Molecular markers regulating early flowering and dwarfing in maize and their applications

Abstract

The present invention discloses molecular markers and applications thereof for regulating early flowering and short stalks of corn. The present invention provides an application of a material for detecting the genotype of SNP site 275 in the corn genome in at least one of the following: 1) identifying or assisting in identifying the flowering time of corn; 2) identifying or assisting in identifying the height of corn; 3) identifying or assisting in identifying the powder shedding period of corn; 4) identifying or assisting in identifying the silking period of corn; 5) breeding early flowering corn; 6) breeding short stalk corn. The present invention uses the kmads_275 marker to detect corn, and finds that the powder shedding period and silking period of materials with AA genotype and CC genotype are significantly advanced, and the plant height is significantly reduced. Therefore, the genotype of SNP site 275 and its corresponding kmads_275 marker can be used to determine the flowering period and plant height of corn, providing a basis for breeding early flowering or short stalk corn without affecting normal growth and development and yield.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a molecular marker for regulating early flowering and short stalks of corn and an application thereof. Background Art

[0002] Flowering period is an extremely important trait for corn. It not only affects the adaptability of corn to the growing area and its resistance to various adversities, but also has an important impact on corn yield, quality, grain dehydration rate and other traits. Early flowering period has great significance for corn production: (1) shortening the growth period, promoting the planting of the next crop, and changing the rotation pattern of different crops; (2) shortening the vegetative growth time, prolonging the grain filling time, promoting the fullness of the grain, and thus increasing the corn grain yield; (3) Early flowering means early grain dehydration, which reduces the moisture content of the grain at harvest, promotes mechanized harvesting of corn grains, promotes changes in harvesting methods, and improves labor productivity. The corn flowering period regulatory network includes four pathways, namely the photoperiod pathway, the autonomous flowering pathway, the gibberellin pathway, and the age pathway.

[0003] Reasonable plant type is an important basis for high-yield crop varieties. Plant height is one of the most important plant type traits that determine corn yield. Dwarf corn has the characteristics of resistance to lodging, high density tolerance, suitability for mechanized production and high group light energy utilization rate. Properly increasing the planting density of dwarf corn will greatly increase corn yield. Although many genes that affect plant height have been identified in corn, such as an1, d8, d9, bv1, etc., the plants after mutation of these genes are extremely dwarfed, affecting normal growth and development, and cannot be directly applied to corn breeding. Therefore, identifying natural allele variations with moderately reduced plant height is the key to solving the problem of dwarf corn breeding.

[0004] Many studies have shown that flowering period and plant height are correlated to a certain extent. Materials with early flowering period have relatively short plant height due to their shorter vegetative growth period. Given the current demand for early flowering and short stalk materials in corn production, it is particularly urgent to develop molecular markers that can effectively distinguish the flowering period and plant height of different corn inbred lines. Summary of the invention

[0005] The purpose of the present invention is to provide molecular markers related to regulating early flowering and / or short stalks of corn and applications thereof.

[0006] In a first aspect, the present invention provides an application of a substance for detecting the genotype of SNP site 275 in a corn genome in at least one of the following aspects:

[0007] 1) Identify or assist in identifying the flowering time of corn;

[0008] 2) Identify or assist in identifying corn plant height;

[0009] 3) Identify or assist in identifying the corn powder shedding period;

[0010] 4) Identify or assist in identifying the silking stage of corn;

[0011] 5) Breeding early-flowering corn;

[0012] 6) Breeding dwarf corn;

[0013] The SNP site 275 is the 101st position of SEQ ID NO:4.

[0014] In the above application, the genotype of the SNP site 275 is AA, CC or AC.

[0015] In the above application, the substance for detecting the genotype of SNP site 275 in the corn genome is A1) or A2):

[0016] A1) Primer set;

[0017] A2) a PCR reagent or a kit containing the set of primers;

[0018] The set of primers includes primer 1, primer 2 and primer 3;

[0019] The nucleotide sequence of the primer 1 includes the sequence shown at positions 22-41 of SEQ ID NO: 1;

[0020] The nucleotide sequence of the primer 2 includes the sequence shown at positions 22-41 of SEQ ID NO: 2;

[0021] The nucleotide sequence of the primer 3 is SEQ ID NO:3.

