Application of histone methyltransferase SMYD2 in preparing drugs for preventing and treating restenosis caused by neointimal hyperplasia after vascular injury

By reducing the expression and activity of SMYD2, gene editing and inhibitors are used to inhibit the proliferation of vascular smooth muscle cells, the problem of restenosis caused by vascular endometrial regeneration is solved, and effective inhibition of vascular endometrial regeneration and prevention and treatment of restenosis is achieved.

CN115998869BActive Publication Date: 2025-08-05TONGJI HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI TECH
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211170808.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-23
Publication Date
2025-08-05
Estimated Expiration
2042-09-23

AI Technical Summary

Technical Problem

In the prior art, neointimal hyperplasia (NIH) caused by percutaneous coronary intervention therapy is an important reason for intrastent restenosis (ISR) in patients. The existing methods are difficult to effectively inhibit the excessive proliferation and migration of vascular smooth muscle cells (VSMCs), resulting in a high incidence of restenosis.

Method used

By reducing the expression and activity of histone methyltransferase SMYD2 in cells or tissues, gene editing, RNAi technology and SMYD2 inhibitors are used to inhibit the proliferation of smooth muscle cells. Specific methods include gene knockout, RNAi technology and administration of SMYD2 inhibitors such as drug-eluting stent administration and drug-coated balloon administration.

Benefits of technology

It significantly inhibits the rebirth of vascular endometrium, blocks VSMCs in the G0/G1 phase, reduces proliferation, and prevents and treats restenosis after vascular injury, providing new targets for the treatment of diseases such as vascular stenosis, post-stent stenosis and post-endometrial dissection stenosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115998869B_ABST
    Figure CN115998869B_ABST
Patent Text Reader

Abstract

The present invention discloses an application of a histone methyltransferase SMYD2 in the preparation of a drug for preventing and treating restenosis caused by intimal regeneration after vascular injury. The prevention and treatment of restenosis caused by intimal regeneration after vascular injury is achieved by reducing the expression and activity of the histone methyltransferase SMYD2 in cells or tissues. By reducing the expression and activity of the histone methyltransferase SMYD2 in cells or tissues, the proliferation of smooth muscle cells is inhibited, and intimal regeneration is effectively inhibited. The drug can be used as a new target for preventing and treating diseases such as vascular stenosis, stenosis after stent surgery, and stenosis after endarterectomy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the function and application field of genes, and specifically refers to the application of a histone methyltransferase SMYD2 in the preparation of a drug for preventing and treating restenosis caused by intimal regeneration after vascular injury. Background Art

[0002] Coronary artery disease is a globally recognized health threat in the cardiovascular field, causing tremendous physical and mental suffering and economic burden on patients. Coronary artery stenosis is the main cause of myocardial ischemia, and percutaneous coronary intervention (PCI), balloon angioplasty, or coronary artery bypass grafting (CABG) are the most common revascularization strategies for treating stenotic atherosclerotic lesions (Jeong K, Kim JH, Murphy JM, Park H, Kim SJ, Rodriguez YAR, Kong H, Choi C, Guan JL, Taylor JM, Lincoln TM, Gerthoffer WT, Kim JS, Ahn EE, Schlaepfer DD and Lim SS. Nuclear Focal Adhesion Kinase Controls Vascular Smooth Muscle Cell Proliferation and Neointimal Hyperplasia Through GATA4-Mediated CyclinD1 Transcription. Circulation research. 2019;125:152-166.). Although these surgeries are effective, neointimal hyperplasia (NIH) after vascular intimal damage caused by vascular interventional techniques (including percutaneous transluminal angioplasty and vascular stent implantation for the treatment of vascular stenosis and occlusion) is an important cause of in-stent restenosis (ISR) in patients and a key factor in poor prognosis.Studies have found that the incidence of restenosis in patients who undergo PCI is 25-50%, and some patients even need further revascularization within 6 months (Giacoppo D, Alfonso F, Xu B, Claessen B, Adriaenssens T, Jensen C, Perez-Vizcayno MJ, Kang DY, Degenhardt R, Pleva L, Baan J, Cuesta J, Park DW, Kukla P, Jimenez-Quevedo P, Unverdorben M, Gao R, Naber CK, Park SJ, Henriques JPS, KastratiA and Byrne RA. Drug-Coated Balloon Angioplasty Versus Drug-Eluting Stent Implantation in Patients With Coronary Stent Restenosis. Journal of the American College of Cardiology. Cardiology.2020;75:2664-2678.), this is undoubtedly another trauma to the patient, so further exploring the mechanism of vascular intimal regeneration and screening intervention targets is a clinical topic with positive significance.

