Knocking out JAMs genes improves tomato resistance to southern root-knot nematode
The JAMs knockout mutant plant was constructed through CRISPR/Cas9 technology, which solved the problem of unclear defense mechanism of JAMs genes against southern root knot nematodes in tomatoes, and achieved significant reduction in root knot count, enhanced resistance, and improved tomato production and yield.
Patent Information
- Application Number
- CN202210864977.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-21
- Publication Date
- 2025-08-08
- Estimated Expiration
- 2042-07-21
AI Technical Summary
In the prior art, the JAMs gene plays a unclear role in the defense mechanism of tomatoes against southern root knot nematodes, which makes it difficult to effectively control root knot nematode infection and affects agricultural production.
JAMs knockout mutant plants were constructed through CRISPR/Cas9 technology to reduce the expression of JAMs genes. Agrobacterium tumefaciens mediated the transformation of target tomato explants, and JAMs knockout jams mutant plants were prepared to enhance resistance to southern root knot nematode.
Significantly reduce the number of root knots, enhance the plant's resistance to southern root knot nematodes, and improve tomato production and yield.
Smart Images

Figure CN115976099B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a method for improving the resistance of tomatoes to southern root-knot nematodes by knocking out JAMs (JAM1, JAM2) genes. Background Art
[0002] A key question in our current research on jasmonic acid (JA) concerns the biological functions of the hormone's many chemical derivatives, including abiotic JA, which are precursors or inactive forms of active JA. Jasmonic acid regulates a wide range of plant processes, including growth and development, as well as defense systems against biotic and abiotic stresses. Although ethylene (ET), salicylic acid (SA), and other plant hormones are important in controlling plant-pathogen interactions, the contribution of these signals to host resistance is relatively small compared to JA.
[0003] Decades of research in the model systems of Arabidopsis thaliana and tomato (Solanum lycopersicum) have elucidated a core JA signaling pathway composed of multiple interconnected protein-protein interaction modules that control the transcriptional state of hormone-responsive genes. JA-Ile is sensed by a protein complex consisting of the F-box protein CORONATINE INSENSITIVE1 (COI1) and the JASMONATE ZIM DOMAIN (JAZ) proteins, leading to ubiquitin-dependent degradation of the JAZ proteins and activation of the MYC transcription factor to regulate JA-responsive genes. The most studied JA-inducible transcription factor is the basic helix-loop-helix (bHLH) protein MYC2, which serves as a master regulator of JA in Arabidopsis. Furthermore, a subclade of MYC-associated DNA-binding proteins, termed JA-ASSOCIATED MYC2-LIKE1 (JAM1), JAM2, and JAM3, play a negative role in JA-mediated defense responses by competing with MYC2 for its DNA binding ability. Studies have shown that JASMONATE ASSOCIATED MYC2-LIKE1 (JAM1), JAM2, and JAM3 encode additional basic helix-loop-helix transcription factors involved in diverse defense responses. In Arabidopsis, they positively regulate defense responses in a COI1- and MYC2-dependent manner. However, in contrast to myc2, the jam1 / jam2 / jam3 triple mutant exhibits shorter roots when treated with methyl jasmonate (MeJA), indicating an enhanced JA response. Following MeJA treatment, key jasmonic acid metabolism genes, as well as genes encoding transcription factors that regulate JA-responsive metabolic genes, are negatively regulated by JAMs. Although studies have identified JAM1, JAM2, and JAM3 as novel factors that primarily antagonize MYC2 in JA signaling, mediating insect resistance in tomato, whether JAMs participate in defense against root-knot nematodes and the underlying mechanisms remain unclear.
[0004] Root-knot nematodes (RKNs; Melodogyne spp.) are pathogenic parasites that primarily infect plant roots, posing a significant threat to agriculture. While extensive research is underway to control RKNs, effective control remains challenging, and the environmental threat remains significant. Therefore, research on the JA pathway to protect against pathogens provides a theoretical basis for future plant-pathogen defenses and could effectively inhibit nematode infestation in tomatoes.
