and BKG-gRNA-R to determine whether the exogenous CRISPR-Cas9 sequence has been transferred into the plant; the sequences of primers M13-F and BKG-gRNA-R are shown in SEQ ID NOs: 5-6, respectively; (8) On the positive transgenic material, the gene target sequence of Nicotiana benthamiana NbTSG101 was cloned by using primers BKG-NbTSG101-F and BKG-NbTSG101-R, and the edited strains were screened by sequencing and kept for seeds; wherein the sequences of BKG-NbTSG101-F and BKG-NbTSG101-R are shown in SEQ ID NOs: 7-8, respectively.

4. The method for cultivating NbTSG101 transgenic plants according to claim 3, characterized in that: The primers in step (1) are NbTSG101-gRNA-F and NbTSG101-gRNA-R, and their sequences are shown in SEQ ID NOs: 3-4, respectively.

Images