[0022] In the above application, the nucleotide sequence of the primer 1 is SEQ ID NO: 1;

[0023] The nucleotide sequence of the primer 2 is SEQ ID NO:2.

[0024] In a second aspect, the present invention provides any of the following substances:

[0025] The set of primers in the first aspect;

[0026] Or, a PCR reagent or kit containing the set of primers described in the first aspect.

[0027] The PCR reagents include primer 1, primer 2, primer 3, and KASP Master mix;

[0028] The ratio of primer 1, primer 2 and primer 3 is 12uM: 12uM: 30uM.

[0029] In the third aspect, the present invention provides the use of the set of primers, PCR reagents or kits described in the second aspect in at least one of the following:

[0030] 1) Identify or assist in identifying the flowering time of corn;

[0031] 2) Identify or assist in identifying corn plant height;

[0032] 3) Identify or assist in identifying the corn powder shedding period;

[0033] 4) Identify or assist in identifying the silking stage of corn;

[0034] 5) Breeding early-flowering corn;

[0035] 6) Breed dwarf corn.

[0036] In a fourth aspect, the present invention provides the following method:

[0037] The present invention provides a method for identifying or assisting in identifying the flowering time and / or plant height of corn, which is to detect whether the genotype of SNP site 275 in the corn genome is AA or CC.

[0038] The flowering time of the tested corn with the genotype of AA at SNP site 275 is earlier or is a candidate to be earlier than that of the tested corn with the genotype of CC at SNP site 275;

[0039] Or / and, the plant height of the tested corn with the genotype of AA at SNP site 275 is smaller or can be smaller than the tested corn with the genotype of CC at SNP site 275.

[0040] Or the present invention provides a method for breeding early-flowering corn, which is to detect whether the genotype of SNP site 275 in the corn genome is AA or CC, select corn with the genotype of SNP site 275 being AA for breeding, and obtain the target corn.

[0041] Or the present invention provides a method for breeding dwarf corn, which is to detect whether the genotype of SNP site 275 in the corn genome is AA or CC, select corn with the genotype of SNP site 275 being AA for breeding, and obtain the target corn;

[0042] The present invention provides a method for breeding early-flowering and short-stalked corn, which detects whether the genotype of SNP site 275 in the corn genome is AA or CC, selects corn with the genotype of SNP site 275 being AA for breeding, and obtains target corn.

[0043] The target corn obtained by the above methods has the following characteristics: early flowering and / or short stalks, normal growth, and no significant change in yield.

[0044] In the method described above,

[0045] The method for detecting whether the genotype of SNP site 275 in the corn genome is AA or CC comprises the following steps: using the corn genome to be tested as a template, performing a KASP reaction with the PCR reagent described in the second aspect, and obtaining the genotype.

[0046] In this study, a recombinant inbred line (RIL) population was constructed using the main maize inbred lines Jing 2416 and Jing 92. By investigating the pollination period, silking period, plant height, ear height, and yield of this population in Beijing, a major QTL locus that simultaneously affects the pollination period, silking period, plant height, and ear height was identified.

[0047] The sequences of Jing 2416 and Jing 92 in the QTL region were amplified, and a key SNP was identified at the genome Chr3:161196684 position. A pair of KASP markers, kmads_275, was developed for this SNP. The early flowering and dwarfing allele of kmads_275 is AA, which comes from Jing 2416, and the other allele is CC, which comes from Jing 92.

[0048] 239 RIL populations were tested using kmads_275 markers, and it was found that the marker fluorescence signal was strong and had a clear typing. The marker genotype was matched with the phenotypes of pollen shedding, silking, plant height, ear height, number of grains per ear, and grain weight per ear. It was found that the AA genotype was 1 day earlier in Beijing pollen shedding, 1 day earlier in silking, 14 cm lower in plant height, and 10 cm lower in ear height than the CC genotype materials, while the number of grains per ear and grain weight per ear were not significantly different. 42 domestic and foreign maize backbone inbred line materials were typed using kmads_275 markers, and the phenotypes of these materials in Liaoning and Henan were analyzed. It was found that the pollen shedding and silking periods of the AA genotype materials were significantly earlier by 4 days than those of the CC genotype materials, and the plant height was significantly reduced by 24 cm. Therefore, the genotype of SNP site 275 and its corresponding kmads_275 marker can be used to determine the flowering period and plant height status of corn, providing a basis for breeding early-flowering or short-stalked corn without affecting normal growth, development and yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 Figure 3 QTL positioning of pollination period, silking period, plant height, ear height, grain weight per ear and grain number per ear in the RIL population in Beijing; the horizontal axis is the chromosome and the vertical axis is the LOD value; the black dotted line in the figure is the threshold line, and QTL is considered to exist if it exceeds the threshold line; the arrows point to the QTL sites that are commonly located for pollination period, silking period, ear height and plant height.