[0005] To explore how JAMs are involved in resistance to root-knot nematodes, we created jam1, jam2 single mutant and jam1 / jam2 double mutant plants, and found that JAMs play a negative regulatory role in tomato's defense against southern root-knot nematodes. This provides theoretical support for the study of the JA pathway and tomato's defense response to nematodes, and creates materials to improve resistance, which is of great significance for improving tomato production and yield. Summary of the Invention
[0006] The present invention used CRISPR / CAS9 technology to construct jams mutant plants. Four weeks after inoculating wild-type tomato (WT) and jams mutant plants with nematodes, the researchers found that the jams mutant plants had fewer root knots than the wild-type tomatoes, and that the root knots in the wild-type tomatoes were more pronounced than those in the jams mutants. Consequently, the present invention provides a method for improving tomato resistance to the southern root-knot nematode by knocking out the JAMs gene.
[0007] A method for improving tomato resistance to southern root-knot nematode by knocking out JAMs genes, wherein the JAMs genes are JAM1 genes and / or JAM2 genes;
[0008] The JAM1 gene is selected from any one of the following two:
[0009] A. The base sequence of the JAM1 gene is shown in SEQ ID NO: 1;
[0010] B. any DNA molecule whose base sequence has 90% or more homology with the sequence shown in SEQ ID NO: 1 and encodes the amino acid sequence shown in SEQ ID NO: 2;
[0011] The JAM2 gene is selected from any one of the following two:
[0012] a. The base sequence of the JAM2 gene is shown in SEQ ID NO: 3;
[0013] b. Any DNA molecule whose base sequence has more than 90% homology with the sequence shown in SEQ ID NO: 3 and encodes the amino acid sequence shown in SEQ ID NO: 4.
[0014] The lower the expression level of the JAMs gene in tomatoes, the fewer root knots there are when infected by root-knot nematodes, and the stronger the plant's resistance to root-knot nematodes; the higher the expression level of the JAMs gene in tomatoes, the more root knots there are when infected by root-knot nematodes, and the more sensitive the plant is to root-knot nematode infection.
[0015] A preferred method for improving tomato resistance to southern root-knot nematode by knocking out JAMs genes, specifically comprising the steps of:
[0016] (1) constructing an Agrobacterium tumefaciens engineered bacterium containing the JAMs gene CRISPR / Cas9 vector;
[0017] (2) The target tomato explants are transformed by the engineered Agrobacterium tumefaciens to prepare jams mutant plants with JAMs gene knockout.
[0018] In step (1), the preparation method of the engineered Agrobacterium tumefaciens is as follows:
[0019] (a) Total RNA was extracted from young leaves of wild-type tomato;
[0020] (b) reverse transcribing the tomato total RNA obtained in step (a) into cDNA;
[0021] (c) Design the target sequence of the tomato JAMs gene on the CRISPR-P website (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR), and design primers to delete and edit large fragments of the gene. This system uses the U6 promoter, so linker sequences are added to both ends of the sgRNA recognition sequence. In theory, when two sgRNAs act at the same time, the large fragment between them will be deleted. Anneal the synthesized sgRNA forward and reverse primers to form a double-stranded sgRNA with a sticky end linker, dilute it 200 times, and connect it to the sgRNA-Cas9 backbone vector that has been digested with BasI overnight at 16°C. The ligation product is transformed into Escherichia coli DH5α competent cells and cultured in the presence of ampicillin (Amp + After overnight culture at 37°C in LB solid medium, single clones were picked and PCR was performed using M13F universal primer and annealed downstream primers. Positive single clones were sequenced and identified.
[0022] Using AtU6-F-KpnI as the forward primer and AtsgR-R-EcoRI as the back primer, the second sgRNA sequence was amplified and then ligated into the backbone vector containing the Cas9 sequence. The correctly sequenced positive plasmid was double-digested with HindIII and EcoRI. The recovered fragment was ligated with linearized pCAMBIA1300 overnight and transformed into DH5α competent cells. The cells were cultured overnight at 37°C in solid LB medium supplemented with 50 mg / L kanamycin. Single colonies were picked and positive clones were identified by PCR using primers 1300-seq-R and AtUBQ-seq-R, followed by sequencing.
[0023] (d) The CRISPR / Cas9 vector obtained in step (c) is transferred into Agrobacterium tumefaciens GV3101 to obtain an engineered Agrobacterium tumefaciens strain containing the tomato JAMs gene CRISPR / Cas9 vector.
