Drought-resistance-related molecular markers of GhRF09 gene in upland cotton and its application

Abstract

The present invention discloses a molecular marker associated with drought resistance of the GhRF09 gene in upland cotton and its application. The present invention provides single nucleotide polymorphisms at the following SNP sites in the cotton genome, or substances for detecting single nucleotide polymorphisms at the following SNP sites in the cotton genome, for use in identifying or assisting in identifying drought resistance in cotton to be tested; the physical location of the SNP site in the cotton reference genome, version TM-1_ZJU_2.1, is A10:83520949; the nucleotide at the SNP site is T or G. The KASP marker developed by the present invention can be used for foreground and background selection at the seedling stage, reducing the field planting scale of the breeding population, shortening the breeding period, and accelerating the breeding process.

Description

Technical Field

[0001] The present invention relates to the field of plant assisted breeding, and in particular to drought resistance-related molecules of the upland cotton GhRF09 gene and applications thereof. Background Art

[0002] α-ketoglutarate (2OG) / Fe(II)-dependent dioxygenase is widely involved in various metabolic processes of plants and is an important oxidase in plants. Related studies have also shown that α-ketoglutarate (2OG) / Fe(II)-dependent dioxygenase may play an important role in the mechanism related to plant drought resistance. In rice, the RL14 gene is a 2OG-Fe(II)oxygenase family protein that modulates rice leaf rolling by affecting secondary cell wall formation in leaves. Plant Biotechnol J. 2012; 10(5): 524-532. doi: 10.1111 / j.1467-7652.2012.00679.x). In Arabidopsis, the DMR6 gene encodes a defense-associated 2OG-Fe(II) dioxygenase that is involved in reducing susceptibility to downy mildew (van Damme, Mireille et al. “Arabidopsis DMR6 encodes a putative 2OG-Fe(II)oxygenase that is defense-associated but required for susceptibility to downy mildew.” The Plant journal: for cell and molecular biology vol. 54, 5(2008): 785-93. doi: 10.1111 / j.1365-313X.2008.03427.x).In apple, the MdCoL gene encodes a putative 2OG-Fe(II) oxygenase and is a strong candidate gene for controlling the columnar growth phenotype of apple trees. mdCoL affects abscisic acid (ABA) biosynthesis by interacting with mdDREB2 abscisic acid (Sun, Xin et al. "The apple columnar gene candidate MdCoL and the AP2 / ERF factor MdDREB2 positively regulate ABA biosynthesis by activating the expression of MdNCED6 / 9." Tree physiology vol. 41, 6 (2021): 1065-1076. doi: 10.1093 / treephys / tpaa162).

[0003] Cotton, a plant of the genus Gossypium in the Malvaceae family, is one of the major cash crops in Xinjiang, my country. Statistics show that Xinjiang currently accounts for 76% of the nation's total cotton planting area and 84.6% of the national output. The promotion and production of cotton have become indispensable to Xinjiang's economic development. Drought stress, one of the most significant abiotic stresses facing plants, can, to a certain extent, hinder the normal growth and development of cotton. Research has shown that drought stress can severely impact cotton's physiological processes, significantly reducing its quality and yield, severely impacting its economic benefits and causing significant losses to farmers. Currently, to truly mitigate the many hazards of drought stress on cotton, in addition to improving the environment, improving cotton's inherent resistance has been a key focus for breeders. However, due to the continuous selection process by nature, cotton germplasm with excellent drought resistance is limited, and further research is needed to expand this resource.

[0004] Marker-assisted selection (MAS) is considered a key tool for incorporating genetic diversity into breeding programs, but it has not been widely used. With continued experimentation, breeders have discovered that new models integrating MAS with modern breeding methods will greatly improve the reliability and efficiency of breeding, thereby promoting the utilization of traditional genetic diversity. In fact, improving plant breeding efficiency has always been a process of developing genetic resources by constructing exogenous genetic libraries. In recent years, an increasing number of breeders, both domestically and internationally, have combined various crops with multi-omics approaches such as molecular biology and epigenetics to assist in breeding. Using the genotypes of molecular markers closely linked to target trait genes, they screen varieties for drought resistance, thereby identifying drought-resistant varieties suitable for cultivation in arid and water-scarce areas. This eliminates the long cycles and low selection efficiency of traditional breeding, greatly accelerating the selection of new drought-resistant varieties. At present, there is little research on the use of molecular markers for identifying and screening drought-resistant cotton materials to assist in breeding. It is necessary to develop a drought-resistance-related molecular marker that can be closely associated with the drought-resistance-related trait indicators of cotton materials to be used for the rapid identification and breeding of drought-resistant cotton varieties. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to develop a drought-resistance-related molecular marker that can be closely correlated with the drought-resistance-related trait indicators of cotton materials during the cotton assisted selection breeding process, so as to be applied to the rapid identification and breeding of excellent drought-resistant cotton varieties, lay the foundation for the rapid identification and screening of large-scale drought-resistant cotton populations, and contribute to subsequent cotton molecular breeding.

[0006] In order to solve the above technical problems, the present invention provides the development and application of drought resistance-related molecular markers based on the upland cotton GhRF09 gene.

[0007] In a first aspect, the present invention claims protection for the use of single nucleotide polymorphisms at the following SNP sites in the cotton genome or substances for detecting single nucleotide polymorphisms at the following SNP sites in the cotton genome in identifying or assisting in identifying drought resistance of cotton to be tested;

[0008] The physical location of the SNP site in the cotton reference genome TM-1_ZJU_V2.1 is A10:83520949; the reference genome sequence TM-1_ZJU_V2.1 is available from the cotton COTTONGEN database (https: / / www.cottongen.org / data / download / genome_tetraploid / AD1). The nucleotide at the SNP site is either T or G. Note: The physical location of the TM-1_ZJU_V2.1 reference genome is the antisense strand of the GhRF09 gene. Corresponding to the sense strand, the SNP site is located at position 18 of the DNA fragment represented by SEQ ID No. 4 in the cotton genome, and is either A or C.

