Primer combinations and amplicon-targeted sequencing methods for the detection of 6 pathogenic microorganisms and their 20 drug-resistant genes

Abstract

The present invention discloses a primer combination for detecting 6 pathogenic microorganisms and their 20 drug resistance genes, including upstream primer F1: 5’-GAACGACATGGCTACGATCCGACTT SPECIAL F-3’; downstream primer R1: 5’-CTAAGACCGCTTGGCCTCCGACTT SPECIAL R-3’, wherein SPECIAL F includes the odd-numbered sequences among sequences 1-64 in the sequence listing, and SPECIAL R includes the even-numbered sequences among sequences 1-64 in the sequence listing. The purpose of the present invention is to provide a pathogenic microorganism amplicon targeted capture sequencing technology, aiming to enrich the microbial genomes with low starting amounts after selectively depleting human DNA from clinical specimens, simply and effectively improving the detection rate of pathogenic microorganisms and at the same time increasing the detection rate of their drug resistance genes.

Description

Technical Field

[0001] The present invention relates to a primer combination and an amplicon targeted sequencing method for detecting 6 pathogenic microorganisms and their 20 drug resistance genes. Background Art

[0002] Drug resistance refers to the weakening or loss of sensitivity of pathogenic microorganisms to clinically critical drugs. The detection of bacterial drug resistance genes is of great significance in clinical diagnosis. With the widespread application of antibacterial drugs in the fields of human medicine and veterinary medicine, the situation of bacterial drug resistance has become increasingly severe, thus putting forward higher requirements for the means of detecting bacterial drug resistance. The bacterial drug sensitivity test is the most classical method for detecting bacterial drug resistance. In particular, the dilution method is the gold standard for detecting bacterial drug resistance, which can obtain accurate MIC values and has strong flexibility. It is the most commonly used method for detecting bacterial drug resistance in clinical and laboratory research. The popularization and application of commercial automatic analysis systems have greatly shortened the experimental cycle compared with the dilution method, and are particularly suitable for clinical detection of bacterial drug resistance. However, whether it is the classical dilution method or the automatic analysis system, since they both require obtaining pure cultures of bacteria isolated from samples and take a long time, it is difficult to play a role in quickly responding to anti-infection treatment.

[0003] With the development of detection technologies and a deeper understanding of bacterial drug resistance, more research has focused on the PCR and qPCR detection technologies for drug resistance genes and elements that are closely related to the generation and transmission of drug resistance genes. Such technologies can quickly and accurately detect drug resistance genes and elements, thereby timely determining the drug sensitivity of the infected bacteria, providing a more timely basis for clinical anti-infection treatment, and gradually becoming an important means for clinical and laboratory detection and monitoring of drug-resistant bacteria. However, such technologies can only be used for screening known target genes and are not competent for the detection and monitoring of large-scale and high-throughput bacterial drug resistance.

[0004] At present, the commercially available bacterial drug resistance gene detection methods that are widely used mainly include the following four: Vitek2 of the automatic detection system, matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF), rapid biochemical detection, and real-time imaging monitoring. Vitek2 shows good consistency when detecting clinical samples, but the samples to be detected need to be positive cultures, and the reporting time of positive results for general blood samples requires at least 24 hours, which greatly delays the treatment opportunity. The same problem exists in real-time imaging monitoring. MALDI-TOF and biochemical detection can only identify pathogens producing carbapenemase and β-lactamase, and it is difficult to accurately detect other drug-resistant bacteria. In addition, polymerase chain reaction (PCR)-based bacterial drug resistance detection methods are also widely used, such as Prove it, FilmArray, Verigene, etc. However, these methods can only detect several common drug resistance genes and have certain limitations.

[0005] The development of whole-genome sequencing technology, MALDI-TOF MS, and microfluidic technology has provided new ideas for the detection of bacterial drug resistance. Whole-genome sequencing technology can discover as many drug resistance mechanisms as possible and is an important means for studying bacterial drug resistance mechanisms, but it is not suitable for popularization and application in clinical settings and drug resistance detection and monitoring; MALDI-TOF MS technology can detect bacterial drug resistance quickly and with high throughput, but due to the limitations of its principle for detecting bacterial drug resistance, it is currently only applied to the detection of drug resistance in a limited number of bacterial species. Summary of the Invention

[0006] The object of the present invention is to provide a primer combination for detecting 6 pathogenic microorganisms and their 20 drug resistance genes.