[0003] Neointimal remodeling is a type of interventional, pathological vascular remodeling that typically occurs after vascular surgery, such as angioplasty or stent implantation. It is a key pathological basis for vascular restenosis (Zhang SM, Zhu LH, Chen HZ, Zhang R, Zhang P, Jiang DS, Gao L, Tian S, Wang L, Zhang Y, Wang PX, Zhang XF, Zhang XD, Liu DP and Li H. Interferon regulatory factor 9 is critical for neointima formation following vascular injury. Nature communications. 2014;5:5160.). Excessive proliferation and migration of vascular smooth muscle cells (VSMCs) are the primary cellular basis of neointimal remodeling. Therefore, elucidating the molecular mechanisms underlying VSMC overproliferation and effectively inhibiting neointimal remodeling are crucial for developing drugs to intervene in restenosis, optimizing treatment strategies, and improving postoperative patient quality of life.

[0004] SMYD2 (SET and MYND domain containing 2) is a member of the SMYD family and has histone methyltransferase activity, which can specifically methylate H3K4 and H3K36. More and more studies have shown that SMYD2 plays an important role in many tumors, including breast cancer, colorectal cancer, leukemia, and esophageal squamous cell carcinoma (Yi X, Jiang XJ, and Fang ZM. Histone methyltransferase SMYD2: ubiquitous regulator of disease. Clin Epigenetics. 2019; 11(1): 112.). Therefore, SMYD2 is considered a potential effective targeted drug for the clinical treatment of tumors. However, the effect of SMYD2 on the proliferation of smooth muscle cells and the mechanism of SMYD2 on endometrial regeneration are still unclear. Therefore, exploring the mechanism of action of SMYD2 in the process of endometrial regeneration and the effect of reducing its activity on endometrial regeneration through gene editing, RNA interference, inhibitors and other technologies have positive clinical significance, thereby providing new ideas and targets for the treatment of endometrial regeneration. Summary of the Invention

[0005] To address the shortcomings of the aforementioned prior art, the present invention aims to provide a drug for the use of the histone methyltransferase SMYD2 in the preparation of a drug for preventing and treating restenosis caused by neointimal regeneration following vascular injury. By reducing the expression of the histone methyltransferase SMYD2 in cells or tissues, the drug aims to inhibit smooth muscle cell proliferation and effectively suppress neointimal regeneration. This drug, in turn, serves as a novel target for the prevention and treatment of vascular stenosis, post-stent stenosis, and post-endothelial resection stenosis.

[0006] To achieve the above object, the present invention is implemented through the following technical solutions:

[0007] In one aspect, the present invention provides a use of a histone methyltransferase SMYD2 in the preparation of a drug for preventing and treating restenosis caused by intimal neoplasia after vascular injury.

[0008] Preferably, preventing and treating restenosis caused by neointimal regeneration after vascular injury is achieved by reducing the expression of histone methyltransferase SMYD2 in cells or tissues.

[0009] Further preferably, reducing the expression of histone methyltransferase SMYD2 in cells or inhibiting the activity of SMYD2 in vascular tissue can inhibit the proliferation of vascular smooth muscle cells and then inhibit vascular intimal neoplasia.

[0010] Further preferably, the method for reducing the expression and activity of SMYD2 in cells or tissues comprises at least one of gene editing, RNAi technology and SMYD2 inhibitors.

[0011] More preferably, gene editing includes at least one of gene knockout, gene modification and single base editing.