[0050] Figure 2The genotyping results of kmads_275 marker for RIL population; the X-axis is FAM fluorescence, the Y-axis is HEX fluorescence, the black point at the origin of the coordinate axis is the blank control, and the value on the coordinate axis is the fluorescence signal value.

[0051] Figure 3 The genotyping results of kmads_275 marker in 42 backbone maize inbred lines; the X-axis is FAM fluorescence, the Y-axis is HEX fluorescence; the black point at the origin of the coordinate axis is the blank control; the value on the coordinate axis is the fluorescence signal value. DETAILED DESCRIPTION

[0052] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0053] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0054] Example 1. Discovery of SNP markers for detecting plant height and flowering period of maize and establishment of methods

[0055] Experimental Materials:

[0056] The corn inbred lines Jing 92 and Jing 2416 are both excellent backbone inbred lines bred by the Corn Research Institute of Beijing Academy of Agricultural and Forestry Sciences. The flowering period of Jing 2416 is earlier than that of Jing 92, and the plants of Jing 2416 are shorter than those of Jing 92. The plant variety right number of Jing 2416 is CNA004319G, and the plant variety right number of Jing 92 is CNA005911G.

[0057] With Jing 2416 as the female parent and Jing 92 as the male parent, a hybridization was performed to obtain F1, which was then self-pollinated to F2. The F2 plants were self-pollinated, and each F2 plant's self-pollinated ear was planted into one plant, which was self-pollinated again, and one fruit was selected to continue planting until the F6 generation was reached, thus obtaining 239 recombinant inbred lines (RILs).

[0058] 1. Obtaining the traits of flowering period, plant height, and ear height

[0059] The parents Jing 2416, Jing 92 and 239 RIL populations were planted in Beijing, with each material planted in one row (20 plants), the sowing date was recorded, and normal field management was given during the growth period. The investigation methods for each trait are as follows:

[0060] Pollen shedding period: the number of days from sowing to the time when more than half of the male spikes of each material have 1 / 3 of the anthers starting to shed pollen.

[0061] Silking period: the number of days from sowing to the time when more than half of the female ear silks of each material emerge 2 cm from the bracts.

[0062] Plant height: the height of the main stem from the ground to the top of the tassel. Ten plants were surveyed for each material.

[0063] Ear height: the height of the main stem from the ground to the node where the top effective female ear (the first ear from top to bottom) is attached. Ten plants of each material were surveyed.

[0064] Number of grains per ear: The total number of grains per ear. For each material, 10 ears with uniform growth were selected for investigation.

[0065] Grain weight per ear: the total weight of the dried grains in each ear. For each material, 10 ears with uniform growth were selected for investigation.

[0066] The results are shown in Table 1.

[0067] Table 1 shows the phenotypes of pollen shedding, silking period, plant height, ear height, number of grains per ear, and grain weight per ear in 239 RIL populations and their parents in Beijing

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077] 2. QTL mapping of flowering period, plant height, ear height, number of grains per ear, and grain weight per ear

[0078] Using the genetic markers of the RIL population, the composite interval mapping method was used to locate QTLs for pollination period, silking period, plant height, ear height, number of grains per ear, and grain weight per ear. The results showed that ( Figure 1 ), the pollen shedding period, silking period, plant height, and ear height were all located in the same interval on chromosome 3 to a major QTL locus, corresponding to the physical position of the V5 version of the maize reference genome B73 at 160-163Mb. However, this QTL locus was not detected for the number of grains per ear and the weight of grains per ear. This indicates that this QTL only affects the pollen shedding period, silking period, plant height, and ear height.