[0024] In step (2), the tomato explant may be a tomato cotyledon.
[0025] The jams mutant plants with the JAMs gene knocked out can be subjected to normal growth management to obtain stably inherited transgenic F2 generation and subsequent seeds.
[0026] The jams mutant plants with the JAMs gene knocked out can be inoculated with southern root-knot nematodes, and the number of root knots and the phenotype of the plants can be recorded.
[0027] The stress treatment of inoculating with southern root-knot nematodes can be specifically as follows: when the jams mutant plant with the JAMs gene knocked out grows to five leaves and one heart, inoculating with southern root-knot nematodes.
[0028] The inoculated southern root-knot nematodes can be southern root-knot nematodes in the J2 stage with infective activity.
[0029] The duration of inoculation with southern root-knot nematode treatment can be 4 weeks.
[0030] The steps of culturing and inoculating the incognita root-knot nematode in the present invention are as follows:
[0031] 1) The southern root-knot nematode was a gift from Professor Peng Deliang of the Chinese Academy of Agricultural Sciences. The nematodes were propagated in sandy loam soil using ordinary cultivated tomatoes in a greenhouse at the Agricultural Experiment Station, with the room temperature maintained at 22-26°C.
[0032] 2) Rinse the harvested root knots with tap water, soak them in a 0.5% sodium hypochlorite solution for 5 minutes, and then rinse them with distilled water until the pungent smell of sodium hypochlorite disappears.
[0033] 3) Crush the roots and pass the homogenate mixture through 80-mesh, 200-mesh, 325-mesh, and 500-mesh sieves in sequence. Rinse the root debris three times with sterile water and filter. Finally, enrich the root-knot nematode eggs on a 500-mesh sieve.
[0034] 4) Stir the egg suspension evenly, pipette 10μ onto a glass slide, and observe and count the eggs under a 50x optical microscope to estimate the total number of eggs. Calculate the number of nematodes obtained based on a hatching rate of 10% to 20%.
[0035] 5) Pipette the egg suspension onto sterile absorbent paper placed in a 10 cm x 10 cm square culture dish and place in a 28°C constant temperature incubator, making sure to keep the absorbent paper moist.
[0036] 6) After 2-3 days, obtain the J2 nematodes. To avoid worm death, try to inoculate and use them within 24 hours.
[0037] 7) When the jams mutant plants have five leaves and one heart, inoculate them with approximately 1,500 J2 nematodes per plant and water them normally during the inoculation period.
[0038] Plants were grown in plastic cups filled with sterilized river sand. Growth conditions were: day / night temperature 23°C / 20°C, 14 h photoperiod, and 600 μmol m -2 s -1 Light intensity.
[0039] The jams mutant plants were grown with the tomato cultivar Ailsa Craig as blank control.
[0040] After the nematode treatment, the plants were compared with the control group under the same planting conditions without nematode treatment to observe the differences between the jams mutant plants and their blank controls and the plants without stress treatment.
[0041] The method for observing the number of root knots is as follows:
[0042] Acid fuchsin staining was used to observe the root phenotype of root-knot nematode infection. The specific method is as follows:
[0043] (A) Rinse tomato roots infected with root-knot nematodes with tap water and then bleach the roots with 1.5% to 5% sodium hypochlorite solution for 5 minutes, depending on the tenderness of the roots.
[0044] (B) Rinse repeatedly with tap water until the pungent smell of sodium hypochlorite disappears;
[0045] (C) The roots were blotted dry with absorbent paper, boiled in a 3.5% acid fuchsin solution, and then cooled to room temperature.
[0046] (D) Rinse the roots with tap water to remove excess fuchsin liquid on the surface;
[0047] (E) Transfer to acidic glycerol for storage at room temperature;
[0048] (F) Photos were taken and the number of root nodes was counted after 24 h.
[0049] This study showed that jams mutant plants had significantly higher resistance to southern root-knot nematode. BRIEF DESCRIPTION OF THE DRAWINGS
[0050] Figure 1 These are the gene expression diagrams of JAM1, JAM2, and JAM3 in wild-type plants at 0h, 24h, 36h, 48h, and 72h after root-knot nematode infection.