[0012] More preferably, RNAi technology inhibits the expression and activity of SMYD2 in cells through small molecule double-stranded RNA.

[0013] More preferably, the RNAi technology includes at least one of targeted lipid nanoinclusions, viral transfection, stem cell modification, and single-chain fragment antibody fusion protein.

[0014] More preferably, the administration of the SMYD2 inhibitor includes at least one of oral administration, intravenous injection, subcutaneous implantation, drug-eluting stent administration, and drug-coated balloon administration.

[0015] More preferably, the administration of the SMYD2 inhibitor includes drug-eluting stent administration and drug-coated balloon administration.

[0016] Preferably, histone methyltransferase SMYD2 is used as a target for treating vascular stenosis, treating stenosis after stenting, and treating stenosis after endarterectomy.

[0017] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0018] The present study demonstrates that knocking down SMYD2 arrests VSMCs in the G0 / G1 phase, significantly inhibiting their proliferation. Conversely, overexpressing SMYD2 significantly promotes VSMC proliferation, which in turn promotes vascular intimal regeneration. The present study discovered a mechanism by which inhibition of the expression and activity of the histone methyltransferase SMYD2 can prevent and treat restenosis caused by intimal regeneration after vascular injury.

[0019] Based on the role of SMYD2 in restenosis caused by intimal regeneration after vascular injury, the SMYD2 specific inhibitor LLY-507 can be used to prepare drugs for preventing and treating restenosis caused by intimal injury, vascular stent implantation, and vascular stripping. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Figure 3 shows the cell counts after SMYD2 knockdown.

[0021] Figure 2A This figure shows the smooth muscle cell proliferation detected by EDU kit after SMYD2 knockdown.

[0022] Figure 2B for Figure 2A Statistical histogram.

[0023] Figure 3A The graph shows the changes in the expression level of the proliferation marker Ki67 after SMYD2 knockdown.

[0024] Figure 3B for Figure 3A Statistical histogram.

[0025] Figure 4A The graph shows the changes in PCNA and P-H3 protein levels after SMYD2 knockdown.

[0026] Figure 4B for Figure 4A Statistical histogram.

[0027] Figure 5 This is a flow cytometry diagram of the cell cycle after SMYD2 knockdown.

[0028] Figure 6A This figure shows the expression of cell cycle-related proteins CDK4 and CDK6 after SMYD2 knockdown.

[0029] Figure 6B for Figure 6A Statistical histogram.

[0030] Figure 7 The figure shows the smooth muscle cell count after SMYD2 overexpression and SMYD2-myc (Y240F) methyltransferase active site gene mutation.

[0031] Figure 8A This figure shows the smooth muscle cell proliferation detected by EDU kit after SMYD2 overexpression and SMYD2-myc (Y240F) methyltransferase active site gene mutation.

[0032] Figure 8B for Figure 8A Statistical histogram.

[0033] Figure 9A This is a graph showing changes in the expression level of the proliferation marker Ki67 after SMYD2 overexpression and SMYD2-myc (Y240F) methyltransferase active site gene mutation.

[0034] Figure 9B for Figure 9A Statistical histogram.

[0035] Figure 10A The graph shows the changes in PCNA and P-H3 protein levels after SMYD2 overexpression and SMYD2-myc (Y240F) methyltransferase active site gene mutation.

[0036] Figure 10B for Figure 10A Statistical histogram.

[0037] Figure 11A This figure shows the expression of cell cycle-related proteins CDK4 and CDK6 after SMYD2 overexpression and SMYD2-myc (Y240F) methyltransferase active site gene mutation.

[0038] Figure 11B for Figure 11A Statistical histogram.

[0039] Figure 12 This is the HE staining image of tissue in the intimal damage model mouse after overexpression of SMYD2.

[0040] Figure 13 Figure 2 shows the area of neointimal regeneration in mice overexpressing SMYD2.

[0041] Figure 14 This is a graph showing the difference in PCNA expression in the endometrial damage model of SMYD2-overexpressing transgenic mice.

[0042] Figure 15 This is the HE staining image of the tissue of mice with endometrial injury model after application of LLY-507.

