A conservative lncrna for treating non-alcoholic fatty liver

By using lnc-CTHCC gene therapy and liver-specific knockout of lnc-CTHCC using adeno-associated virus type 8 vector, the problem of lack of drug targets for non-alcoholic fatty liver disease has been solved, achieving the relief and reversal of non-alcoholic fatty liver disease and providing a basis for clinical treatment.

CN115990184BActive Publication Date: 2026-02-17NANJING DRUM TOWER HOSPITAL
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211326054.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-27
Publication Date
2026-02-17
Estimated Expiration
2042-10-27

AI Technical Summary

Technical Problem

Currently, there are no approved standardized drugs for the treatment of non-alcoholic steatohepatitis (NASH). At present, treatment mainly relies on lifestyle changes, and there is a lack of effective drug targets to prevent it from progressing to liver fibrosis, cirrhosis and liver cancer.

Method used

Using the conserved lncRNA lnc-CTHCC, gene therapy was performed via adeno-associated virus type 8 vector to achieve specific knockout of lnc-CTHCC in liver tissue, thereby alleviating or reversing non-alcoholic fatty liver disease.

Benefits of technology

lnc-CTHCC knockout significantly alleviates or reverses non-alcoholic fatty liver disease, providing a theoretical basis and drug target for clinical treatment. It is homologous to humans and mice and is suitable for animal model studies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115990184B_ABST
    Figure CN115990184B_ABST
Patent Text Reader

Abstract

The application provides an application of a conservative lncRNA in preparation of a medicine for delaying and / or treating non-alcoholic fatty liver, wherein the conservative lncRNA is named as lnc-CTHCC, and the nucleotide sequence of the lnc-CTHCC is shown as SEQ ID NO:1. The lnc-CTHCC knockout provided by the application can obviously relieve or even reverse the non-alcoholic fatty liver, thereby providing a theoretical basis and a drug target for clinical treatment of the non-alcoholic fatty liver.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biotechnology, and particularly relates to a conservative lncRNA for treating non-alcoholic fatty liver. BACKGROUND

[0002] Non-alcoholic fatty liver disease (NAFLD) is a chronic and heterogeneous liver disease. At present, NAFLD has become one of the most common chronic liver diseases in the world, with an incidence of about 25% in adults, and is considered to be closely related to metabolic syndrome and is becoming an important cause of end-stage liver disease. The definition of NAFLD is that more than 5% of hepatocytes have fatty degeneration related to metabolic risk factors (especially obesity and type 2 diabetes), and there is no excessive drinking or other chronic liver disease. It can develop from simple fatty degeneration to non-alcoholic steatohepatitis (NASH). NASH is an inflammatory subtype of NAFLD, characterized by fatty degeneration, insulin resistance, hepatocyte damage and inflammation, with or without fibrosis. NASH patients can further develop liver fibrosis, cirrhosis, and even eventually evolve into hepatocellular carcinoma.

[0003] In addition, more and more evidence shows that obesity is closely related to NASH, and NASH can increase the risk of type 2 diabetes, cardiovascular disease, dyslipidemia, hypertension and chronic kidney disease. Studies have shown that the incidence of NAFLD is increasing year by year, and by 2030, the number of NAFLD patients in China will reach 315 million, of which NASH accounts for 15% of all NAFLD patients, which will increase to 48.26 million cases.

[0004] However, so far, there is no standard drug approved for the treatment of NASH. At present, the main treatment method for NASH is to change the lifestyle. Therefore, it is of great significance to actively seek key targets that can alleviate or reverse NASH and prevent it from developing into liver fibrosis, cirrhosis and liver cancer for the development of clinical prevention and treatment of NASH. SUMMARY

[0005] In view of the above prior art, the present application provides a conservative lncRNA for treating non-alcoholic fatty liver.

[0006] The application provides an application of a conservative lncRNA in preparation of a medicine for delaying and / or treating non-alcoholic fatty liver, wherein the conservative lncRNA is named lnc-CTHCC, and the nucleotide sequence of the lnc-CTHCC is shown as SEQ ID NO: 1.

[0007] Preferably, the medicine comprises a pharmaceutically acceptable carrier.