[0009] Furthermore, the substance used to detect the single nucleotide polymorphism of the SNP site in the cotton genome is the KASP primer described in the second aspect below or the reagent or kit described in the third aspect below.

[0010] In a second aspect, the present invention claims KASP primers for identifying or assisting in identifying drought resistance in cotton.

[0011] The KASP primers for identifying or assisting in identifying drought resistance of cotton claimed in the present invention consist of primer 1, primer 2 and primer 3; the primer 1 is a single-stranded DNA having a tag sequence A and positions 22 to 39 of SEQ ID No. 1 from the 5' end to the 3' end; the primer 2 is a single-stranded DNA having a tag sequence B and positions 22 to 39 of SEQ ID No. 2 from the 5' end to the 3' end; and the primer 3 is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID No. 3 in the sequence listing.

[0012] Furthermore, the nucleotide sequence of the tag sequence A may be positions 1 to 21 of SEQ ID No. 1; and the nucleotide sequence of the tag sequence B may be positions 1 to 21 of SEQ ID No. 2.

[0013] In a specific embodiment of the present invention, the primer 1 is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID No. 1; the primer 2 is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID No. 2.

[0014] In a third aspect, the present invention claims a reagent or kit for identifying or assisting in identifying drought resistance in cotton.

[0015] The reagent or kit for identifying or assisting in identifying drought resistance of cotton claimed in the present invention contains the KASP primers described in the second aspect above.

[0016] Furthermore, the reagent or kit further comprises a fluorescent probe A, a fluorescent probe B, a quencher probe A, and a quencher probe B. The nucleotide sequence of the fluorescent probe A is consistent with the nucleotide sequence of the tag sequence A, and the 5' end is connected to the fluorescent group A; the nucleotide sequence of the quencher probe A is reverse complementary to the nucleotide sequence of the tag sequence A, and the 3' end is connected to the quencher group. The nucleotide sequence of the fluorescent probe B is consistent with the nucleotide sequence of the tag sequence B, and the 5' end is connected to the fluorescent group B; the nucleotide sequence of the quencher probe B is reverse complementary to the nucleotide sequence of the tag sequence B, and the 3' end is connected to the quencher group.

[0017] In a specific embodiment of the present invention, the fluorescent group A is VIC; the fluorescent group B is FAM; and the quencher group is BHQ.

[0018] In a fourth aspect, the present invention claims protection for the use of the KASP primers described in the second aspect above or the reagents or kits described in the second aspect above in any of the following:

[0019] (A1) Identify or assist in identifying drought resistance in cotton;

[0020] (A2) identifying or assisting in identifying yield traits and / or morphology and / or photosynthesis of cotton under drought stress;

[0021] (A3) Compare the drought resistance of the tested cotton plants;

[0022] (A4) comparing the yield traits and / or morphology and / or photosynthesis of the tested cotton plants under drought stress;

[0023] (A5) Breeding cotton plants, lines, strains, or varieties that are relatively drought-resistant;

[0024] (A6) Breeding cotton plants, strains, lines, or varieties that exhibit relatively high yield and / or relatively high plant height and / or relatively more fruiting branches and / or relatively more productive branches and / or relatively stronger photosynthesis under drought stress;

[0025] (A7) Breeding cotton plants, lines, strains, or varieties that are relatively less drought-resistant;

[0026] (A8) Breeding cotton plants, lines, varieties, or varieties that have relatively low yield and / or relatively low plant height and / or relatively few fruiting branches and / or relatively few effective branches and / or relatively weak photosynthesis under drought stress;

[0027] (A9) Cotton breeding.

[0028] In a fifth aspect, the present invention claims protection for any one of the following methods:

[0029] Method I: A method for comparing the drought resistance of tested cotton may include the following steps: detecting nucleotides at the following SNP sites in the genome of the tested cotton, determining the genotype of the tested cotton, and determining the drought resistance of the tested cotton according to the genotype of the tested cotton as follows: the drought resistance of the tested cotton with the G:G genotype is stronger than or potentially stronger than the drought resistance of the tested cotton with the T:G genotype.

[0030] The method can also be used to compare the yield traits and / or apparent morphology and / or photosynthesis of the cotton to be tested under drought stress. The yield of the cotton to be tested of the G:G genotype under drought stress is higher or is a candidate higher than that of the cotton to be tested of the T:G genotype, the plant height of the cotton to be tested of the G:G genotype under drought stress is higher or is a candidate higher than that of the cotton to be tested of the T:G genotype, the number of fruiting branches of the cotton to be tested of the G:G genotype under drought stress is more or is a candidate higher than that of the cotton to be tested of the T:G genotype, the number of effective branches of the cotton to be tested of the G:G genotype under drought stress is more or is a candidate higher than that of the cotton to be tested of the T:G genotype, and the photosynthesis of the cotton to be tested of the G:G genotype under drought stress is stronger or is a candidate higher than that of the cotton to be tested of the T:G genotype.

[0031] Method II: A method for breeding relatively drought-resistant cotton plants, lines, varieties or varieties, which may include the following steps: detecting the nucleotides at the following SNP sites in the genome of the cotton to be tested, determining the genotype of the cotton to be tested, selecting the cotton to be tested whose SNP site in the genome is a G:G genotype as a parent for breeding, and selecting cotton whose SNP site in the genome is a G:G genotype in each generation of breeding, ultimately obtaining relatively drought-resistant cotton plants, lines, varieties or varieties.