[0043] Figure 16 This is a diagram of the intimal regeneration area after LLY-507 was applied to mice with intimal injury model.

[0044] Figure 17 This is a graph showing the difference in PCNA expression in tissues of mice with endometrial injury model after application of LLY-507. DETAILED DESCRIPTION

[0045] The present invention is further described in detail below in conjunction with the accompanying drawings, embodiments and experimental examples. Of course, the scope of protection of the present invention is not limited to the following examples. Professionals and technicians in this field will understand that various changes and modifications can be made to the present invention without departing from the spirit of the present invention. The present invention provides a general and / or specific description of the materials and test methods used in the experiments. Although many materials and operating methods used to achieve the purpose of the present invention are well known in the art, the present invention is still described as detailed as possible here. The following examples further illustrate the present invention, rather than limit the present invention. Any equivalent transformation that is merely formal and not substantial based on the concept of the present invention should be regarded as the scope of the technical solution of the present invention.

[0046] Unless otherwise specified, the experimental methods or test methods described in the following examples are all conventional methods; the reagents and materials described are all obtained from conventional commercial channels or prepared by conventional methods unless otherwise specified.

[0047] 1. Isolation and Culture of Primary Aortic Smooth Muscle Cells

[0048] (1) SD rat aortic smooth muscle cells: Rats weighing approximately 200 g were selected, and the aorta was isolated and placed in pre-cooled culture medium. The cells were then rapidly isolated and cultured. The purity of the isolated and purified smooth muscle cells was verified using a smooth muscle-specific immunofluorescence antibody.

[0049] (2) Human aortic smooth muscle cells: The human aortic smooth muscle cells used in this study were isolated from human aortic vascular tissue. All blood vessels were obtained from the Department of Cardiovascular Surgery and Heart and Lung Transplantation, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology. Informed consent was obtained from the patients and their families. The purity of the isolated and purified smooth muscle cells was verified using smooth muscle-specific immunofluorescence antibodies.

[0050] (3) Tissue block adherent separation and culture method:

[0051] The aorta was isolated under a dissecting microscope and the adventitia was peeled off. The blood vessels were cut open longitudinally and the intimal cells were scraped off. The treated vascular media was placed in a culture bottle and the blood vessels were cut into 1 mm pieces using microscissors. 3 Remove the fragments and evenly spread them across the bottom of the culture flask. Stand the flask upright and add DME / F12 complete medium containing 10% fetal bovine serum and 1% double-streptomycin. Maintain this orientation and allow the tissue to adhere to the wall for 20 minutes in a 37°C incubator. Rotate the flask to position it horizontally and allow the tissue to soak in the culture medium. After one week of culture in a 37°C, 5% CO2 incubator, observe under an optical microscope the growth of several aortic smooth muscle cells surrounding the tissue. After cell passage, cells with a spindle-shaped appearance are identified as aortic smooth muscle cells.

[0052] 2. Cell Passaging

[0053] (1) Turn on the ultraviolet light in advance and irradiate the clean bench for half an hour. At the same time, preheat the DEM / F12 complete culture medium, PBS and double antibodies.

[0054] (2) Carefully remove the cells from the incubator and evaluate the cell density and status under a microscope. If the cells are approximately full grown, they can be passaged.

[0055] (3) Use a vacuum pump to remove the supernatant and then wash with PBS.

[0056] (4) Add 1 ml of trypsin to evenly cover the bottom of the dish, then observe under a microscope. When the cells have become rounded, gently tap the cell sidewalls to release them. Immediately add 1 ml of complete medium to terminate digestion. Mix the cell suspension with a pipette and transfer it to a 15 ml centrifuge tube. Centrifuge at 1000 rpm for 5 min.

[0057] (5) During centrifugation, prepare the culture dish in advance and add 5 ml of culture medium. Label the cell type and date.

[0058] (6) After centrifugation, discard the supernatant and add 1 ml of culture medium to resuspend the cells. Divide the suspension evenly into the prepared culture dishes according to the subculture ratio.

