Method for constructing rice dominant cytoplasmic male sterile material based on EAT1 gene and application thereof

Abstract

This invention provides a rice dominant nuclear male sterility expression vector constructed based on the EAT1 gene and its application. The expression vector has... Ubiquitin Promoters and genes for male flower development in rice EAT1 It is formed by operable connections. Specific construction methods include: obtaining rice cDNA and using it as a template, employing... EAT1 Gene-specific primer amplification EAT1 Genes were extracted to obtain PCR product fragments; these PCR product fragments were then ligated into genes containing... Ubiquitin The expression vector is obtained by placing the promoter in a skeletal vector. Transgenic plants obtained using this expression vector exhibit dominant nuclear male sterility, and dominant nuclear male sterile rice lines can be created through hybridization. Recurrent selection breeding using these dominant nuclear male sterile lines can rapidly eliminate non-target materials, efficiently aggregate multiple superior traits and genes, and does not contain transgenic components, effectively improving breeding efficiency and safety.

Description

Technical Field

[0001] This invention relates to the fields of breeding and plant genetic engineering technology, specifically to a method for constructing dominant nuclear male-sterile rice materials based on the EAT1 gene and its application. Background Technology

[0002] Rice ( Oryza sativa Rice (L.) is one of the world's most important food crops, with more than half of the world's population (over 60% in my country) relying on it as their staple food. With global climate change, population growth, and decreasing arable land, the global food crisis is becoming increasingly severe. Therefore, increasing the yield of food crops, especially rice, is extremely important.

[0003] Practice has proven that fully utilizing modern molecular biology research methods to continuously explore new rice male-sterile gene resources and create various male-sterile lines is an effective means to increase rice yield. However, most rice male-sterile lines are recessive nuclear male-sterile, requiring corresponding maintainer lines and propagation technology systems, which presents many difficulties in actual production. In contrast, the sterility of dominant nuclear male-sterile materials is controlled by dominant genes. When fertile materials are crossed with them, the offspring consist of an equal number of fertile and sterile plants, which is of great significance for hybrid seed production. Using dominant nuclear male-sterile lines, large-scale recurrent selection breeding can be carried out to efficiently aggregate multiple superior traits and genes (such as high yield, disease resistance, and stress resistance). Therefore, research on dominant nuclear male-sterile materials has always been a hot topic.

[0004] In recent years, more than 40 genes related to male fertility in rice have been cloned, such as OsMS1, GAMYB, UDT1, TDR, and EAT1. Many of these genes encode transcription factors that affect pollen and tapetal development by regulating the expression of downstream related genes. Among them, the EAT1 gene encodes a bHLH-type transcription factor that initiates programmed cell death in the anther tapetum by activating the expression of two genes encoding aspartic proteases, OsAP25 and OsAP37 (Reference: Niu N, Liang W, Yang X, et al. EAT1 promotes tapetal cell death by regulating aspartic proteases during male reproductive development in rice[J]. Nature Communications, 2013, 4: 1445). The EAT1 loss-of-function mutant created by gene knockout exhibits recessive nuclear male sterility, and its heterozygous offspring show simple Mendelian segregation, which does not maintain sterility, thus greatly limiting its application in production. On the other hand, existing studies have found that overexpression of bHLH transcription factors such as TIP2 and TDR leads to male sterility in rice plants through the creation of overexpression vectors, and this trait may be dominant (Reference: Ko SS, Li MJ, Ho YC, et al. Rice transcription factor GAMYB modulates bHLH142 and is homeostatically regulated by TDR during anther tapetal and pollen development[J]. Journal of Experimental Botany, 2021, 72(13): 4888–4903). However, there are currently no reports on the application of these genes in breeding, nor are there any studies on constructing overexpression materials for the EAT1 gene. This invention aims to provide a new method for creating dominant nuclear male sterility materials based on the overexpression of the EAT1 gene. Summary of the Invention

[0005] To address the problems and deficiencies of existing technologies, this invention provides a method for constructing dominant nuclear male-sterile rice lines based on the EAT1 gene and its application. This method can be used to create dominant nuclear male-sterile rice lines and to conduct recurrent selection breeding using these lines. It can rapidly eliminate non-target materials, efficiently aggregate multiple superior traits and genes, and effectively improve breeding efficiency. The technical solution of this invention is as follows:

[0006] In a first aspect, the present invention provides a rice dominant nuclear male sterility expression vector constructed based on the EAT1 gene, wherein the expression vector is composed of... Ubiquitin It is formed by the operative linking of the promoter and the rice male flower development gene EAT1.