[0032] This method can also be used to breed cotton plants, lines, strains, or varieties that have relatively high yields and / or relatively high plant heights and / or relatively more fruiting branches and / or relatively more effective branches and / or relatively stronger photosynthesis under drought stress. The ultimately obtained cotton plants, lines, strains, or varieties with relatively strong drought resistance are cotton plants, lines, strains, or varieties that have relatively high yields and / or relatively high plant heights and / or relatively more fruiting branches and / or relatively more effective branches and / or relatively stronger photosynthesis under drought stress.

[0033] Method III: A method for breeding cotton plants, lines, varieties or varieties with relatively weak drought resistance, comprising the following steps: detecting the nucleotides at the following SNP sites in the genome of the cotton to be tested, determining the genotype of the cotton to be tested, selecting the cotton to be tested whose SNP site in the genome is a T:G genotype as a parent for breeding, and selecting cotton whose SNP site in the genome is a T:G genotype in each generation of breeding, ultimately obtaining cotton plants, lines, varieties or varieties with relatively weak drought resistance.

[0034] This method can also be used to select cotton plants, lines, strains, or varieties that have relatively low yields and / or relatively low plant heights and / or relatively few fruiting branches and / or relatively few effective branches and / or relatively weak photosynthesis under drought stress. The cotton plants, lines, strains, or varieties with relatively weak drought resistance ultimately obtained are cotton plants, lines, strains, or varieties that have relatively low yields and / or relatively low plant heights and / or relatively few fruiting branches and / or relatively few effective branches and / or relatively weak photosynthesis under drought stress.

[0035] In the present invention, the drought resistance is relatively strong, which means that the drought resistance of the cotton of the G:G genotype is relatively strong or the candidate is relatively strong compared to the cotton of the T:G genotype. The drought resistance is relatively weak, which means that the drought resistance of the cotton of the T:G genotype is relatively strong or the candidate is relatively weak compared to the cotton of the G:G genotype. Accordingly, the relatively high yield, the relatively high plant height, the relatively large number of fruiting branches, the relatively large number of effective branches, and the relatively strong photosynthesis are all traits exhibited by the cotton of the G:G genotype compared to the cotton of the T:G genotype. The relatively low yield, the relatively low plant height, the relatively small number of fruiting branches, the relatively small number of effective branches, and the relatively weak photosynthesis are all traits exhibited by the cotton of the T:G genotype compared to the cotton of the G:G genotype.

[0036] In the method, the physical location of the SNP site in the cotton reference genome TM-1_ZJU_V2.1 is A10:83520949; the nucleotide at the SNP site is T or G. Note: The physical location on the TM-1_ZJU_V2.1 reference genome is the physical location of the antisense strand of the GhalkB09 gene. Corresponding to the sense strand, the SNP site is located at position 18 of the DNA fragment shown in SEQ ID No. 4 in the cotton genome and is A or C.

[0037] The G:G genotype is a homozygous type in which the nucleotide at physical position A10:83520949 in the cotton reference genome TM-1_ZJU_V2.1 is G; corresponding to the positive strand, the G:G genotype is a homozygous type in which the nucleotide at position 18 of the DNA fragment shown in SEQ ID No. 4 in the cotton genome is C;

[0038] The T:G genotype is a hybrid type in which the nucleotides at physical position A10:83520949 in the cotton reference genome TM-1_ZJU_2.1 are T and G. Corresponding to the positive strand, the T:G genotype is a hybrid type in which the nucleotides at position 18 of the DNA fragment shown in SEQ ID No. 4 in the cotton genome are A and C.

[0039] In addition to the G:G genotype and the T:G genotype, a T:T genotype also theoretically exists (the T:T genotype was not found in the 183 natural materials verified in the present invention, and some materials have unknown genotypes). The T:T genotype is a homozygous type in which the nucleotide at physical position A10:83520949 in the cotton reference genome TM-1_ZJU_2.1 is T; corresponding to the positive strand, the T:T genotype is a homozygous type in which the nucleotide at position 18 of the DNA fragment shown in SEQ ID No. 4 in the cotton genome is A.

[0040] In the above method, the "detection of nucleotides at the following SNP sites in the genome of the cotton to be tested to determine the genotype of the cotton to be tested" can be performed according to a method comprising the following steps: using the reagents or kit described in the third aspect above to perform PCR amplification on the genomic DNA of the cotton to be tested, performing fluorescence signal scanning on the amplified products, and then determining the genotype of the SNP sites in the genome of the cotton to be tested as follows:

[0041] If the fluorescent signal of the amplified product of the cotton to be tested is the signal of the fluorescent group B, then the SNP site of the cotton to be tested is the G:G genotype;

[0042] If the fluorescent signals of the amplified product of the cotton to be tested are the signals of the fluorescent group A and the fluorescent group B, then the SNP site of the cotton to be tested is the T:G genotype.

[0043] If the fluorescent signal of the amplified product of the cotton to be tested is the signal of the fluorescent group A, then the SNP site of the cotton to be tested is the T:T genotype;

[0044] If the fluorescent signals of the amplified products of the cotton to be tested do not show the signals of the fluorescent group A and the fluorescent group B, the SNP site of the cotton to be tested is an unknown genotype.

[0045] In the present invention, the fluorescent probe A, the fluorescent probe B, the quencher probe A and the quencher probe B are present in KASP HiGeno 2x Probe Mix, wherein the KASP HiGeno 2x Probe Mix is ​​a product of Beijing Jiacheng Biotechnology Co., Ltd. (Cat. No. AQP-001S).

[0046] In the above aspects, the cotton is upland cotton.

[0047] In a specific embodiment of the present invention, the cotton is selected from the 183 materials shown in Table 3.