[0007] The technical solution adopted by the present invention is as follows: A primer combination for detecting 6 pathogenic microorganisms and their 20 drug resistance genes, including

[0008] Forward primer F1: 5’-GAACGACATGGCTACGATCCGACTT SPECIAL F-3’;

[0009] Reverse primer R1: 5’-CTAAGACCGCTTGGCCTCCGACTT SPECIAL R-3’, where SPECIAL F includes the odd-numbered sequences among Seq_1 to Seq_64 in the sequence listing, and SPECIAL R includes the even-numbered sequences among Seq_1 to Seq_64 in the sequence listing.

[0010] The 6 pathogenic microorganisms of the present invention include Klebsiella pneumoniae, Escherichia coli, Salmonella enterica, Acinetobacter baumannii, Pseudomonas aeruginosa, and Staphylococcus aureus. The drug resistance genes include: 5 drug resistance genotypes against β-lactamases, 14 drug resistance genotypes against carbapenems, and 1 drug resistance genotype against methicillin.

[0011] The above primer combination further includes:

[0012] F0: 5’-GAACGACATGGCTACGATC-3’ (Seq_65);

[0013] R0: 5’-CTAAGACCGCTTGGCCT-3’ (Seq_66).

[0014] The above primer combination further includes:

[0015] Second-round amplification upstream universal primer

[0016] F2: 5’-GAACGACATGGCTACGA-3’ (Seq_67);

[0017] Second-round amplification downstream BC primer

[0018] R-MGI_BC: 5’-TGTGAGCCAAGGAGTTG NNNNNNNNNN TTGTCTTCCTAAGACCGCTTGGCCTCCGACTT-3’(Seq_68);

[0019] Second-round amplification downstream universal primer

[0020] R2: 5’-TGTGAGCCAAGGAGTTG-3’(Seq_69);

[0021] wherein NNNNNNNNNN is the barcode region.

[0022] The present invention also discloses an amplicon-targeted sequencing method for detecting 6 pathogenic microorganisms and their 20 drug-resistant genes, which is characterized in that its steps include:

[0023] (1) Synthesize the above primer combination;

[0024] (2) Extract DNA from the sample to be tested as a template, add the upstream specific primer F1, the downstream specific primer R1, the universal primers F0 and R0 for the first-round PCR amplification, wherein the concentrations of the universal primers F0 and R0 in the reaction system are higher than those of the upstream primer F1 and the downstream primer R1. The 5’ ends of the specific primers F1 and R1 are linked with tag sequences (partial library adapter sequences). The first-round multiplex PCR amplification enriches the target region and adds partial library adapter sequences to both ends of the amplified fragment. Since multiplex PCR is a mixture of multiple different primers, it is easy to form interference between primers and primer dimers, resulting in uneven amplification efficiency and poor stability of the reaction system. Thus, the introduction of universal primers effectively solves these problems. The universal primers F0 and R0 can respectively complementarily pair with the tag sequences at both ends of the amplified fragment for PCR amplification, thereby converting the multiplex PCR of multiple pairs of primers into single-PCR of a pair of primers. The low-concentration specific primers F1 and R1 first specifically bind to the template and amplify to form an initial PCR product containing tag sequences at both ends. Since the concentrations of the universal primers F0 and R0 are higher than those of the specific primers F1 and R1, the universal primers F0 and R0 are more likely to bind to the template for PCR amplification. Therefore, after several thermal cycles, it is mainly single-PCR carried out with the primers F0 and R0, and the deviation caused by the efficiency problem superior to the specific primers is improved, the number of primers accommodated in the multiplex PCR system is increased, and the amplification is balanced and stable.