[0008] Preferably, the vector is an adeno-associated viral vector.

[0009] Preferably, the vector is an adeno-associated viral vector of type 8.

[0010] The beneficial effects of the present application relative to the prior art are:

[0011] 1、The lnc-CTHCC involved in the present application has high conservation and human-mouse homology, allowing it to be studied on a model animal mouse.

[0012] 2、The adeno-associated viral vector used in the present application is a liver high-affinity drug carrier, and through gene therapy, the specific knockout of lnc-CTHCC in liver tissue can be achieved.

[0013] 3、The knockout of lnc-CTHCC involved in the present application can significantly alleviate or even reverse non-alcoholic fatty liver, thereby providing a theoretical basis and drug target for the clinical treatment of non-alcoholic fatty liver. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 It is an experimental schematic diagram of the HFD diet group in the embodiment of the present application.

[0015] Figure 2 It is a serum detection result schematic diagram of the HFD diet group in the embodiment of the present application.

[0016] Figure 3 It is a staining result schematic diagram of the formaldehyde-fixed liver tissue and the fat-fixing fluid-fixed fat tissue of the HFD diet group in the embodiment of the present application.

[0017] Figure 4 It is an observation result schematic diagram of the electron microscope fixing fluid-fixed liver tissue of the HFD diet group in the embodiment of the present application.

[0018] Figure 5 、 6 It is a related index detection result schematic diagram of the liquid nitrogen quick-frozen liver tissue of the HFD diet group in the embodiment of the present application.

[0019] Figure 7 It is an experimental schematic diagram of the WD diet group in the embodiment of the present application.

[0020] Figure 8 It is a serum detection result schematic diagram of the WD diet group in the embodiment of the present application.

[0021] Figure 9 It is a staining result schematic diagram of the formaldehyde-fixed liver tissue and the fat-fixing fluid-fixed fat tissue of the WD diet group in the embodiment of the present application.

[0022] Figure 10 The schematic diagram of observation results of liver tissues fixed by electron microscope fixing solution of WD diet group in the embodiment of the present application.

[0023] Figure 11 、 12 The schematic diagram of detection results of related indexes of liver tissues rapidly frozen by liquid nitrogen of WD diet group in the embodiment of the present application. DETAILED DESCRIPTION

[0024] In order to make the technical means, creative features, purposes and effects realized by the present application easy to understand, the present application is further described below in combination with specific embodiments. EMBODIMENT

[0025] I. Preparation of adeno-associated virus for knocking out lnc-CTHCC

[0026] 1. Design and screen effective sgRNA sequences:

[0027] A plurality of sgRNA sequences were designed and synthesized for the full-length sequence of mouse lnc-CTHCC:

[0028] sgRNA1: CTGTTTATTGCTCGCTCCCGT;

[0029] sgRNA2: AGTTCTGTGCTGATTCGGGTC;

[0030] sgRNA3: GTCTGTAAGTTCTGTGCTGAT;

[0031] sgRNA4: TCCCCAACAGCCTGACAACTG;

[0032] sgRNA5: CCTCCAGTTGTCAGGCTGTTG.

[0033] The above sgRNA sequences were respectively constructed on an sgRNA in vitro verification vector, which carries a saCas9 protein gene; 4x10 5

[0034] 2. AAV8 packaging and titer detection:

[0035] ​The selected sgRNA1 sequence, CTGTTTATTGCTCGCTCCCGT, was constructed into an adeno-associated virus vector. The vector was pAV-CMV-SaCas9-U6-sagRNA, which was packaged into adeno-associated virus type 8. The titer was detected by real-time quantitative PCR.

[0036] II. Constructing a non-alcoholic fatty liver model

[0037] All WT (C57BL / 6 background) mice were housed in a specific pathogen-free (SPF) facility, maintained at a temperature of 20±2℃ and humidity of 40-60%, with alternating 12-hour light and 12-hour dark environments, and provided with ample water and feed. At 8 weeks of age, the mice were divided into four groups of six each. Two groups were fed a high-fat diet (HFD), while the other two groups were fed a western diet (WD) and fructose-fed drinking water, all for 16 weeks, inducing two non-alcoholic fatty liver disease models.