[0007] The rice male flower development gene EAT1 has the function of initiating programmed cell death in the tapetum, and its sequence is shown in SEQ ID NO.2. Currently, only the loss of EAT1 function has been found to affect rice pollen development, confirming that EAT1 is necessary for rice to maintain normal fertility. This invention further confirms that overexpression of the EAT1 gene also leads to male sterility in rice. A series of analyses revealed that overexpression of EAT1 causes premature degradation of the anther tapetum, a finding that has never been reported before.

[0008] Ubiquitin The promoter, derived from maize, controls constitutive gene expression, and its sequence is shown in SEQ ID NO.1. Secondly, this invention provides a method for constructing the above-mentioned expression vector, comprising:

[0009] Rice cDNA was obtained and used as a template to amplify the EAT1 gene using specific primers for the EAT1 gene, resulting in PCR product fragments.

[0010] PCR product fragments were ligated into... Ubiquitin It is obtained in the promoter skeleton carrier.

[0011] Furthermore, the specific primers include the upstream primer EAT1-OE-F and the downstream primer EAT1-OE-R, with sequences shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0012] Thirdly, the present invention provides the application of the above-mentioned expression vector in regulating the fertility of rice plants.

[0013] Fourthly, this invention provides a method for constructing a dominant nuclear male-sterile rice plant, which uses the aforementioned expression vector. The construction method includes:

[0014] Step 1: Transform the expression vector into Agrobacterium and culture it;

[0015] Step 2: Infect rice callus tissue with the obtained Agrobacterium containing the expression vector, and then perform dedifferentiation and redifferentiation treatment;

[0016] Step 3: Harden the seedlings and transplant them for further cultivation.

[0017] Fifthly, the present invention provides a method for constructing a dominant nuclear male-sterile rice line, which is obtained by using a dominant nuclear male-sterile rice plant obtained by the above construction method as the female parent and a fertile rice as the male parent, and then obtaining the line through hybridization.

[0018] Sixthly, the present invention provides a method for identifying the above-mentioned dominant nucleomale sterile rice line, which involves extracting RNA from the leaves of the rice dominant nucleomale sterile line obtained by the above-mentioned construction method and reverse transcribing it into cDNA, using the cDNA as a template, and then... EAT1 Primer pairs for gene identification EAT1 Genes were subjected to qPCR reaction, and then compared with wild-type genes. EAT1 The expressions are compared, among which EAT1 The expression level of the gene was significantly higher than that of the wild type, indicating a dominant nuclear male sterile line in rice. The standard for "significantly higher" was P < 0.05, t-test.

[0019] Furthermore, the leaves are taken from rice dominant nuclear male sterile lines at any stage of growth, from seedling to maturity.

[0020] Furthermore, the identification primers include upstream primer EAT1-RT-F1 and downstream primer EAT1-RT-R1, with sequences shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.

[0021] Furthermore, the identification method uses the OsActin1 gene as an internal reference gene, and the internal reference primers include the upstream primer Actin1-RT-F1 and the downstream primer Actin1-RT-R1, with sequences shown in SEQ ID NO.7 and SEQ ID NO.8, respectively.

[0022] In a seventh aspect, the present invention provides a method for recurrent selection breeding using dominant nucleomale-sterile rice plants, comprising:

[0023] (1) Using the above-mentioned dominant nuclear male sterile rice plants as the female parent and rice with excellent traits and genes as the male parent, hybridize them and harvest F1 seeds;

[0024] (2) F1 seeds were planted and artificially isolated. Sterile and fertile plants were separated during the heading stage. Sterile plants were used as female parents and pollinated with pollen from fertile plants. The seeds on the sterile plants were harvested as seeds for the first round of selection population.

[0025] (3) Plant the seeds of the first round of selection population and isolate them artificially. During the heading period, separate the sterile plants and fertile plants. Similarly, use the sterile plants as the female parent, pollinate them with the pollen of the fertile plants, and harvest the seeds from the sterile plants as the seeds of the second round of selection population.

[0026] (4) Repeat step (3) several times according to the breeding needs to obtain several rounds of selection populations.

[0027] This invention is the first to discover that overexpression of EAT1 leads to premature degradation of the rice anther tapetum, providing a new theoretical reference for further understanding the relationship between the expression homeostasis of related genes and tapetum development. Furthermore, by utilizing the constitutive promoter Ubiquitin to drive EAT1 gene expression, the expression level of the EAT1 gene was increased in transgenic rice plants, creating genetic material with dominant male sterility.