[0051] Figure 2 The graph shows the changes in JAM1 protein levels at 0h, 24h, 36h, 48h, and 72h after root-knot nematode infection in wild-type plants.
[0052] Figure 3 This is the sequencing result of the jam mutant.
[0053] Figure 4 The figure shows the statistical results of the number of root knots in wild-type and jams mutant plants four weeks after inoculation with RKN. jam1 represents the mutant plant with JAM1 gene knockout, jam2 represents the mutant plant with JAM2 gene knockout, and jam1 / jam2 represents the mutant plant with both JAM1 and JAM2 genes knocked out.
[0054] Figure 5 These are the root knot phenotypes of wild-type and jams mutant plants four weeks after inoculation with RKN. The scale bar in the figure is 1 cm. jam1 represents the mutant plant with JAM1 gene knockout, jam2 represents the mutant plant with JAM2 gene knockout, and jam1 / jam2 represents the mutant plant with both JAM1 and JAM2 genes knocked out. DETAILED DESCRIPTION
[0055] The present invention will be further described below in conjunction with the accompanying drawings and specific examples. It should be understood that these examples are intended to illustrate the present invention and are not intended to limit the scope of the invention. The operating methods in the following examples where no specific conditions are specified are generally performed under conventional conditions or as recommended by the manufacturer.
[0056] Unless otherwise specified, the experimental materials and reagents used in the following examples can be obtained from commercial sources.
[0057] Example 1
[0058] Construction and detection of jams mutant plants in tomato
[0059] 1. Extraction of Total RNA from Tomato
[0060] Total RNA from tomato tender roots was extracted using the Tiangen Plant total RNA extraction kit, and the steps were the same as the above-mentioned total RNA extraction method.
[0061] 2. Gene cloning and construction of Agrobacterium tumefaciens engineered bacteria
[0062] The target sequence of tomato JAMs (JAM1, JAM2) gene was designed on the CRISPR-P website (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR). In order to delete and edit the large fragment of the gene, primers were designed. This system uses the U6 promoter, so the linker sequence is added to both ends of the sgRNA recognition sequence. In theory, when two sgRNAs act at the same time, the large fragment between them will be deleted. The synthesized sgRNA forward and reverse primers are annealed to form a double-stranded sgRNA containing a sticky end linker. After diluting 200 times, it is connected to the sgRNA-Cas9 backbone vector that has been digested with BasI enzyme at 16°C overnight. The ligation product is transformed into Escherichia coli DH5α competent cells and cultured in a medium containing ampicillin (Amp + After overnight culture at 37°C in LB solid medium, single clones were picked and PCR was performed using M13F universal primer and annealed downstream primers. Positive single clones were sequenced and identified.
[0063] Using AtU6-F-KpnI as the forward primer and AtsgR-R-EcoRI as the back primer, the second sgRNA sequence was amplified and then ligated into the backbone vector containing the Cas9 sequence. The correctly sequenced positive plasmid was double-digested with HindIII and EcoRI. The recovered fragment was ligated with linearized pCAMBIA1300 overnight and transformed into DH5α competent cells. The cells were cultured overnight at 37°C in solid LB medium supplemented with 50 mg / L kanamycin. Single colonies were picked and positive clones were identified by PCR using primers 1300-seq-R and AtUBQ-seq-R, followed by sequencing.
[0064] The obtained CRISPR / Cas9 vector was transferred into Agrobacterium tumefaciens GV3101 to obtain an engineered Agrobacterium tumefaciens strain containing the tomato JAMs gene CRISPR / Cas9 vector.
[0065] The primer sequences used are as follows:
[0066] sgRNA-JAM1-F1: CTGGTCTCTATTGaacaaagcaccagtggtctagtg (SEQ ID NO: 5)
[0067] sgRNA-JAM1-R1: CTGGTCTCTAAAACAGACGCCACCATAGCtgcaccagccgggaa (SEQ ID NO: 6)
[0068] sgRNA-JAM2-F1:GCTGGTCTCTTTTTgttttagagctagaaatagcaagtta (SEQ ID NO: 7)
[0069] sgRNA-JAM2-R1: CTGGTCTCTCCATAGTCTTATCCTCATCAtgcaccagccgggaa (SEQ ID NO: 8)
[0070] 3. Construction of tomato jams mutant plants
[0071] The target vector was transformed into tomato cotyledons through Agrobacterium-mediated infection, and candidate transgenic plants were initially screened using hygromycin. Transgenic plants were screened using PCR amplification using forward and reverse primers specific to the hygromycin gene sequence. The preparation of the culture medium and the cultivation of sterile seedlings were similar to those for the overexpression plants described above. Transformation and regeneration were performed using an engineered Agrobacterium tumefaciens culture containing the target vector plasmid. Mutant plants were obtained through rooting and transplanting.