[0079] 2. Discovery of SNP markers for detecting flowering time and plant height

[0080] The genomic DNA of leaves of Jing 2416 and Jing 92 was extracted, and the segmented primers were designed according to the reference genome B73-Ref V5 sequence to amplify the DNA sequence of the segment, and the PCR amplification products were sequenced for the first generation. The sequencing results showed that there was a difference between Jing 2416 and Jing 92 at Chr3:161196684, and the genotype of this site in Jing 2416 was A, and that in Jing 92 was C. The genotype of this site in Jing 2416 and Jing 92 and the sequence of 100 bp upstream and downstream are shown in SEQ ID NO: 4, where N is A or C; the site is named SNP site 275, and the genotype of this SNP site 275 is AA, CC or AC, and the SNP site is SEQ ID NO: 4, position 101.

[0081] SEQ ID NO: 4:

[0082] TATTTTTCTGTTAATTATAGCTGACTAAAGAGACATTCTGTTATTTTTCTGATAAATACAGCTGACTAAAGTAT

[0083] TTTGCCCCAGAACCGGGATGTAGCTGNTTCAGATTTACAGTCGAGACTTAAGGAGATCGCAACATGGTAACACT

[0084] AAGTTTTCACTACTCTCTCCCAACTTTCTATGTTCAATGGTGGCAACAATGTA

[0085] 3. Development of KASP molecular markers and establishment of detection methods for SNP site 275

[0086] 1. Development of KASP molecular markers

[0087] A pair of KASP markers was developed for SNP site 275, named kmads_275. The primer information of the KASP marker is shown in Table 2:

[0088] Table 2 shows the KASP primer sequences

[0089]

[0090]

[0091] In Table 2, the uppercase letters at the 5' end of Primer 1 are FAM sequences (GAAGGTGACCAAGTTCATGCT, blue), which are on the X-axis. The uppercase letters at the 5' end of Primer 2 are HEX sequences (GAAGGTCGGAGTCAACGGATT, red), which are on the Y-axis.

[0092] The above primers were synthesized by Beijing Tianyi Huiyuan Biotechnology Co., Ltd.

[0093] 2. Establishment of KASP method:

[0094] 1) DNA extraction

[0095] The genomic DNA of the tested corn was extracted using the conventional CTAB method and diluted to a concentration of 10 ng / ul.

[0096] 2) KASP amplification

[0097] The genomic DNA of the above-mentioned sample to be tested is used as a template and kmads_275 is used as a primer for KASP amplification. The primer working solution is composed of a FAM primer, a HEX primer and a Common primer labeled with each KASP, and the concentrations of the FAM and HEX primers are both 12 μM, and the concentration of the Common primer is 30 μM.

[0098] The KASP amplification system is 1ul (using a 1536-well microplate), including 30ng of dried DNA, 0.5μl of KASP2xMaster Mix (LGC, model KBS-1016-011), 0.486μl of deionized water or ultrapure water, and 0.014μl of primer working solution, wherein the final concentrations of FAM primers, HEX primers, and Common primers in the amplification system are 12uM, 12uM, and 30uM.

[0099] The KASP amplification system can also be 3ul (using a 384-well microplate), including 30ng of dried DNA, 1.5μl of KASP2X Mastermix 96 / 384 (LGC, model KBS-1016-003), 1.5μl of deionized water or ultrapure water, and 0.042μl of primer working solution, wherein the final concentrations of FAM primers, HEX primers, and Common primers in the amplification system are 12uM, 12uM, and 30uM.

[0100] The KASP amplification program was as follows: preheating at 95°C for 15 min; 94°C for 20 s, 61-55°C for 1 min (0.6°C reduction per cycle), 10 cycles; 94°C for 20 s, 55°C for 1 min, 26 cycles, end.

[0101] 3) Fluorescence scanning

[0102] The PCR plate that completed the PCR program was scanned using the fluorescence scanner Pherastar, and the typing results were read and output using Kraken software.

[0103] If the fluorescent color of the amplified product is the color of the fluorescent group corresponding to the fluorescent tag sequence in primer 1, the genotype of the tested corn SNP site 275 is CC homozygous;

[0104] If the fluorescent color of the amplified product is the color of the fluorescent group corresponding to the fluorescent tag sequence in primer 2, the genotype of the tested corn SNP site 275 is AA homozygous.