[0028] The transgenic plants obtained by this invention can be rapidly and accurately detected for EAT1 gene overexpression at any stage of their growth and development using leaf qPCR, without the need for detection based on specific time periods and tissue sites, thus saving a great deal of time.

[0029] Furthermore, the dominant male-sterile line material created in this invention can be used as a medium to quickly eliminate non-target materials in recurrent selection breeding, efficiently aggregate multiple superior traits and genes (such as high yield, disease resistance, and stress resistance), and effectively improve breeding efficiency. At the same time, since rice containing the pUbi-EAT1 vector is sterile, the seeds harvested from fertile plants do not contain transgenic components, which helps to promote its green and safe application. Attached Figure Description

[0030] Figure 1 This is a plasmid map of pUbi-EAT1, the genetic transformation vector for dominant nucleo-male sterile rice.

[0031] Figure 2 The relative expression levels of the EAT1 gene in the young florets of wild-type and pUbi-EAT1 transgenic plants in Example 2 of this invention are shown.

[0032] Figure 3 The images show a comparison of florets and pollen of wild-type plants and pUbi-EAT1 transgenic plants in Example 2 of this invention. Figures a, b, and c show the phenotypes of florets and floral organs of wild-type plants and the pollen iodine staining, respectively. Figures d, e, and f show the phenotypes of florets and floral organs of pUbi-EAT1 transgenic plants and the pollen iodine staining, respectively.

[0033] Figure 4 These are comparative images of semi-thin anther sections of wild-type plants and pUbi-EAT1 transgenic plants in Example 2 of the present invention. Figures a, b, and c show the pollen structure of the wild-type plants at stages 8a, 8b, and 9, respectively; figures d, e, and f show the pollen structure of the pUbi-EAT1 transgenic plants at stages 8a, 8b, and 9, respectively; figures g, h, and i show the pollen structure of the wild-type plants at stages 10, 11, and 12, respectively; and figures j, k, and l show the pollen structure of the pUbi-EAT1 transgenic plants at stages 10, 11, and 12, respectively.

[0034] Figure 5 This is an example of the positive overexpression of the EAT1 gene rapidly identified by leaf qPCR in Example 3 of the present invention.

[0035] Figure 6 The images show the pollen fertility of the EAT1 gene overexpression positive plants identified in Example 3 of this invention. Figure a shows the pollen iodine staining of the wild-type plant; Figures b, c, d, e, f, g, h, i, j, k, l, m, n, o, and p show the pollen iodine staining of the overexpression positive plants numbered #7, #8, #15, #28, #31, #33, #34, #38, #42, #43, #44, #47, #48, #49, and #50, respectively.

[0036] Figure 7 This is a flowchart illustrating the technical process of the rice recurrent selection breeding method based on the dominant nuclear male sterile vector pUbi-EAT1 in Embodiment 4 of the present invention. Detailed Implementation

[0037] The skeletal vector pRHV was provided by Professor Chen Xuewei's research group at Sichuan Agricultural University and has been published in previous papers (He F, Zhang F, Sun W, et al. A Versatile vector toolkit for functional analysis of rice genes[J]. Rice, 2018, 11(1):27).

[0038] In the description of this invention, it should be noted that unless specific conditions are specified in the examples, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0039] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These descriptions are for illustrative purposes only and are not intended to limit the scope of the invention.

[0040] Example 1

[0041] Construction and genetic transformation of the dominant nuclear male sterility vector pUbi-EAT1

[0042] 1.1 Using the japonica rice variety Nipponbare as material, total RNA was extracted from rice using the Plant Total RNA Isolation Kit (Foregene) (all EP tubes and pipette tips were treated with DNA / RNase-free methods). Subsequently, reverse transcription was performed using the HiScript II Reverse Transcriptase (Vazyme) kit, prepared according to the manufacturer's instructions, to obtain cDNA.

[0043] 1.2 Using the cDNA from the previous step as a template, EAT1 Gene-specific primer amplification EAT1 The gene was analyzed, yielding a PCR product fragment of approximately 1400 bp. The primer sequences used are as follows:

[0044] EAT1-OE-F: SEQ ID NO.3

[0045] tccccgggtgagctcggtaccATGATTGTTGGGGCTGGTTACT (lowercase represents the vector homologous arm sequence; ggtacc is the KpnI restriction site);

[0046] EAT1-OE-R: SEQ ID NO.4

[0047] agcggccgcactagtaagcttTTAGTTGAATATGTCGAGGGCCT (lowercase letters represent the vector homologous arm sequence; aagctt is the HindIII restriction site).