[0025] (3) The products of the first-round PCR amplification are purified by magnetic beads and used as templates for the second-round PCR. Primer F2, R2, and R-MGI_BC are added for the second-round PCR amplification. The barcode region sequences in R-MGI_BC for each sample are different from each other. Among them, the concentrations of F2 and R2 in the reaction system are both higher than the concentration of R-MGI_BC. During this process, a separate R-MGI_BC primer is used for each sample, and different R-MGI_BC primers only differ in the barcode region, such as the 10 underlined Ns below. Through the second-round PCR amplification, barcodes are added to the first-round PCR products to distinguish different samples. Since the BC primer is too long and not conducive to amplification, after adding the barcode to the target fragment, the PCR reaction mainly uses F2 and R2 as primers for amplification, and finally a complete library is obtained.

[0026] (4) After the products of the second-round PCR amplification are purified by magnetic beads, through the DNB one-step method, the target sequence is circularly amplified to obtain a library. The DNB method increases the signal intensity by increasing the copy number of the DNA to be tested, thereby improving the sequencing accuracy.

[0027] The above amplicon-targeted sequencing method further includes step (5): loading the DNB products onto a chip for high-throughput sequencing;

[0028] Step (6): Analyze the sequencing results, align the sequences. If the specific sequences of pathogenic microorganisms and drug-resistant genes are both aligned, it indicates that the sample contains drug-resistant pathogenic microorganisms.

[0029] When selecting target fragments of 20 pathogenic microorganism drug-resistant genotypes to design characteristic primers, the amplified fragment length should be between 160 - 240 bp to meet the purification operation requirements and maximize the retention of specific amplification products. Each detection target has at least 1 - 2 non-overlapping targeting regions, and the distance between them exceeds 500 bp to avoid primer cross. Select the BGISEQ-50 sequencer. Taking the drug-resistant genotype CTX-M-14 of Escherichia coli as an example, the underlined part is the adapter sequence:

[0030] The first-round amplified fragment 1:

[0031] GAACGACATGGCTACGATCCGACTT GTGCAACGGATGATGTTCGCGGCGGCGGCGTGCATTCCGCTGCTGCTGGGCAGCGCGCCGCTTTATGCGCAGACGAGTGCGGTGCAGCAAAAGCTGGCGGCGCTGGAGAAAAGCAGCGGAGGGCGGCTGGGCGTCGCGCTCATCGATACCGCAGATAATACGCAGGTGC AAGTCGGAGGCCAAGCGGTCTTAG (Seq_70)

[0032] The upstream primer of the first-round amplified fragment 1

[0033] CTX-M14-1-F1: 5'- GAACGACATGGCTACGATCCGACTT GTGCAACGGATGATGTTCGC-3’(Seq_71)

[0034] The downstream primer of the first-round amplified fragment 1

[0035] CTX-M14-1-R1: 5'- CTAAGACCGCTTGGCCTCCGACTT GCACCTGCGTATTATCTGCG-3’(Seq_72)

[0036] The first-round amplified fragment 2:

[0037] GAACGACATGGCTACGATCCGACTT CTTTATGCGCAGACGAGTGCGGTGCAGCAAAAGCTGGCGGCGCTGGAGAAAAGCAGCGGAGGGCGGCTGGGCGTCGCGCTCATCGATACCGCAGATAATACGCAGGTGCTTTATCGCGGTGATGAACGCTTTCCAATGTGCAGTACCAGTAAAGTTATGGCGGCC AAGTCGGAGGCCAAGCGGTCTTAG (Seq_73)

[0038] The upstream primer of the first-round amplified fragment 2

[0039] CTX-M14-2-F1: 5'- GAACGACATGGCTACGATCCGACTT CTTTATGCGCAGACGAGTGC-3’(Seq_74)

[0040] The downstream primer of the first-round amplified fragment 2

[0041] CTX-M14-2-R1: 5'- CTAAGACCGCTTGGCCTCCGACTT GGCCGCCATAACTTTACTGG-3’(Seq_75)

[0042] Gene chip technology can place up to 24,000 pairs of primers in the same reaction system under the same reaction conditions to amplify the target fragments. It has the characteristics of being fast, high-throughput, and capable of simultaneously detecting the presence of multiple drug-resistant genes. This makes it have a bright application prospect in the detection of bacterial drug resistance, and this method has far-reaching practical significance for the extensive screening of bacterial drug resistance in critically ill patients.