[0105] 4. Detection of the association between KASP markers and flowering period and plant height

[0106] The kmads_275 marker was used to detect the SNP site 275 of the DNA of 239 RIL populations. The method was based on 2 of the above three, and a blank control (no DNA added) was set up.

[0107] The results are as follows Figure 2 As shown in Table 3, it can be seen that the marker has a good typing effect on SNP site 275, can effectively distinguish materials with different genotypes, and has a high amplification efficiency. Among these materials, 157 materials have an AA genotype at SNP site 275, and 82 materials have a CC genotype at SNP site 275 (Table 3).

[0108] Table 3 shows the genotypes of kmads_275 marker in 239 RIL populations

[0109]

[0110]

[0111]

[0112] The genotypes of SNP site 275 of the above 239 RIL populations identified by kmads_275 marker were matched one by one with the phenotypes of flowering period, plant height, ear height, grain weight per ear and number of grains per ear, and a significance test was performed. It was found that the AA genotype material had an earlier pollen shedding period and a earlier silking period than the CC genotype material, a 14 cm lower plant height, and a 10 cm lower ear height, while the phenotypes of number of grains per ear and grain weight per ear were not significantly different (Table 4). This indicates that compared with the CC genotype corn of SNP site 275, the AA genotype corn of SNP site 275 has the effect of early flowering, reduced plant height and / or ear height, but does not affect yield.

[0113] Table 4 shows the significance of the association between kmads_275 marker and phenotype

[0114]

[0115] Therefore, the pollination period, silking period and / or plant height of the tested corn can be identified or assisted in identification by detecting whether the genotype of SNP site 275 in the corn genome is AA or CC;

[0116] The pollen shedding period and / or silking period of the tested corn with the genotype of AA at SNP site 275 is earlier than or is a candidate for being earlier than the tested corn with the genotype of CC at SNP site 275; indicating that the flowering time of the tested corn with the genotype of AA at SNP site 275 is earlier than or is a candidate for being earlier than the tested corn with the genotype of CC at SNP site 275;

[0117] The plant height of the tested corn with the genotype of AA at SNP site 275 is smaller or has a potential to be smaller than the tested corn with the genotype of CC at SNP site 275.

[0118] The above method for detecting whether the genotype of SNP site 275 in the corn genome is AA or CC is to use kmads_275 marker to perform KASP amplification on the corn to be tested (the method is the same as 2 in the above three) to detect the genotype.

[0119] Example 2, application of kmads_275 marker

[0120] 1. Testing of pollination period, silking period, plant height, number of grains per ear, and grain weight per ear

[0121] According to the research of Xiao et al., 42 backbone materials of 9 types of different maize heterosis groups at home and abroad were collected as shown in Table 5, including Huanggai group, Luxi group, P group, X group, Zi330 subgroup, Rede, Improved Rede, Lanka, and Tropical materials; each material is recorded in the following literature: Xiao Y, Jiang S, Cheng Q, Wang X, Yan J, Zhang R, Qiao F, Ma C, Luo J, Li W, Liu H, Yang W, Song W, Meng Y, Warburton ML, Zhao J, Wang X, Yan J. The genetic mechanism of heterosis utilization in maize improvement. Genome Biology. 2021 May 10; 22(1): 148. The phenotypic data of pollination period, silking period, plant height, number of grains per ear, and grain weight per ear of these materials under the spring sowing environment in Liaoning and summer sowing in Henan were obtained, as shown in Table 5.

[0122] Table 5 shows the flowering period, plant height and yield phenotypes of 42 maize backbone inbred lines in Henan and Liaoning

[0123]

[0124]

[0125] 2. Genotype detection of SNP locus 275

[0126] According to the method of Example 1, the 42 materials were genotyped using the kmads_275 marker.

[0127] The flowering time of the tested corn with the genotype of AA at SNP site 275 is earlier or is a candidate to be earlier than that of the tested corn with the genotype of CC at SNP site 275;

[0128] The plant height of the tested corn with the genotype of AA at SNP site 275 is smaller or has a potential to be smaller than the tested corn with the genotype of CC at SNP site 275.