[0048] In the above aspects, the drought resistance is mainly reflected in changes in yield traits, morphology and / or photosynthesis under drought stress. Further, the yield traits are reflected by the following indicators: boll number (BN), effective boll number (EBN), single boll seed weight (SBSW), single boll lint weight (SBLW) and / or single boll weight (SBW); the morphology is reflected by the following indicators: plant height (PH), fruit branch number (FBN) and / or effective fruit branch number (EFBN); the photosynthesis is reflected by the following indicators: net photosynthetic rate (Pn), transpiration rate (Tr) and / or vapor pressure deficit (VPD).

[0049] Beneficial effects of the present invention:

[0050] (1) The phenotypic selection efficiency of the KASP marker developed in the present invention is basically consistent with field identification, and can be used to quickly and accurately detect drought resistance in different cotton germplasm resources.

[0051] (2) The molecular marker KASP developed in the present invention can be used in commercial molecular breeding with high throughput, and does not require cumbersome procedures such as enzyme cutting, electrophoresis and sequencing during the detection process, reducing aerosol pollution and the use of toxic substances such as EB. It directly detects bases, and the accuracy is not affected by the length of the amplified fragment. It is simple, fast, accurate, and has a high degree of automation, which greatly improves the efficiency of gene selection and reduces costs.

[0052] (3) The KASP marker developed in the present invention can be used for foreground selection and background selection at the seedling stage, thereby reducing the field planting scale of the breeding population, shortening the breeding period, and accelerating the breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 This is the genotyping result diagram.

[0054] Figure 2 Cluster diagram of drought resistance of 183 resource materials. A is the cluster analysis result based on CDC value, and B is the cluster analysis result based on D value.

[0055] Figure 3 This is a boxplot of the DC value, CDC value and D value of drought resistance-related traits of 183 upland cotton resource materials combined with genotypes. AQ is a box plot of the drought resistance coefficient (DC) values ​​calculated from 17 traits, including plant height (PH), height of the first fruiting branch node (HNFFB), number of fruiting branches (FBN), number of effective branches (EFBN), number of bolls (BN), number of effective bolls (EBN), seed cotton weight per boll (SBSW), lint cotton weight per boll (SBLW), single boll weight (SBW), lint percentage (LP), intercellular carbon dioxide concentration (Ci), net photosynthetic rate (Pn), stomatal conductance (Gs), transpiration rate (Tr), vapor pressure deficit (VPD), water use efficiency (WUE), and relative chlorophyll value (SPAD), combined with genotype data. R and S are box plots of the comprehensive drought resistance coefficient (CDC value) and drought resistance metric (D) values ​​of each material, combined with genotype data. DETAILED DESCRIPTION

[0056] The following examples are generally as follows: In view of the complexity of cotton drought resistance-related traits and the comparison of various molecular marker technologies, high-throughput sequencing data under drought stress treatment and phenotypic data of resource materials were used to develop KASP molecular markers based on the genotype and characteristics of the non-synonymous mutant gene GhRF09 obtained in the QTL candidate interval located by the drought resistance population. Genotyping screening and identification were carried out through upland cotton resource materials with rich genetic backgrounds, and association analysis of related trait indicators was performed to develop molecular markers related to drought resistance.

[0057] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0058] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0059] Example 1. Development of molecular markers for identifying drought resistance in cotton and design of KASP primers

[0060] The gene used in the present invention to develop molecular markers is the GhRF09 gene in upland cotton, with the gene annotation information being α-ketoglutarate (2OG) / Fe(II)-dependent dioxygenase. Its source background is a candidate gene located within a drought resistance-related candidate interval by BSA-seq simplified genome sequencing of a drought-resistant RIL population based on the drought resistance metric D value. The reference genome is TM-1_ZJU_V2.1, its gene ID is GH_A10G1602, its physical location information is A10:83519234-83521058 (antisense strand), the CDS sequence fragment size is 1353bp, the full-length DNA sequence fragment size is 1825bp, and the protein sequence length is 450aa. Relevant information can be found in the cotton FGD database (https: / / cottonfgd.net / profiles / gene / GH_A10G1602 / ).

[0061] Analysis of SNPs and nonsynonymous genes within the candidate interval revealed a single nucleotide polymorphism (SNP) mutation at position A10:83520949 (antisense strand) in the GhRF09 gene. This mutation, located at base 110 in the CDS sequence of the GhRF09 gene, results in an amino acid change from histidine to proline (cAt / cCt), making it the only nonsynonymous mutation in the gene. Based on its location in the GhRF09 gene CDS sequence, this SNP was designated GhRF09-110SNP.

[0062] The KASP marker primer sequence was designed based on the positive strand of the SNP site (GhRF09-110SNP) as follows:

[0063] Upstream primer F1: 5'- GAAGGTCGGAGTCAACGGATT GAATCCCTCCCGGAAACA-3' (SEQ ID No. 1, the underlined part is the specific fluorescent tag sequence VIC);

[0064] Upstream primer F2: 5'- GAAGGTGACCAAGTTCATGCT GAATCCCTCCCGGAAACC-3' (SEQ ID No. 2, the underlined part is the specific fluorescent tag sequence FAM);

[0065] Downstream primer R: 5'-AACTCACTGAAGAATAATCGGAAGA-3' (SEQ ID No. 3).

[0066] The last base at the 3' end of the two upstream primers corresponds to the SNP site (GhRF09-110SNP).

[0067] The upstream primer F1 is used to amplify the case where the nucleotide at the physical position A10:83520949 (antisense chain) of the cotton reference genome TM-1_ZJU_V2.1 is T, and the upstream primer F2 is used to amplify the case where the nucleotide at the physical position A10:83520949 (antisense chain) of the cotton reference genome TM-1_ZJU_V2.1 is G; the downstream primer R is a universal primer.