[0048] The sequence of the rice male flower development gene EAT1 is shown in SEQ ID NO.2.

[0049] 1.3 After recovering the amplification product from the gel, it was ligated into a gel containing... Ubiquitin The resulting vector, named pUbi-EAT1, was created from the pRHV vector containing the promoter; this vector also carries the hygromycin resistance gene. Hpt The plasmid map of pUbi-EAT1 is as follows: Figure 1 As shown. Ubiquitin The promoter is derived from maize and controls the constitutive expression of the gene; its sequence is shown in SEQ ID NO.1.

[0050] 1.4 Refer to Hiei (Hiei Y, Ohta S, Komari T, et al. Efficient transformation of rice ( Oryza sativa L.) mediated by AgrobacteriumThe pUbi-EAT1 vector constructed in this invention was transformed into Agrobacterium EHA105 using the method described in Plant Journal, 1994, 6(2): 271–282. The specific method is as follows: Approximately 100 ng of plasmid was added to 100 μL of Agrobacterium EHA105 competent cells thawed on ice. The mixture was then incubated sequentially on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and on ice for 5 min. 500 μL of antibiotic-free YEB liquid medium was added, and the mixture was incubated at 28°C and 200 rpm for 2–3 h. The culture was then plated onto solid YEB plates containing 50 mg / L rifampicin and 50 mg / L kanamycin and incubated for 2–3 days. After bacterial growth, single colonies were picked and identified as positive by PCR.

[0051] 1.5 The *Agrobacterium*-mediated infection and transformation method was used to introduce the *Agrobacterium* into the callus tissue of the recipient rice material *Nishimura*, specifically following the methods described in existing studies (Nishimura, et al. A protocol for...). Agrobacterium -mediated transformation in rice[J]. Nature Protocols, 2006,1:2796–2802). Positive tissues were screened on hygromycin medium and further dedifferentiated and redifferentiated. After one to two weeks of hardening off, the seedlings were transplanted into a greenhouse for cultivation to obtain transgenic rice plants.

[0052] Example 2

[0053] Phenotypic observation of pUbi-EAT1 transgenic plants

[0054] 2.1 EAT1 Gene expression level detection

[0055] Young flower samples were ground in liquid nitrogen, and total RNA was extracted using the Plant Total RNA Isolation Kit (Foregene) (all EP tubes and pipette tips were treated with DNA / RNase-free methods). Subsequently, reverse transcription was performed using the HiScript II Reverse Transcriptase (Vazyme) kit, prepared according to the manufacturer's instructions, to obtain cDNA. Further utilization... EAT1 Gene identification primers were used for qPCR reactions, and the genes were identified by interaction with wild-type (WT) genes. EAT1By comparing the expression of [elements], we can determine the [specific characteristics] in transgenic plants. EAT1 Whether it is overexpressed. For example Figure 2 As shown, in the pUbi-EAT1 transformed lines EAT1 The relative expression levels of the genes were all higher than those of WT. The identification primers were:

[0056] EAT1-RT-F1: SEQ ID NO.5

[0057] CAGAGGAGGTCAAAGGAATG

[0058] EAT1-RT-R1: SEQ ID NO.6

[0059] CCGAACCTTCTGATACCTTAGT

[0060] 2.2 Phenotypic Observation

[0061] Select spikelets from various rice materials at the heading stage and observe the anther morphology by opening them with tweezers. Add a drop of distilled water to a glass slide, crush the stamens with tweezers, and stain with iodine-potassium iodide (I2-KI) solution. Observe under an optical microscope to determine pollen fertility. Figure 3 As shown, the anthers of transgenic plant #3 are noticeably small and pale yellow, and the pollen grains cannot be stained by I2-KI dye, indicating that the transgenic plant transformed with the pUbi-EAT1 vector exhibits male sterility.