[0059] (7) Cross-mix and gently place the cells in a 37°C, 5% CO2 incubator.

[0060] 3. Extraction of Aortic Smooth Muscle Cell Protein

[0061] (1) Remove the cells, discard the culture medium, remove the remaining liquid with a pipette tip, add PBS to rinse the cells, discard the PBS again, remove the remaining liquid with a pipette tip, and add lysis buffer.

[0062] (2) First, shake the tube by hand to cover the cells with lysis solution, and then place the tube on a shaker at 4 degrees Celsius for 10 minutes. At the same time, remove the centrifuge tube and mark the information.

[0063] (3) Use a cell scraper to scrape the cell protein into a centrifuge tube and let it stand for 10 minutes to lyse.

[0064] (4) Ultrasound: 15% power, ultrasonic for 1 second, stop for 2 seconds, let it stand for 5 minutes, then repeat the ultrasonication once and let it stand for another 10 minutes.

[0065] (5) Centrifugation: 12000r, 30min, take the supernatant into a new centrifuge tube.

[0066] (6) Denaturation: Add 5×SDS loading and protein supernatant according to the corresponding volume, vortex for a while, centrifuge briefly, denature at 95°C in a water bath for 10 min, centrifuge, denature at 95°C for another 10 min, and centrifuge.

[0067] 4.Western blot

[0068] (1) Sample loading and electrophoresis

[0069] Prepare the polyacrylamide gel in advance and then place the prepared gel in the electrophoresis tank.

[0070] Fill the gel rack with the inner solution, and then add the electrophoresis outer solution so that it occupies 2 / 3 of the total capacity of the electrophoresis tank. The inner solution must be freshly prepared.

[0071] Add the protein sample into the gel loading well and perform electrophoresis at a constant voltage of 80-90V.

[0072] (2) Transfer

[0073] Prepare transfer solution: weigh 3.03g Tribase, 14.4g glycine, 200ml methanol and 800ml double-distilled water, and pre-cool in a refrigerator at 4 degrees.

[0074] Cutting the membrane: Cut the PVDF membrane to the desired length and width based on the sample quantity and the molecular weight of the protein being coated. Mark the membrane in the upper right corner, typically using a cut. Before use, remove the protective paper and activate it in methanol.

[0075] Soak the sponge pad and filter paper required for transfer, and use a clamp to spread them out left and right, with the black side (negative pole) of the clamp facing right. Place the sponge pad, filter paper, gel, and PVDF membrane in turn, so that there are no bubbles between the membrane and the gel. Then place the filter paper and sponge pad. Finally, use a glass rod to roll back and forth to remove bubbles and close the clamp.

[0076] Place the clamp into the transfer tank, with the black side of the clamp corresponding to the black side of the tank, and the white side of the clamp corresponding to the red side of the transfer tank. Finally, add transfer solution, preferably covering the clamp.

[0077] Turn on the power supply and set the constant current to about 0.2A. The starting voltage should be between 100-130V. The transfer time is determined by the molecular weight of the protein. The larger the molecular weight, the longer the transfer time.

[0078] After the transfer is completed, open the clamp and carefully pick up the PVDF membrane with tweezers.

[0079] (3) Blocking: After the transfer, use 5% defatted

[0080] The PVDF membrane was then cut according to the molecular weight of the incubated protein, the primary antibody was added, and the membrane was incubated on a shaker at 4°C overnight.

[0081] (5) Secondary antibody incubation

[0082] The primary antibody was recovered and the PVDF membrane was washed with TBST for 5 min, three times.

[0083] Dilute the secondary antibody at a ratio of 1:10,000 and incubate at room temperature for 1 hour.

[0084] (6) Development

[0085] After the secondary antibody incubation, wash with TBST for 10 minutes three times. Then, mix the developer A and B solutions evenly and react with the PVDF membrane. Then, expose it in an exposure machine and analyze the results.

[0086] 5. Lentiviral Infection of Aortic Smooth Muscle Cells

[0087] A. Preparation of viral vectors

[0088] (1) Construction of lentiviral vector plasmid: The shSMYD2 mRNA sequence was retrieved from the Sigma website, and the sequence was connected to the PLKO.1 vector to finally construct the SMYD2 lentiviral knockdown plasmid.