[0068] The sequence of the theoretical amplification product is shown in SEQ ID No. 4 (corresponding to the positive strand). Position 18 of SEQ ID No. 4 is the indicated SNP site (GhRF09-110 SNP), which is A or C (represented by M in SEQ ID No. 4).

[0069] The single-stranded DNA molecule shown in the above SEQ ID No.1 and the single-stranded DNA molecule shown in SEQ ID No.3 amplify a fragment in which the genotype of the nucleotide at the physical position A10:83520949 (antisense chain) of the cotton reference genome TM-1_ZJU_V2.1 is T:T homozygous (i.e., the base at position 18 of SEQ ID No.4 on the cotton genome is A:A homozygous).

[0070] The single-stranded DNA molecule shown in the above SEQ ID No. 2 and the single-stranded DNA molecule shown in SEQ ID No. 3 amplify a fragment in which the genotype of the nucleotide at the physical position A10: 83520949 (antisense chain) of the cotton reference genome TM-1_ZJU_V2.1 is G:G homozygous (i.e., the base at position 18 of SEQ ID No. 4 on the cotton genome is C:C homozygous).

[0071] The single-stranded DNA molecule shown in SEQ ID No.1, the single-stranded DNA molecule shown in SEQ ID No.2, and the single-stranded DNA molecule shown in SEQ ID No.3 amplify a fragment in which the genotype of the nucleotide at the physical position A10:83520949 (antisense chain) of the cotton reference genome TM-1_ZJU_V2.1 is T:G hybrid (i.e., the base at position 18 of SEQ ID No.4 on the cotton genome is A:C hybrid).

[0072] Example 2: Establishment and application of a method for detecting SNP genotypes using KASP primers

[0073] 1. DNA sample preparation

[0074] DNA extraction: Genomic DNA was extracted from cotton leaves using the CTAB method.

[0075] DNA concentration determination: Randomly extract several DNA working solutions and measure the concentration using the NanoDrop2000 instrument.

[0076] DNA integrity test: Agarose gel electrophoresis, 1.5%, 120V, 40min. The presence of a main band is considered acceptable.

[0077] Preparation of SNP Primer Mix (4x): Dilute the primer powder to 100 mM, and then prepare the three sequences according to the ratio of F1:F2:R:ddH2O=24:24:48:100.

[0078] DNA dilution: Dilute the DNA stock solution to 20 ng / μl.

[0079] 2. KASP reaction

[0080] Xinjiang Aidesen Biotechnology Co., Ltd. was commissioned to conduct KSAP detection of the GhalkB09-110 SNP site using the LGC high-throughput genotyping detection platform.

[0081] The PCR amplification system for KASP detection is shown in Table 1.

[0082] Table 1. KASP detection PCR amplification system

[0083] name 384-well plate (4 μL system) KASP HiGeno 2x Probe Mix 2μL SNP Primer Mix (4x) 1 μL DNA samples 2μL

[0084] Note: KASP HiGeno 2x Probe Mix is ​​a product of Beijing Jiacheng Biotechnology Co., Ltd. (Cat. No. AQP-001S). KASP HiGeno 2x Probe Mix contains fluorescent probe A, fluorescent probe B, quencher probe A, quencher probe B, ROX dye, high-fidelity Taq enzyme, dNTP, Mg 2+ The nucleotide sequence of fluorescent probe A is 5'-GAAGGTCGGAGTCAACGGATT-3', with a VIC fluorescent group attached to its 5' end. The nucleotide sequence of fluorescent probe B is 5'-GAAGGTGACCAAGTTCATGCT-3', with a FAM fluorescent group attached to its 5' end. The nucleotide sequence of quencher probe A is 5'-AATCCGTTGACTCCGACCTTC-3', with a quencher group BHQ attached to its 3' end. The nucleotide sequence of quencher probe B is 5'-AGCATGAACTTGGTCACCTTC-3', with a quencher group BHQ attached to its 3' end.

[0085] The PCR reaction procedure for KASP detection is shown in Table 2 .

[0086] Table 2. KASP detection PCR reaction procedure

[0087]

[0088]

[0089] 3. Results Analysis

[0090] Fluorescence reading: After the PCR amplification cycle is completed, fluorescence readings are performed using a fluorescence quantitative PCR instrument at temperatures below 40°C. In this method, SNP detection uses the fluorophores FAM and VIC to distinguish between two isogenic loci. The passive reference dye ROX is used to correct for signal differences between wells due to reaction volume errors. The relevant excitation and emission wavelengths are shown in Table 3 below. Reading software is provided by LGC's Omega equipment.

[0091] Table 3. Excitation and emission wavelengths of fluorescent groups

[0092] Fluorophore Excitation light (nm) Emitted light (nm) FAM 485 520 VIC 535 556 ROX 575 610

[0093] Note: If the fluorescence scanning instrument uses the HEX fluorophore as the detection signal, no modifications to the setup are required, as the excitation and emission values ​​for VIC and HEX are very similar.