[0062] Further observation was conducted by performing semi-thin sections of the anthers. For example... Figure 4 As shown, the anthers of both WT and pUbi-EAT1 vector-transformed plants differentiated into pollen mother cells, epidermis, endodermis, mesoderm, and tapetum, and oval-shaped meiotic cells appeared in phase 8a. However, in phase 8b, the tapetum of pUbi-EAT1-transformed plants showed abnormal swelling ( Figure 4 e). As the florets continue to develop, the tapetum of WT gradually degrades and disappears completely by stage 12, while the tapetum of pUbi-EAT1 transformed plants has already degraded completely by stage 11. Figure 4 (k), significantly earlier than WT. During rice pollen development, the tapetum gradually degenerates to provide nutrients for microspore development; this process must be precise. Previous studies have shown... EAT1 The loss of function will delay the degradation of the tapetum, thereby causing pollen abortion; and this invention is the first to discover EAT1 Overexpression can lead to premature degradation of the tapetum, ultimately resulting in pollen abortion.

[0063] Example 3

[0064] Methods for the creation and rapid identification of pUbi-EAT1 dominant nuclear male sterile lines

[0065] 3.1 Creation of the pUbi-EAT1 Dominant Nuclear Sterile Line

[0066] Using pUbi-EAT1 transformed rice plants as the female parent and other fertile rice varieties with the same or different genetic backgrounds as the male parent, sterile lines were created through hybridization. In the F1 generation, sterile and fertile plants separated in a 1:1 ratio, and all carried… EAT1 Plants that overexpressed the genotype all exhibited male sterility, indicating dominant inheritance. The male parent in this example was the japonica rice variety Nipponbare. The fertility statistics are shown in Table 1, with a ratio of sterile plants to fertile plants of approximately 41:50:1:1.

[0067] Table 1. 91 individual plants from the F1 generation population EAT1 Expression level and fertility statistics

[0068]

[0069] 3.2 Rapid Identification EAT1 Gene overexpression positive plants

[0070] The seeds produced by the above hybridization were planted in a greenhouse. At any stage of the seed's growth, from seedling to maturity, leaves were taken to extract RNA, which was then reverse transcribed into cDNA. Utilizing... EAT1 Gene identification primers were used for qPCR reactions, and the results were obtained by comparing the gene with wild-type genes. EAT1 Comparison of expression, overexpression in plants EAT1 The expression level was significantly higher in the α group than in the wild type; OsActin1 The gene is used as an internal reference. The identification primers are:

[0071] EAT1-RT-F1: SEQ ID NO.5

[0072] CAGAGGAGGTCAAAGGAATG

[0073] EAT1-RT-R1: SEQ ID NO.6

[0074] CCGAACCTTCTGATACCTTAGT

[0075] The internal reference primer:

[0076] Actin1-RT-F:CCTTCAACACCCCTGCTATG (SEQ ID NO.7)

[0077] Actin1-RT-R:CAATGCCAGGGAACATAGTG (SEQ ID NO.8)

[0078] In this example, leaves were selected at the jointing stage. The qPCR results of all plants carrying the pUbi-EAT1 vector are as follows: Figure 5 As shown, EAT1 The expression levels of all genes were significantly higher than those of WT.

[0079] To verify the qPCR results, plant fertility was assessed during the heading stage by direct observation or pollen iodine staining. The fertility statistics are shown in Table 2, and some pollen iodine staining results are as follows: Figure 6 As shown, all plants identified as overexpressing positive by leaf analysis exhibited pollen abortion, with 100% accuracy.

[0080] Table 2. Leaves EAT1 Expression level and plant fertility statistics

[0081]

[0082] Example 4

[0083] Rice recurrent selection breeding method based on dominant nuclear male sterility vector pUbi-EAT1

[0084] A method for rice recurrent selection breeding based on the dominant nuclear male sterility vector pUbi-EAT1, the specific steps of which are as follows (e.g.) Figure 7 (as shown)

[0085] (1) Using rice dominant nuclear male sterile materials carrying the pUbi-EAT1 vector as the female parent and rice varieties or materials with excellent traits and genes such as high yield, disease resistance, and high quality as the male parent, hybridization was carried out and F1 seeds were harvested.

[0086] (2) F1 seeds are mixed and planted and artificially isolated. During the heading stage, 50% sterile plants and 50% fertile plants will be separated. The sterile plants with excellent agronomic traits are used as the female parent and pollinated with the pollen of the fertile plants. The seeds on the sterile plants are harvested as the seeds of the first round of selection population.

[0087] (3) Plant the seeds obtained in the previous step and isolate them artificially. During the heading stage, continue to separate 50% sterile plants and 50% fertile plants. Similarly, use the sterile plants with excellent agronomic traits as the female parent, pollinate them with the pollen of the fertile plants, and harvest the seeds from the sterile plants as the seeds for the second round of selection population.