[0089] (2) Prepare transfection reagent: A 10cm cell culture dish is generally given 6ml of culture medium. Take 1 / 10 of the culture medium volume as the reaction system, so the reaction system for a 10cm dish is 600ul. Prepare two EP tubes. Add 300ul of empty DMEM culture medium and 24ul of MAX to one tube and mix well. Add 300ul of serum-free DMEM culture medium, 6ug of target plasmid, 3ug of SPEX2 and 3ug of PMD2G (SPEX2 and PMD2G are viral backbone plasmids) to the other EP tube and mix well. Then mix the liquids in the two centrifuge tubes and let it stand for 15 minutes.

[0090] (3) Take out 293T cells with a cell density of about 40%-60%, then gently add the above mixture, mix crosswise, and culture in a 37°C, 5% CO2 incubator.

[0091] (4) After 8 h, discard the supernatant, add 6 ml of complete DMEM medium, and continue to culture in a 37°C, 5% CO2 incubator;

[0092] (5) Collect the viral supernatant every 24 hours, then change the medium and collect twice.

[0093] B. Viral infection

[0094] (1) The 24-hour and 48-hour viral supernatants were mixed, centrifuged at 12,000 rpm for 30 min, and the cell residues were filtered through a 0.22 μm filter;

[0095] (2) Remove the cells to be infected, discard the supernatant, add 3 ml of viral supernatant and 3 ml of DME / F12 complete medium, and infect at 37°C, 5% CO2 for 24 hours;

[0096] (3) After 24 hours, discard the supernatant and replace with complete culture medium for culture. After 48 hours of culture, collect the protein.

[0097] 6. Cell Counting

[0098] (1) Remove the cells to be counted from the incubator, discard the supernatant, add PBS to wash, and then digest with 300ul of trypsin in a 6cm dish. Then observe under a microscope until the cells become round. Tap the side wall to make the cells fall off, and then add 700ul of complete culture medium to terminate the reaction.

[0099] (2) Wipe the blood cell counting plate with alcohol, then cover it with a coverslip. Slowly add the above cell suspension along the edge of the slide. Then observe the total number of cells in the four large squares on the cell counting plate under a microscope. Then calculate the total number of cells in the four large squares / 4×10 4 The number is the number of cells per ml, and the experiment was repeated 3 times to calculate the average value. There were 5 replicate wells in each group.

[0100] 7.EdU proliferation staining kit

[0101] (1) Slide: Cells are plated in a 12-well plate at an appropriate density and placed on a cell slide in advance. After the cells adhere to the wall, the corresponding drug administration or viral infection treatment is performed.

[0102] (2) Use complete culture medium to dilute the EdU solution at a ratio of 1000:1.

[0103] (3) EDU incubation: After drug administration or viral infection, the culture medium was discarded and 500 μl of diluted EdU culture medium was added to each well of a 12-well plate. The cells were incubated in a constant temperature incubator at 37°C and 5% CO2 for 4 hours, and then the culture medium was discarded.

[0104] (4) Wash with PBS for 5 minutes twice.

[0105] (5) Then add 500 μl of tissue fixative to each well, fix for 30 minutes, and then discard.

[0106] (6) Add 500 μl of 2 mg / ml glycine to each well to neutralize excess aldehyde groups, incubate for 5 minutes, and discard the supernatant.

[0107] (7) Wash with PBS for 5 minutes twice.

[0108] (8) Add 500 μl of 0.5% Triton X-100 (prepared in PBS) to each well, permeabilize on a decolorizing shaker for 10 minutes, and wash with PBS for 5 minutes.

[0109] (9) Preparation of staining solution:

[0110]

[0111]

[0112] (10) Prepare in advance Then add 500 μl / well of staining solution and incubate at room temperature in the dark for 30 minutes.

[0113] (11) Discard the staining solution and permeabilize the cells again with 0.5% TritonX-100 (prepared in PBS) for 10 min each time, for 2 times.