[0043] The amplicon - targeted capture sequencing (for pathogenic microorganism drug resistance) technology refers to a method that specifically amplifies target fragments during the sequencing process and finally determines the base composition by sequencing the fragments. Different from the traditional second - generation sequencing method, this method does not use ultrasound to break the genome into short fragments. Instead, in the same reaction system, primers are pre - placed, and the primers are used to specifically amplify the target fragments of interest, thereby generating short fragments that meet the subsequent sequencing read length. This method can place multiple pairs of primers in the same reaction conditions and the same reaction system to amplify the target fragments. It can combine clinical and laboratory departments to screen common pathogenic species and drug - resistant genes, customize a detection panel suitable for the hospital, and assist in the precise treatment of infectious diseases. The purpose of the present invention is to provide a pathogenic microorganism amplicon - targeted capture sequencing technology, aiming to enrich the microbial genome with low starting amount after selectively depleting human DNA in clinical specimens, simply and effectively improving the detection rate of pathogenic microorganisms and at the same time increasing the detection rate of their drug - resistant genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 It is a schematic diagram of the first - round PCR.

[0045] Figure 2 It is a schematic diagram of the first - round PCR.

[0046] Figure 3 It is the Qsep result of the amplification library of Standard 1 when leaving the library.

[0047] Figure 4 It is the Qsep result of the amplification library of Standard 2 when leaving the library.

[0048] Figure 5 It is the quality of the data downloaded from the machine for Standard 1.

[0049] Figure 6 It is the quality of the data downloaded from the machine for Standard 2. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0050] To further elaborate on the technical means and effects adopted by the present invention to achieve the predetermined invention purpose, the following combines the drawings and preferred embodiments to detail the specific implementation manners, structures, features, and their effects according to the present invention as follows.

[0051] Example 1 Design and synthesis of specific primers for 6 pathogenic microorganisms and their 20 drug - resistant genes

[0052] 1. Design primers for 6 pathogenic microorganisms and their 20 drug - resistant genes. The corresponding relationship between drug - resistant genes and pathogenic species is shown in Table 1. Table 2 shows the specific primer sequences SPECIAL - F / R of 6 pathogenic microorganisms designed, and Table 3 shows the specific primer sequences SPECIAL - F / R of 20 drug - resistant genes designed.

[0053] 2. Primer synthesis

[0054] Primers for the first-round PCR amplification:

[0055] Forward primer F1: 5’-GAACGACATGGCTACGATCCGACTT SPECIAL F-3’

[0056] Reverse primer R1: 5’-CTAAGACCGCTTGGCCTCCGACTT SPECIAL R-3’

[0057] F0: 5’-GAACGACATGGCTACGATC-3’

[0058] R0: 5’-CTAAGACCGCTTGGCCT-3’.

[0059] Primers for the second-round PCR amplification:

[0060] Forward universal primer for the second-round amplification

[0061] F2: 5’-GAACGACATGGCTACGA-3’

[0062] Reverse BC primer for the second-round amplification

[0063] R-MGI_BC: 5’-

[0064] TGTGAGCCAAGGAGTTG NNNNNNNNNN TTGTCTTCCTAAGACCGCTTGGCCTCCGACTT-3’

[0065] Reverse universal primer for the second-round amplification

[0066] R2: 5’-TGTGAGCCAAGGAGTTG-3’.

[0067] Among them NNNNNNNNNN is the barcode region. The design of the barcode region is to use different sequences for each detected sample to distinguish samples from different sources, so that multiple samples can be sequenced simultaneously.

[0068] Table 1: Corresponding relationship between drug-resistant genes and pathogenic species:

[0069]

[0070] Table 2: Specific primer sequences of 6 pathogenic microorganisms

[0071]

[0072]