[0072] 4. PCR Detection of Jams Mutant Plants in Tomato
[0073] Specific primers were designed near the sequence positions of the sgRNAs targeting the tomato JAMs gene to detect changes in the target gene sequence. The primers are as follows. The fragment length can be detected. Homozygous mutants in JAMs knockout plants can be screened based on the size of the PCR product band and sequencing results.
[0074] M13F: TGTAAAACGACGGCCAGT (SEQ ID NO: 9)
[0075] M36-R: ggtattggtttatctcatcggaactgca (SEQ ID NO: 10)
[0076] Jam mutant sequencing results are shown in Figure 3 .
[0077] Example 2
[0078] jams mutant plants and wild-type tomatoes were inoculated with RKN.
[0079] The specific method for treating tomato jams mutant plants and wild-type tomatoes with root-knot nematodes is as follows:
[0080] The wild-type WT and mutant plants were divided into two groups, one as the control group and the other as the experimental group.
[0081] When the tomatoes grew to five leaves and one heart, the experimental group was inoculated with nematodes, with about 1,500 J2 nematodes per plant, and watered normally during the period.
[0082] Plants were grown in plastic cups filled with sterilized river sand. Growth conditions were: day / night temperature 23°C / 20°C, 14 h photoperiod, and 600 μmol m -2 s -1 Light intensity.
[0083] The nematode treatment period was 4 weeks.
[0084] Example 3
[0085] Gene expression of JAM1, JAM2, and JAM3 in wild type plants at 0h, 24h, 36h, 48h, and 72h after RKN infection.
[0086] The specific method is as follows:
[0087] When tomatoes grew to five leaves and one heart, the plants were inoculated with nematodes. About 1,500 J2 nematodes were inoculated per plant, and root samples were taken for qRT-PCR to detect the expression levels of JAM1, JAM2, and JAM3.
[0088] Real-time fluorescence quantitative PCR (qRT-PCR) was performed using Roche Gene expression analysis was performed using the SYBR Green RT-PCR Kit (NanoVoxan) using a 480II real-time fluorescence detection system. Primers are listed in Table 1. A 20-μL reaction system contained 10 μL of 2× SYBR Green Supermix, 0.4 μL of sense and antisense primers (10 μM), 1 μL of cDNA template, and 8.2 μL of ddH₂O. PCR reaction conditions were: 95°C for 3 min, followed by 40 cycles of denaturation at 95°C for 10 s and annealing at 58°C for 30 s. Fluorescence data were collected at the end of each extension cycle. The tomato Actin gene was used as an internal reference. Relative gene expression was calculated according to the method of Livak and Schmittgen (Analysis of relative gene expression data using real-time quantitative PCR and the 22DDCT method, Methods, 2001, 25:402–408). All experiments were performed in triplicate.
[0089] Table 1 Real-time fluorescence quantitative PCR primers
[0090]
[0091] Example 4
[0092] The specific method of RKN treatment of wild-type tomatoes is as follows: when the tomatoes grow to five leaves and one heart, they are inoculated with nematodes, with approximately 1,500 J2-stage nematodes per plant, and watered normally during the period.