[0094] LGC's genotyping software (Kluster Caller) was used to analyze the fluorescence readings. The VIC and FAM values ​​for each reaction well were corrected using the values ​​of the reference dye (ROX) for that specific well. The fluorescence values ​​were then normalized to obtain the relative fluorescence values ​​for VIC and FAM for each PCR reaction well. According to the relative fluorescence value, the samples were clustered, and the genotype of the GhRF09-110SNP site in the cotton genome to be tested (i.e., the base at the 18th position of SEQ ID No. 4 on the cotton genome is A or C) was further determined according to the sample cluster and the fluorescence type: if the fluorescence signal data of the amplified product of the cotton to be tested is close to the Y axis (VIC signal) after analysis by the genotyping software KlusterCaller, the genotype of the GhRF09-110SNP site in the cotton genome to be tested is T:T homozygous (i.e., the base at the 18th position of SEQ ID No. 4 on the cotton genome is A:A homozygous); if the fluorescence signal data of the amplified product of the cotton to be tested is close to the X axis (FAM signal) after analysis by the genotyping software KlusterCaller, the genotype of the GhRF09-110SNP site in the cotton genome to be tested is G:G homozygous (i.e., the base at the 18th position of SEQ ID No. 4 on the cotton genome is A:A homozygous). No.4, the base at position 18 is C:C homozygous); if the fluorescence signal data of the amplified product of the cotton to be tested is located between the X-axis and the Y-axis (with both VIC and FAM signals) after analysis by the genotyping software KlusterCaller, the genotype of the GhRF09-110 SNP site in the cotton genome to be tested is T:G heterozygous (i.e., the base at position 18 of SEQ ID No. 4 on the cotton genome is A:C heterozygous).

[0095] Genotyping results are shown in Figure 2. Figure 1 As shown. Those marked with orange (cross) are genotypes T:G, those marked with blue (circles) are genotypes G:G, and those marked with green (squares) are genotypes unknown.

[0096] 4. Marker typing data analysis

[0097] A total of 183 upland cotton resource materials were used for testing, including conventionally planted varieties from major cotton areas such as the Yellow River Basin Cotton Area, Northwest Inland Cotton Area, Yangtze River Basin Cotton Area and Northeast Extra Early Cotton Area, some imported materials from abroad, and materials developed by this laboratory. They were all collected and provided by the Key Laboratory of Crop Genetic Improvement and Germplasm Innovation, College of Agriculture, Xinjiang Agricultural University.

[0098] On the one hand, the genotype of the GhRF09-110 SNP locus of each test cotton material was detected according to the above method. On the other hand, field resistance identification was carried out using conventional methods. The details are as follows:

[0099] Drought resistance tests on 183 resource materials (see Table 4, recorded in the article "Yan Chengchuan, Zeng Qingtao, Chen Qin, Fu Jincheng, Wang Tingwei, Chen Quanjia, Qu Yanying. Screening and evaluation of drought resistance indicators for upland cotton during the boll period [J]. China Agricultural Science and Technology Herald, 2022, 24(07): 46-57", which are available to the public from the applicant and can only be used to repeat the experiments of this invention and cannot be used for other purposes) were conducted in 2021 at the Xinjiang Agricultural University Cotton Breeding Base, 3rd Company, 144th Regiment, Shawan County (43°20′-45°20′N, 84°45′-86°40′E). The experiment set up two treatments: drought stress and normal control, with two replicates each. A 2-meter protective row was set between the drought stress and normal control. Each plot had a row length of 2 meters, 14 films per area, 3 rows per film, and 1 material per film for planting. Drip irrigation was used under the film. The experimental materials were sown on April 26, seedlings emerged on May 5, and topping was carried out on July 7. The stress treatment started on July 4. Before the stress, a water meter was installed on the main pipeline in the drought area to record the amount of water controlled. The management method during the cultivation period was the same as that in the field. After 15 days of drought stress, the 0-20, 20-40, and 40-60 cm soil layers were sampled and weighed using a 5-point sampling method. The soil was placed in an oven and dried to a constant weight, and the water content was measured. The results showed that the water content of the 0-20 cm soil layer changed the most after drought stress, decreasing by 8.257 percentage points. The water content of the three soil layers decreased by an average of 7.921 percentage points. During the stress period, a total of 566 m3 of water was controlled in the two drought stress treatments. 3 , reaching drought stress conditions.

[0100] Cotton plants with the third leaf in the upper left corner were selected for measurement of photosynthetic indices using a photosynthetic meter (CIRAS-3, Hansa, UK). These indices included transpiration rate (Tr), intercellular carbon dioxide concentration (Ci), net photosynthetic rate (Pn), stomatal conductance (Gs), vapor pressure deficit (VPD), and water use efficiency (WUE). Three consecutive measurements were taken for each material, and the average value was taken as one replicate.

[0101] On July 20, the relative chlorophyll value (SPAD) was measured using a SPAD instrument (SYS-SPAD-502Plus, Japan). The third leaf from the bottom of the cotton plant was selected, and the average value was taken at the top, middle and bottom of the third leaf. Three plants were measured continuously, and the average value was taken and recorded as one replicate. On September 17, agronomic traits of drought-stressed and normal controls were measured, including plant height (PH), height at the node of the first fruit branch (HNFFB), fruit branch number (FBN), efficient fruit branch number (EFBN), boll number (BN), and efficient boll number (EBN). On September 25, 20 bolls were mixed and harvested, and lint percentage (LP), single boll weight (SBW), single boll seed weight (SBSW), and single boll lint weight (SBLW) were measured. The measurement methods were based on the "Specifications and Data Standards for the Description of Cotton Germplasm Resources" (Du Xiongming, Zhou Zhongli. Specifications and Data Standards for the Description of Cotton Germplasm Resources [M]. Beijing: China Agriculture Press, 2005: 1-89).

[0102] EXCEL 2010 and SPSS 25.0 were used to perform statistical analysis on the data. This experiment included 17 trait indicators. The method for drought resistance evaluation included calculating the drought resistance coefficient (DC), drought resistance index (DI), comprehensive drought resistance coefficient (CDC value) and drought resistance measurement value (D) of the relevant trait indicators. The calculation formula was based on the calculation method of Sun Fenglei (Sun Fenglei, Qu Yanying, Chen Quanjia, et al. Comprehensive evaluation and grey correlation analysis of cotton drought resistance related indicators [J]. Agricultural Research in Arid Areas. 2019, 37(1): 233-239.) et al.