[0088] (4) Repeat step (3) to obtain the 3rd to nth round of recurrent selection populations, and add donors with target traits and genes to the recurrent selection populations according to breeding needs;

[0089] (5) Harvest the fertile single plants with excellent traits from the above steps, and identify plants that meet the breeding objectives by combining genotype identification and molecular marker-assisted selection. This results in new germplasm that integrates multiple excellent traits and genes. At the same time, since rice containing the pUbi-EAT1 vector is sterile, the transgenic components are screened out while harvesting the seeds of fertile plants, which helps to promote and apply the technology in a green and safe manner.

[0090] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. The application of an expression vector based on the EAT1 gene in regulating the dominant nuclear male sterility phenotype in rice plants, wherein the method for constructing the expression vector includes: Rice cDNA was obtained and used as a template to amplify the EAT1 gene using specific primers for the EAT1 gene, resulting in PCR product fragments. PCR product fragments were ligated into... Ubiquitin The expression vector is obtained by placing it in the promoter skeleton vector.

2. The application according to claim 1, characterized in that: The specific primers include the upstream primer EAT1-OE-F and the downstream primer EAT1-OE-R, with sequences shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

3. A method for constructing a dominant nuclear male-sterile rice plant, characterized in that: The construction method includes: Step 1: Construct an expression vector based on the EAT1 gene. The construction method includes: Rice cDNA was obtained and used as a template to amplify the EAT1 gene using specific primers for the EAT1 gene, resulting in PCR product fragments. PCR product fragments were ligated into... Ubiquitin The expression vector is obtained by placing it in the promoter skeleton vector; Step 2: Transform the expression vector into Agrobacterium and culture it; Step 3: Infect rice callus tissue with the obtained Agrobacterium containing the expression vector, and then perform dedifferentiation and redifferentiation treatment; Step 4: Harden the seedlings and transplant them for further cultivation.

4. The method for constructing a dominant nucleus male-sterile rice plant according to claim 3, characterized in that: The specific primers include the upstream primer EAT1-OE-F and the downstream primer EAT1-OE-R, with sequences shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

5. A method for constructing a dominant nuclear male-sterile rice line, characterized in that: It is obtained by hybridization using a dominant nucleomale sterile rice plant obtained by the construction method described in claim 3 or 4 as the female parent and a fertile rice plant as the male parent.

6. The method for identifying dominant nucleus male-sterile rice lines obtained by the construction method according to claim 5, characterized in that: RNA was extracted from the leaves of the obtained dominant nucleomale sterile rice line and reverse transcribed into cDNA. Using this cDNA as a template, qPCR was performed on the EAT1 gene using primers for EAT1 gene identification. The expression of EAT1 in the cDNA was then compared with that in the wild type. EAT1 The expression level of the gene was significantly higher than that of the wild type, indicating a dominant nuclear male sterile line in rice. The standard for "significantly higher" was P < 0.05, t-test.

7. The identification method according to claim 6, characterized in that: The leaves were taken from rice dominant nuclear male sterile lines at any stage of growth, from seedling to maturity.

8. The identification method according to claim 6, characterized in that: The identification primers include upstream primer EAT1-RT-F1 and downstream primer EAT1-RT-R1, with sequences shown in SEQ ID NO.5 and SEQ ID NO.6, respectively; and the identification method uses the OsActin1 gene as an internal reference gene, with internal reference primers including upstream primer Actin1-RT-F1 and downstream primer Actin1-RT-R1, with sequences shown in SEQ ID NO.7 and SEQ ID NO.8, respectively.

9. A method for recurrent selection breeding of rice dominant nucleus male-sterile plants obtained using the construction method described in claim 3 or 4, comprising: (1) Using the dominant nuclear male sterile rice plant as the female parent and rice with excellent traits and genes as the male parent, hybridize and harvest F1 seeds; (2) F1 seeds were planted and artificially isolated. Sterile and fertile plants were separated during the heading stage. Sterile plants were used as female parents and pollinated with pollen from fertile plants. The seeds on the sterile plants were harvested as seeds for the first round of selection population. (3) Plant the seeds of the first round of selection population and isolate them artificially. During the heading period, separate the sterile plants and fertile plants. Similarly, use the sterile plants as the female parent, pollinate them with the pollen of the fertile plants, and harvest the seeds from the sterile plants as the seeds of the second round of selection population. (4) Repeat step (3) several times according to the breeding needs to obtain several rounds of selection populations.

Images