[0073] Table 3: Specific primer sequences of 20 drug-resistant genes

[0074] Serial number Drug resistance gene Upstream primer SPECIAL-F Downstream primer SPECIAL-R 1 CTX-M GTGCAACGGATGATGTTCGC GCACCTGCGTATTATCTGCG 2 IMP AGCAGAGCCTTTGCCAGATT AGCCGTAAATGGAGTGTCAA 3 KPC GATGCGCGCGATACCTCATC TTTTGTCTCCGACTGCCCAG 4 NDM ATATTATGCACCCGGTCGCG TAGGAAGTGTGCTGCCAGAC 5 OXA AGCATGGCTCGAAAGTAGCT CCCTTCAAACCATCCGTTTTGT 6 OXA TCGCTTTTTTACGCAAGCTGT AGTTCAACCCAACCAACCCA 7 OXA TCTGGTTGTACGGTTCAGCA GTATTTGCGCGGCTTAGAGC 8 OXA AGTTTCTCTCAGTGCATGTTCA GCAAGAGCATTACCATAGGTGC 9 OXA GGGCTTGTGCTGAGCATAGT TCGGTCTAAATGCGTGCCAT 10 SHV AACTGAATGAGGCGCTTCCC CTTATCGGCGATAAACCAGCC 11 CTX-M CGCGTGATACCACTTCACCT TATCCCCCACAACCCAGGAA 12 CTX-M TTGTTAGGAAGTGTGCCGCT GGCCATCACTTTACTGGTGC 13 NDM CTGACTTTCGCCGCCAATG TGCTGTCCTTGATCAGGCAG 14 OXA TGCTAATCCAAATCACAGCGC GCAGGTACATACTCGGTCGA 15 OXA TGGACAGACGCGTGATATCG TGCCCGAGATATCCTCATTGC 16 OXA GGCTGTGTTTTTGGTGGCAT GCTTGGTTCGCCCGTTTAAG 17 SHV ATCTCCCTGTTAGCCACCCT TGCTCATCATGGGAAAGCGT 18 TEM CGTGTCGCCCTTATTCCCTT GGGGCGAAAACTCTCAAGGA 19 VIM TTGACCGCGTCTATCATGGC TAGACTGCGCCATCAAACGA 20 mecA GGCATGAAAAAACTAGGTGTTGG AGATTGAAAGGATCTGTACTGGG

[0075] Example 2 Amplicon-targeted sequencing method for 6 pathogenic microorganisms and their 20 drug-resistant genes 1. Nucleic acid extraction

[0076] Purchase and use a positive standard of Klebsiella pneumoniae resistant to KPC-type carbapenems, and conduct two parallel experiments. The same DNA extraction kit was used for nucleic acid extraction, and the concentration of the extracted DNA was measured using the Qubit dsDNA HS kit.

[0077] 2. First-round amplification

[0078] 1) Prepare a specific primer mixture according to a final concentration of 100 nM, and the adapter concentration is 10 times the final concentration of the specific primer.

[0079] 2) In a PCR tube, perform nucleic acid target amplification in a 25-μl system, which includes 12.5 μl of 2x Buffer, 1 μl of multiplex PCR enzyme, 1.25 μl of adapter mixture, 0.125 μl of specific primer mixture, and 10.125 μl of template.

[0080] Vortex and mix well, denature at 95 °C, anneal at 60 °C, and extend at 72 °C in a PCR instrument.

[0081] First-round amplification system:

[0082]

[0083] First-round amplification program:

[0084]

[0085] 3. First-round purification

[0086] Mix 25 μl of the previous-round PCR product, 25 μl of water, and 45 μl of beads (0.9X), retain the magnetic beads, wash twice with 80% ethanol, elute with 11 μl of water, and recover 10 μl.

[0087] 4. Second-round amplification

[0088] 1) In a PCR tube, perform second-round amplification and add a sequencing adapter in a 25-μl system, which includes 12.5 of 2x Buffer, 1 μl of multiplex PCR enzyme, 0.25 μl of the second-round adapter primer, 1 μl of the sequencing adapter, and 10 μl of the DNA template.

[0089] 2) Vortex and mix well, denature at 95°C, anneal at 54°C, and extend at 72°C in a PCR instrument.

[0090] Second-round amplification system:

[0091] Component Dosage / μl Final Concentration / nm mix 12.5 Tag enzyme 1 F2(100μM) 0.25 1000 R-MGI_BC(10μM) 1 400 R2(100μM) 0.25 1000 DNA (Product of the previous round) 10

[0092] Second-round amplification program:

[0093]

[0094] 5. Second-round purification

[0095] Mix 25 μl of the second-round PCR amplification product, 75 μl of water, and 80 μl of beads (0.8X), leave 178 μl of the supernatant, then add 20 μl of beads (0.2X), retain the magnetic beads, wash twice with 80% ethanol, and elute with 25 μl of water.