[0114] (12) Add 500 μl of methanol to each well and wash for 5 minutes, wash twice, and then wash with PBS for 5 minutes.

[0115] (13) Dilute Reagent F with deionized water at a ratio of 100:1 and store in a dark place.

[0116] (14) Add 500 μl of 1× diluted F reaction solution, incubate in the dark for half an hour, and discard the staining solution.

[0117] (15) Add 500 μl of PBS and wash for 5 minutes x 3 times.

[0118] (16) Take out the slide, pick out the crawling slice, place it upside down on the slide, observe under a fluorescence microscope, and take pictures.

[0119] 8. Immunofluorescence

[0120] (1) Slide: Cells were plated in a 12-well plate at an appropriate density and placed on a cell slide in advance;

[0121] (2) After the corresponding treatment, the 12-well plate was removed, the culture medium was discarded, and PBS was added for washing once;

[0122] (3) Add 300 μl of tissue fixative to each well and fix for 15 minutes;

[0123] (4) Wash with PBS three times, 5 min each time;

[0124] (5) Add 300 μl of 0.2% Triton X-100 (prepared in PBS) to each well and permeabilize on a shaker for 15 min;

[0125] (6) Wash with PBS three times, 5 min each time;

[0126] (7) Blocking: Block with 8% goat serum at room temperature for 1 h;

[0127] (8) Discard the blocking solution, pick out the slide, dilute the primary antibody at a ratio of 1:200, add it dropwise to the slide, and incubate at 4 degrees overnight.

[0128] (9) The next day, discard the primary antibody and wash with PBS three times, 5 min each time;

[0129] (10) Dilute the secondary antibody at a ratio of 1:100 and incubate at room temperature for 1 h in the dark;

[0130] (11) Discard the secondary antibody and wash with PBS three times, 5 min each time;

[0131] (12) Pick out the slides, cover with DAPI, and store them in a dark, humidified box at 4°C.

[0132] 9. Cell Cycle

[0133] (1) Collect 2-5×10 6 cells (trypsinized with EDTA).

[0134] (2) Wash the cells once with 5 ml of room temperature PBS at 1000 r for 10 min, and discard the culture medium: resuspend the cells with 1 ml of PBS, then add 4 ml of PBS along the wall, cover the centrifuge tube, and gently mix by inverting.

[0135] (3) Fix the cells: First resuspend the cells with 300ul of PBS, then slowly add 1ml (-20) of pre-cooled 75% ethanol (prepared with high-pressure pure water) below the liquid surface, circling along the wall, and then add 4ml of 70% ethanol along the wall. Cover the centrifuge tube with a cap and gently mix by inverting.

[0136] (4) Incubate the fixed cells at 4°C overnight.

[0137] (5) Before use, centrifuge at 1000 r for 10 min to discard 75% ice ethanol and wash twice with pre-cooled PBS.

[0138] (6) Resuspend the cells with 150 μl of RNase.

[0139] (7) Add 150 μl of PI (Sigma, P4864, prepared in PBS), stain for 1 hour in the dark, and place at 4 degrees for 2 hours.

[0140] (8) Cell cycle was detected by flow cytometer Aria III.

[0141] 10. Construction of Mouse Model of Endometrial Injury

[0142] Construction of carotid artery wire injury mouse model: All animal experimental protocols were approved by the Institutional Animal Care and Use Committee of Tongji Hospital, Huazhong University of Science and Technology.

[0143] (1) Mice were anesthetized with sodium pentobarbital (80 mg / kg, intraperitoneal injection).

[0144] (2) Make a midline incision in the neck and carefully dissect the left carotid artery under a dissecting microscope. Ligate the external carotid artery proximal to the bifurcation with an 8-0 suture. Block the blood flow to the internal and common carotid arteries with a vascular clamp.

[0145] (3) A transverse incision was made around the external carotid artery. A guide wire (0.38 mm diameter, No. C-SF-15-15; Cook, Bloomington, USA) was introduced toward the aortic arch and rotated out five times.