[0038] III. Validation of Targeted Lnc-CTHCC Treatment for Nonalcoholic Fatty Liver Disease

[0039] Mice that had developed non-alcoholic fatty liver disease were grouped as follows: Figure 1 As shown, two groups of mice were fed an HFD diet. One group was injected with AAV-Control virus, and the other group was injected with AAV-KO virus. The required viral load per mouse was 1 × 10⁻⁶. 11 vg, with a volume of 200 μl. For example... Figure 7 As shown, two groups of mice were fed the WD diet. One group was injected with AAV-Control virus, and the other group was injected with AAV-KO virus. The required viral load per mouse was 1×10⁻⁶. 11 Vg, volume 200 μl. Continue HFD and WD diets for 8 weeks respectively. Visit the animal room weekly to observe the mice's condition and record their weight. After 24 weeks of HFD and WD diets, collect mouse serum, weigh liver and adipose tissue, and photograph them. Part of the liver tissue was fixed with paraformaldehyde and electron microscopy fixative, and part of the adipose tissue was fixed with fat fixative. The remaining liver and adipose tissues were flash-frozen in liquid nitrogen and stored at -80°C.

[0040] 1. Serum ALT and AST levels were measured to analyze liver function. Results for the HFD diet group are as follows: Figure 2 As shown, the test results of the WD diet group are as follows: Figure 8 As shown.

[0041] 2. Paraformaldehyde-fixed liver tissues were subjected to the following staining methods: H&E staining to observe liver lesions in each group of mice, including ballooning degeneration, fatty degeneration, and inflammation; Oil Red staining to observe lipid deposition in the liver tissues of each group of mice; and Masson's red, Sirius red, and α-SMA staining to determine the severity of liver fibrosis in each group of mice. The staining results for the HFD diet group are shown below. Figure 3 As shown, the staining results of the WD diet group are as follows: Figure 9 As shown.

[0042] 3. Adipose tissue fixed with fat fixative was stained with H&E to observe the size of adipocytes. The staining results for the HFD diet group are shown below. Figure 3 As shown, the staining results of the WD diet group are as follows: Figure 9 As shown.

[0043] 4. Liver tissue fixed with electron microscopy fixative was examined under an electron microscope to observe the lipid droplets within the liver tissue, including their size and number. The observation results for the HFD diet group are as follows: Figure 4 As shown, the observation results of the WD diet group are as follows: Figure 10 As shown.

[0044] 5. Liver tissue flash-frozen in liquid nitrogen was used to extract RNA, which was then reverse transcribed into cDNA. Real-time quantitative PCR was used to detect indicators related to inflammation (Tnf, Il1b, Il6, Ccl2, etc.), fibrosis (Col1a1, Acta2, Tgfb1, Desmin, Gfap, etc.), and lipid metabolism (Fatp1, Fapp1, Cd36, Fasn, Pparg, Scd1, Srebf1, Ppara, etc.). The results for the HFD diet group are as follows: Figure 5 , 6 As shown, the test results of the WD diet group are as follows: Figure 11 , 12 As shown.

[0045] The above are merely embodiments of the present invention and do not limit the patent scope of the present invention. Any equivalent structures made using the content of the present invention specification, whether directly or indirectly applied to other related technical fields, are similarly within the patent protection scope of the present invention.

Claims

1. The use of a sgRNA with a knockout conserved lncRNA in the preparation of a drug for delaying and / or treating non-alcoholic fatty liver disease, wherein the conserved lncRNA is named lnc-CTHCC, the nucleotide sequence of lnc-CTHCC is shown in SEQ ID NO:1, and the sequence of the sgRNA is: CTGTTTATTGCTCGCTCCCGT.

2. The application as described in claim 1, characterized in that, The drug is contained in a pharmaceutically acceptable carrier.

3. The application as described in claim 2, characterized in that, The vector is an adeno-associated virus vector.

4. The application as described in claim 2 or 3, characterized in that, The vector is adeno-associated virus type 8 vector.

Citation Information

Patent Citations

  • Preparation method of lncRNA marker for non-alcoholic steatohepatitis

    CN112626197A