[0129] The results are as follows Figure 3 As shown in Table 6, there are 9 materials corresponding to the AA genotype, which are only distributed in a part of the yellow modified population, while there are 33 materials corresponding to the CC genotype.

[0130] The significance analysis of genotype and phenotype found that the marker can significantly distinguish flowering period and plant height, which is consistent with the actual phenotypic results. The pollen shedding and silking periods of the AA genotype materials in Henan and Liaoning were 4 days earlier than those of the CC genotype materials; at the same time, the plant height of the AA genotype materials in Henan and Liaoning was 24 cm lower than that of the CC genotype materials (Table 7). However, the single ear grain number and single ear grain weight phenotypes of the AA and CC genotype materials were not significant in Henan and Liaoning, indicating that this site did not affect the yield trait. Therefore, the genotype of SNP locus 275 and its corresponding kmads_275 marker can be used to determine the flowering period and plant height status of corn.

[0131] Table 6 shows the genotypes of 42 maize backbone inbred lines

[0132]

[0133]

[0134] Table 7 shows the significance of genotype and phenotype of kmads_275 marker in 42 backbone inbred line populations

[0135]

Claims

1. The use of a substance for detecting the genotype of SNP site 275 in the corn genome in at least one of the following: 1) Identify or assist in identifying the flowering time of corn; 2) Identify or assist in identifying corn plant height; 3) Identify or assist in identifying the corn powder shedding period; 4) Identify or assist in identifying the silking stage of corn; 5) Breeding early-flowering corn; 6) Breeding dwarf corn; The SNP site 275 is the 101st position of SEQ ID NO: 4; The genotype of the SNP site 275 is AA or CC.

2. The use according to claim 1, characterized in that: The substance for detecting the genotype of SNP site 275 in the corn genome is A1) or A2): A1) Primer set; A2) a PCR reagent or a kit containing the set of primers; The set of primers includes primer 1, primer 2 and primer 3; The nucleotide sequence of the primer 1 includes the sequence shown at positions 22-41 of SEQ ID NO: 1; The nucleotide sequence of the primer 2 includes the sequence shown at positions 22-41 of SEQ ID NO: 2; The nucleotide sequence of the primer 3 is SEQ ID NO:

3.

3. The use according to claim 2, characterized in that: The nucleotide sequence of the primer 1 is SEQ ID NO: 1; The nucleotide sequence of the primer 2 is SEQ ID NO:

2.

4. Use of the primer set, PCR reagent or kit according to claim 2 or 3 in at least one of the following: 1) Identify or assist in identifying the flowering time of corn; 2) Identify or assist in identifying corn plant height; 3) Identify or assist in identifying the corn powder shedding period; 4) Identify or assist in identifying the silking stage of corn; 5) Breeding early-flowering corn; 6) Breeding dwarf corn.

5. A method for identifying or assisting in identifying the flowering time and / or plant height of corn, comprising detecting whether the genotype of the SNP site 275 in claim 1 in the corn genome is AA or CC, The flowering time of the tested corn with the genotype of AA at the SNP site 275 is earlier than or is a candidate to be earlier than the tested corn with the genotype of CC at the SNP site 275; Or / and, the plant height of the corn to be tested whose genotype is AA at the SNP site 275 is smaller or may be smaller than that of the corn to be tested whose genotype is CC at the SNP site 275.

6. A method for breeding early-flowering corn, comprising detecting whether the genotype of the SNP site 275 in claim 1 in the corn genome is AA or CC, selecting corn with the genotype of the SNP site 275 being AA for breeding, and obtaining the target corn.

7. A method for breeding dwarf corn, comprising detecting whether the genotype of the SNP site 275 in claim 1 in the corn genome is AA or CC, selecting corn with the genotype of the SNP site 275 being AA for breeding, and obtaining target corn; Or, a method for breeding early-flowering and short-stalked corn, comprising detecting whether the genotype of the SNP site 275 in claim 1 in the corn genome is AA or CC, selecting corn with the genotype of the SNP site 275 being AA for breeding, and obtaining the target corn.

8. The method according to any one of claims 5 to 7, characterized in that: The method for detecting whether the genotype of the SNP site 275 in the corn genome is AA or CC comprises the following steps: using the corn genome to be tested as a template, performing a KASP reaction with the PCR reagent described in claim 4 to obtain the genotype.

Images