[0146] (4) After carefully removing the guidewire, remove the vascular clamp, restore blood flow, and then close the skin incision.

[0147] After surgery, mice were intraperitoneally injected with LLY-507 at a dose of 1 mg per kilogram of body weight per day. A control group of mice received the same dose of DMSO. Tissues were collected from the animals for morphological and biochemical analysis after 28 days of treatment.

[0148] 11. Results

[0149] (1) The mechanism of SMYD2 regulating smooth muscle cell proliferation was verified by knocking down SMYD2 and overexpressing SMYD2. The results showed that compared with the PLKO control group, the number and proliferation level of VSMCs were significantly reduced after SMYD2 knockdown. Figure 1 、 Figure 2A 、 Figure 2B The number of VSMCs positively stained with the proliferation marker Ki67 was also significantly reduced. Figure 3A 、 Figure 3B Protein gel electrophoresis results showed that PCNA and P-H3 were significantly down-regulated, such as Figure 4A 、 Figure 4B Further flow cytometry analysis of the cell cycle revealed that SMYD2 knockdown caused most VSMCs to stagnate in the G0 / G1 phase and fail to enter the S phase. Figure 5 The protein levels of CDK4 and CDK6, key checkpoint proteins that regulate the transition from G0 / G1 to S phase, were also significantly reduced. Figure 6A 、 Figure 6B The above research results confirmed that knockdown of SMYD2 significantly inhibited the proliferation of VSMCs by arresting VSMCs in the G0 / G1 phase.

[0150] (2) In contrast to SMYD2 knockdown, SMYD2 overexpression significantly promoted the proliferation of VSMCs. Figure 7 、 Figure 8A 、 Figure 8B 、 Figure 9A 、 Figure 9B 、 Figure 10A 、 Figure 10B 、 Figure 11A 、 Figure 11B In addition, an intimal injury model was constructed in transgenic mice overexpressing SMYD2, and HE staining was performed. The results showed that compared with the control group, mice with smooth muscle-specific overexpression of SMYD2 had more severe intimal neoplasia, such as Figure 12 . Figure 13 Immunohistochemistry experiments showed that the expression level of the proliferation marker PCNA was significantly increased in the intimal injury model established in mice overexpressing SMYD2 compared with the control group. Figure 14 The above experimental results confirmed that overexpression of SMYD2 can promote the proliferation of VSMCs.

[0151] (3) By using DMSO or SMYD2 inhibitor (taking LLY-507 as an example) in the vascular endothelial injury model mice, HE staining verified that the use of SMYD2 specific inhibitor LLY-507 can intervene in neointimal hyperplasia, such as Figure 15 . And the inhibition significantly reduced the area of the new endometrium, such as Figure 16 Immunohistochemistry experiments showed that the expression of proliferation marker PCNA was significantly decreased after using LLY-507. Figure 17 The above experiments confirmed that SMYD2 inhibitors (taking LLY-507 as an example) can effectively inhibit intimal neoplasia caused by vascular damage.

[0152] Antibody catalog:

[0153]

[0154]

[0155] Primer catalog:

[0156]

[0157] Plasmid sequence:

[0158] Hum-SMYD2-sh1: GGAATGTTCCCCATGGTTGT

[0159] Hum-SMYD2-sh2:CGGCAAAGATCATCCATATAT

[0160] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Use of the SMYD2 inhibitor LLY-507 in the preparation of a drug for preventing and treating restenosis caused by intimal regeneration after vascular injury, wherein the drug plays a role in preventing and treating restenosis caused by intimal regeneration after vascular injury by inhibiting the proliferation of VSMCs.

2. The use according to claim 1, characterized in that: The administration method of the SMYD2 inhibitor includes at least one of oral administration, intravenous injection, subcutaneous embedment, drug-eluting stent administration, and drug-coated balloon administration.

3. The use according to claim 2, characterized in that: The administration methods of SMYD2 inhibitors include drug-eluting stents and drug-coated balloons.

Citation Information

Patent Citations

  • Novel aryl-cyanoguanidine compounds

    US20180118722A1