[0096] 6. DNB preparation

[0097] 1) For the obtained library, measure the length of the purified fragment using QSEP100, then calculate the library input amount based on the library fragment length and library concentration, and then calculate the library input volume according to the corresponding formula.

[0098] 2) In a PCR tube, perform DNB preparation in a 40 μl system. The DNBSEQ one-step DNB preparation kit from MGI, with the product number A0201, is selected. This system includes a mixture of 20 μl of DNB preparation buffer, 20 μl of Input dsDNA, and TE buffer.

[0099] 3) After vortexing and mixing well, proceed to the next preparation step. Perform the next reaction in an 84 μl system, which includes 40 μl of DNB polymerase mixture I, 4 μl of DNB polymerase mixture II, and 40 μl of the product from the previous round.

[0100] 4) After the reaction ends, add 20 μl of termination buffer, mix well with a wide-mouth pipette tip, and measure the concentration.

[0101] 7. DNB loading and onto the MGI sequencing instrument

[0102] 1) In a PCR tube, perform DNB loading in a 200 μl system, which includes 50 μl of DNB loading buffer I, 50 μl of DNB loading buffer II, and 100 μl of DNB.

[0103] 2) Carefully pipette and mix well with a wide-mouth pipette tip, and load onto the sequencing instrument.

[0104] 8. Experimental results

[0105] 1) Figure 3 andFigure 4 It shows the QSep100 graph after multiplex PCR library construction of two positive standards and a negative control. Figure 3 It is Standard 1, and the main peak is 270 bp; Figure 4 It is Standard 2, and the main peak is 246 bp.

[0106] 2) Figure 5 and Figure 6 It shows the quality of the base calling data of different samples at different positions after sequencing. Figure 5 It is Standard 1, Figure 6 It is Standard 2.

[0107] 3) Table 4 shows the sequencing data of the standards downloaded from the sequencer and the sequencing results.

[0108] Table 4

[0109]

[0110] Performance parameters:

[0111] A. The adapter ratio of data quality control < 15%;

[0112] B. The minimum starting amount for library construction is 5 ng;

[0113] C. MGI platform SE50 sequencing mode;

[0114] D. The pathogen detection accuracy rate > 95% (positive reference samples can be correctly detected), and there is no carryover contamination (false positives caused by closely related species are excluded);

[0115] E. The detection limit is not higher than: 200 cp / ml;

[0116] F. Good repeatability (low-value samples can be stably detected, and the detection rate ≥ 95%);

[0117] G. There is no competitive interference, and high-concentration pathogens in positive reference samples do not affect the detection of other pathogens at the detection limit concentration.

[0118] The above are only the preferred embodiments of the present invention, and do not impose any form of limitation on the present invention. Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or equivalent changes within the scope of the technical solution of the present invention by using the disclosed technical content above. However, any brief modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. A primer combination for detecting 6 pathogenic microorganisms and their 20 drug resistance genes, characterized in that, including Upstream primer F1: 5’-GAACGACATGGCTACGATCCGACTT SPECIALF-3’; Downstream primer R1: 5’-CTAAGACCGCTTGGCCTCCGACTT SPECIALR-3’; wherein, SPECIAL F includes the single sequences among SEQ ID NO.1 to SEQ ID NO.64 in the sequence listing, and SPECIALR includes the double sequences among SEQ ID NO.1 to SEQ ID NO.64 in the sequence listing; also includes universal primers: F0: 5’-GAACGACATGGCTACGATC-3’; R0: 5’-CTAAGACCGCTTGGCCT-3’; also includes: The upstream universal primer for the second-round amplification F2: 5’-GAACGACATGGCTACGA-3’; The downstream BC primer for the second-round amplification R-MGI_BC: 5’-TGTGAGCCAAGGAGTTG NNNNNNNNNN TTGTCTTCCTAA GACCGCTTGGCCTCCGACTT-3’.

Images