[0103] Drought resistance coefficient:

[0104] Drought resistance index:

[0105] Comprehensive drought resistance coefficient:

[0106] Membership function:

[0107] Drought resistance metrics:

[0108] In the above calculation formulas, X d 、X w These are the measured values ​​of each index of each material under drought stress and normal control, is the average value of this index under drought stress, DI i min ,DI i max is the minimum and maximum value of drought resistance index of each trait; r i is the contribution rate of the i-th comprehensive indicator.

[0109] Using the above experimental design and analysis methods, 17 traits of 183 upland cotton accessions were measured and analyzed. The drought resistance coefficient (DC) values ​​were calculated for the average values ​​after normal and drought stress treatments. The comprehensive drought resistance coefficient (CDC) values ​​and drought resistance metric (D) values ​​were then calculated. Cluster analysis was used to rank the drought resistance of the 183 upland cotton accessions. The results showed that the CDC and D values ​​were roughly the same in grading. Finally, the final drought resistance grade was determined according to the drought resistance metric D value: Class I was strong drought-resistant type (0.54≤D≤0.78), with 16 materials, of which G / G genotype accounted for 62.5% (10 / 16), T / G genotype accounted for 37.5% (6 / 16); Class II was drought-resistant type (0.46≤D<0.54), with 46 materials, of which G / G genotype accounted for about 23.9% (11 / 46), T / G genotype accounted for about 71.7% (33 / 46), and unknown genotype accounted for about 4.3% (2 / 46); Class III was moderate drought-resistant type (0.42≤D<0.46), with 40 materials, of which G / G genotype accounted for The ratio was 22.5% (9 / 40), T / G genotype accounted for 75% (30 / 40), and unknown genotype accounted for 2.5% (1 / 40); Category IV was drought-sensitive type (0.38≤D<0.42), with 45 materials, of which G / G genotype accounted for about 8.9% (4 / 45), T / G genotype accounted for 88.9% (40 / 45), and unknown genotype accounted for about 2.2% (1 / 45); Category V was extremely drought-sensitive type (0.28≤D<0.38), with 36 materials, of which G / G genotype accounted for 0% (0 / 36), T / G genotype accounted for 97.2% (35 / 36), and unknown genotype accounted for about 2.7% (1 / 36).

[0110] There are a total of 34 materials with the G / G genotype, of which the materials in Class I, Class II and Class III (strong drought-resistant, drought-resistant and moderate drought-resistant) account for about 88.2% (30 / 34), the materials in Class IV (drought-sensitive) account for about 11.8% (4 / 34), and the materials in Class V (extremely drought-sensitive) account for 0% (0 / 34).

[0111] Cluster diagram of drought resistance of 183 resource materials. Figure 2 Figure A is the cluster analysis result based on CDC value. Figure 2 Figure B shows the cluster analysis results based on the D value. The colors represent the magnitude of the values, with values ​​from blue to yellow representing small to large.

[0112] The comprehensive drought resistance coefficient (CDC) values ​​calculated based on the DC values ​​of 17 traits for 183 upland cotton accessions, the grading based on the CDC values, the drought resistance metric D values, the grading based on the D values, and the genotype information of the GhRF09-110 SNP locus are shown in Table 4. Table 5 shows the DC values ​​of 17 traits for 183 upland cotton accessions.

[0113] Table 4. CDC values ​​and their corresponding grades, D values ​​and their corresponding grades of 17 traits of 183 upland cotton resource materials and genotype information of GhRF09-110 SNP loci

[0114]

[0115]

[0116]

[0117]

[0118]

[0119] Table 5. DC values ​​of 17 traits of 183 upland cotton resources

[0120]

[0121]

[0122]

[0123]

[0124] 5. Genotype-phenotype association analysis

[0125] The drought resistance identification results based on 183 upland cotton resource materials obtained in step 4 were associated with their genotype results at the GhRF09-110SNP site to achieve the purpose of associating genotype with single or multiple trait indicators and explore the relationship between genotype and drought resistance.

[0126] Two-tailed T test was performed between phenotype and genotype using GraphPad Prism 9 software. Figure 3ns represents no significant difference; * represents P < 0.05, indicating that the overall trait indexes among different genotypes are significantly different; ** represents P < 0.01, indicating that the overall trait indexes among different genotypes are very significantly different; *** represents P < 0.001, indicating that the overall trait indexes among different genotypes are extremely significantly different.

[0127] The results showed that both the CDC values ​​and the drought resistance metric D values ​​showed extremely significant differences, indicating a strong correlation between genotypic variation and the overall drought resistance of the resource materials. Of the 17 traits measured, five showed extremely significant differences: BN, EBN, SBSW, SBLW, and SBW. These traits directly reflect cotton yield. Three traits, pH, FBN, and EFBN, showed very significant differences, reflecting cotton morphology. Three traits, Pn, Tr, and Vpd, all photosynthetic parameters, showed significant differences. While the remaining traits did not show significant differences overall, they all showed an overall trend of differential drought resistance. These results indicate that the genotype at the GhRF09-110 SNP locus is significantly associated with multiple traits related to cotton drought resistance, and that, overall, different genotypes represent, to some extent, the strength of drought resistance.

[0128] In summary, different genotypes of the GhRF09-110 SNP locus may affect the differential expression of multiple traits of cotton through a certain drought stress regulation mechanism, and the G / G genotype materials are more drought-resistant than the T / G genotype materials on the whole. At the same time, the drought resistance of plants is increased by affecting multiple traits. This shows that the GhRF09-110 SNP locus, as a molecular marker, is of great significance in the identification and screening of drought resistance of cotton resource materials, and lays a good foundation for cotton molecular marker-assisted selection breeding.