[0093] Tomato root samples were taken at 0 h, 24 h, 36 h, 48 h, and 72 h after inoculation, and protein was extracted and Western Blot was performed. The specific method is as follows:
[0094] A 0.3 g protein sample was placed in a 1.5 mL centrifuge tube, placed in a steel ball mill, and ground into a powder using a sample grinder. An appropriate amount of protein extraction solution was added to form a homogenate. The mixture was placed on ice for 15 min, centrifuged at 12,000 g for 20 min at 4°C, and the supernatant was collected. Protein concentration was determined using the Coomassie Brilliant Blue method. Proteins were separated by SDS-PAGE gel and transferred to a nitrocellulose membrane. The membrane was blocked with TBS buffer (20 mM Tris, pH 7.5, 150 mM NaCl, 0.1% Tween 20) containing 5% skim milk powder for 1 h at room temperature, incubated with JAM1 antibody for 1 h, and then incubated with a goat anti-rabbit HRP secondary antibody (Cell Signaling Technology, 7074) at room temperature for 1 h. The antigen-antibody complex was detected using a luminol chemiluminescence detection kit (Thermo Fisher Scientific, 34080).
[0095] Example 5
[0096] The role of JAMs in tomato resistance to root-knot nematodes
[0097] JAMs, as new regulatory factors that recognize JA responses, are highly similar to MYC2, and their expression patterns are closely related to the expression patterns of JA-responsive genes. Arabidopsis contains two close JAM1 homologs, JAM2 and JAM3. Unlike myc2, the jam1jam2jam3 triple mutant shows enhanced JA-responsive phenotypes, such as shorter roots, higher JA content and anthocyanin accumulation, and higher expression of transcription factors that regulate JA-responsive metabolic pathways. JAM1, JAM2 and JAM3 mainly play an antagonistic role with MYC2 in JA signaling, regulating various metabolic pathways in Arabidopsis. Since MYC2 has been reported to be involved in defense against root-knot nematodes in tomatoes, we found JAM1 and its homologous proteins JAM2 and JAM3 in tomatoes, and induced the gene expression of JAM1, JAM2 and JAM3 48 hours after root-knot nematode infection ( Figure 1 ), to further explore how the protein levels of JAMs change after root-knot nematode infection, we customized JAM1 antibodies and found that the protein level decreased after root-knot nematode infection ( Figure 2 ).
[0098] Thus, we created jams mutant plants and verified their resistance. Figure 4 、 Figure 5 As shown in Figure 3, we found that the jams mutant had significantly fewer root knots than the wild type, and the root knots were smaller than those of the wild type. These results suggest that JAMs are involved in RKN resistance and that JAM1 negatively regulates tomato resistance to the southern root-knot nematode.
[0099] In addition, it should be understood that after reading the above description of the present invention, those skilled in the art may make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.
Claims
1. A method for improving tomato resistance to southern root-knot nematode by knocking out the JAMs gene, characterized in that: The JAMs gene is JAM1 gene and / or JAM2 gene; The base sequence of the JAM1 gene is shown in SEQ ID NO: 1; The base sequence of the JAM2 gene is shown in SEQ ID NO:
3.
2. The method according to claim 1, characterized in that The specific steps include: (1) constructing an Agrobacterium tumefaciens engineered bacterium containing the JAMs gene CRISPR / Cas9 vector; (2) The target tomato explants are transformed by the engineered Agrobacterium tumefaciens to prepare jams mutant plants with JAMs gene knockout.
3. The method according to claim 2, characterized in that In step (2), the tomato explant is a tomato cotyledon.
4. The method according to claim 2 or 3, characterized in that The jams mutant plants with the JAMs gene knocked out are subjected to normal growth management to obtain stably inherited transgenic F2 generation and subsequent seeds.
5. The method according to claim 2, characterized in that The jams mutant plants with the JAMs gene knocked out were inoculated with southern root-knot nematodes, and the number of root knots and the phenotype of the plants were recorded.
6. The method according to claim 5, characterized in that The stress treatment of inoculating with southern root-knot nematodes is specifically as follows: when the jams mutant plant with the JAMs gene knocked out grows to five leaves and one heart, inoculating with southern root-knot nematodes.
7. The method according to claim 5 or 6, characterized in that The inoculated southern root-knot nematodes are in the J2 stage and have infectious activity.
8. The method according to claim 5 or 6, characterized in that The treatment period of inoculation with southern root-knot nematode was 4 weeks.
Citation Information
Patent Citations
Method for improving insect resistance of tomato
CN109912701A
Method for improving resistance of tomatoes to meloidogyne incognita
CN113913456A
Cited By
Application of RKNR3 gene in improving root-knot nematode resistance of plants and method for improving root-knot nematode resistance of tomatoes
CN122168677A