[0129] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. Use of the following single nucleotide polymorphisms at the SNP sites in the cotton genome or substances for detecting the following single nucleotide polymorphisms at the SNP sites in the cotton genome in identifying or assisting in identifying drought resistance in cotton to be tested; The physical position of the SNP site in the cotton reference genome TM-1_ZJU_V2.1 is A10:83520949; the nucleotide at the SNP site is T or G.

2. The use according to claim 1, characterized in that: The substance used to detect the single nucleotide polymorphism of the SNP site in the cotton genome is a KASP primer or a reagent or kit containing the KASP primer; The KASP primers consist of primer 1, primer 2, and primer 3; primer 1 is a single-stranded DNA having tag sequence A and positions 22-39 of SEQ ID No. 1 from the 5' end to the 3' end; primer 2 is a single-stranded DNA having tag sequence B and positions 22-39 of SEQ ID No. 2 from the 5' end to the 3' end; and primer 3 is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID No. 3 in the sequence listing.

3. The use according to claim 2, characterized in that: The nucleotide sequence of the tag sequence A is the 1st to 21st positions of SEQ ID No. 1; the nucleotide sequence of the tag sequence B is the 1st to 21st positions of SEQ ID No.

2.

4. The use according to claim 2 or 3, characterized in that: The primer 1 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID No. 1; the primer 2 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID No.

2.

5. The use according to claim 4, characterized in that: The reagent or kit further contains fluorescent probe A, fluorescent probe B, quenching probe A and quenching probe B; The nucleotide sequence of the fluorescent probe A is consistent with the nucleotide sequence of the tag sequence A, and the 5' end is connected to the fluorescent group A; the nucleotide sequence of the quencher probe A is reverse complementary to the nucleotide sequence of the tag sequence A, and the 3' end is connected to the quencher group; The nucleotide sequence of the fluorescent probe B is consistent with that of the tag sequence B, and the 5' end is connected to the fluorescent group B; the nucleotide sequence of the quenching probe B is reverse complementary to that of the tag sequence B, and the 3' end is connected to the quenching group.

6. The use according to claim 5, characterized in that: The fluorescent group A is VIC; the fluorescent group B is FAM; and the quenching group is BHQ.

7. Use of the KASP primer, reagent, or kit according to any one of claims 2 to 6 in any of the following: (A1) Identify or assist in identifying drought resistance in cotton; (A2) Identification or assisted identification of yield traits and / or morphology and / or photosynthesis of cotton under drought stress; (A3) Compare the drought resistance of the tested cotton plants; (A4) comparing the yield traits and / or morphology and / or photosynthesis of the tested cotton plants under drought stress; (A5) Breeding cotton plants, lines, strains, or varieties that are relatively drought-resistant; (A6) Breeding cotton plants, lines, varieties, or varieties that exhibit relatively high yields and / or relatively high plant heights and / or relatively more fruiting branches and / or relatively more productive branches and / or relatively stronger photosynthesis under drought stress; (A7) Breeding cotton plants, lines, strains, or varieties with relatively weak drought resistance; (A8) Breeding cotton plants, lines, varieties or varieties that have relatively low yield and / or relatively low plant height and / or relatively few fruiting branches and / or relatively few effective branches and / or relatively weak photosynthesis under drought stress.

8. Use any of the following methods: Method I: A method for comparing the drought resistance of test cotton, comprising the following steps: detecting nucleotides at the following SNP sites in the genome of the test cotton to determine the genotype of the test cotton, and determining the drought resistance of the test cotton according to the genotype of the test cotton as follows: the drought resistance of the test cotton with the G:G genotype is stronger than or potentially stronger than the drought resistance of the test cotton with the T:G genotype; Method II: A method for breeding relatively drought-resistant cotton plants, lines, strains, or varieties, comprising the following steps: detecting nucleotides at the following SNP sites in the genome of the tested cotton, determining the genotype of the tested cotton, selecting the tested cotton having a G:G genotype at the SNP site in the genome as a parent for breeding, and selecting cotton having a G:G genotype at the SNP site in the genome in each breeding generation, thereby ultimately obtaining relatively drought-resistant cotton plants, lines, strains, or varieties; Method III: A method for breeding relatively weak drought-resistant cotton plants, lines, strains, or varieties, comprising the following steps: detecting nucleotides at the following SNP sites in the genome of the tested cotton, determining the genotype of the tested cotton, selecting the tested cotton having the T:G genotype at the SNP site in the genome as a parent for breeding, and selecting cotton having the T:G genotype at the SNP site in the genome in each breeding generation, thereby ultimately obtaining relatively weak drought-resistant cotton plants, lines, strains, or varieties; The physical position of the SNP site in the cotton reference genome TM-1_ZJU_V2.1 is A10:83520949; the nucleotide at the SNP site is T or G; The G:G genotype is a homozygous type in which the nucleotide at the physical position A10:83520949 in the cotton reference genome TM-1_ZJU_V2.1 is G; The T:G genotype is a heterozygous type in which the nucleotides at the physical position A10:83520949 in the cotton reference genome TM-1_ZJU_V2.1 are T and G.

9. The method according to claim 8, characterized in that: The method of "detecting the nucleotides at the following SNP sites in the genome of the cotton to be tested to determine the genotype of the cotton to be tested" is performed according to a method comprising the following steps: performing PCR amplification on the genomic DNA of the cotton to be tested using the reagent or kit described in claim 5 or 6, scanning the amplified product for fluorescence signals, and then determining the genotype of the SNP sites in the genome of the cotton to be tested as follows: If the fluorescent signal of the amplified product of the cotton to be tested is the signal of the fluorescent group B, then the SNP site of the cotton to be tested is the G:G genotype; If the fluorescent signals of the amplified product of the cotton to be tested are the signals of the fluorescent group A and the fluorescent group B, then the SNP site of the cotton to be tested is the T:G genotype.

Images