A strain HB for rapid degradation of pleuromutilin and its application
By providing strain HB that quickly degrades leptin, the problem of difficult to effectively degrade leptin in the prior art is solved, and the effect of efficient degradation of leptin is achieved, reducing environmental pollution and drug resistance risks.
Patent Information
- Application Number
- CN202211643610.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-20
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2042-12-20
AI Technical Summary
The prior art is difficult to effectively degrade leptin, resulting in an increase in environmental pollution and drug resistance risks.
A strain HB that rapidly degrades pleurin is provided, and by culturing the strain in microbial culture medium, it can rapidly degrade pleurin.
Strain HB can significantly degrade leptin in a short period of time, and has high degradation efficiency, which is suitable for reducing environmental pollution and drug resistance risks.
Smart Images

Figure CN116004401B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of microbiology, and particularly relates to a strain HB capable of rapidly degrading pleuromutilin and its application. Background Art
[0002] Pleuromutilin is isolated from the culture of Pleurotus mutilus and is the precursor of pleuromutilin - type semi - synthetic derivatives. Pleuromutilin and its derivatives can bind to the 50S subunit of the bacterial ribosome subunit, inhibiting bacterial protein synthesis. It has a unique curative effect on many Gram - positive bacteria and mycoplasma infections.
[0003] The application time of pleuromutilin - type antibiotics is still short, and drug resistance is not yet prominent, showing great development potential. However, Escherichia coli mutants resistant to tylosin have been found. Tylosin cannot smoothly enter the ribosome binding pocket, resulting in strong drug resistance in bacteria. Effectively degrading pleuromutilin can reduce the entry of this type of antibiotic into the environment, reducing environmental pollution and the risk of drug resistance. Pleuromutilin is obtained by extracting the fermentation metabolites of Pleurotus mutilus. The waste mycelium residue of pleuromutilin produced during the fermentation process contains ultra - high concentrations of pharmaceutical pollutants such as pleuromutilin. Intermediate products and solvents in the chemical synthesis and purification processes also contain some pharmaceutical pollutants, which belong to national hazardous wastes and need to be handed over to qualified formal units for treatment according to the regulations for the treatment of hazardous wastes. During the treatment process, these hazardous wastes need to be dried and sealed, which not only increases the floor area but also increases the possibility of secondary pollution, and the treatment cost is relatively high.
[0004] As an emerging pollutant, the residual phenomenon of antibiotics in the environment is very common at present. Antibiotic residues can be detected in environmental samples such as wastewater, urban sludge, and soil. Although the half - life of antibiotics is not long, their continuous emission into the environment will form a long - term environmental risk. The biodegradation of pleuromutilin is an efficient and economical treatment method. Finding a strain that can effectively degrade pleuromutilin has become an urgent task for controlling pleuromutilin pollution. Summary of the Invention
[0005] The purpose of the present invention is to provide a strain HB capable of rapidly degrading pleuromutilin and its application. After inoculation, it can degrade pleuromutilin with high degradation efficiency.
[0006] To achieve the above - mentioned purpose, the present invention adopts the following technical solutions:
[0007] One object of the present invention is to provide a strain HB for degrading pleuromutilin, with the preservation number of CGMCC NO.40244.
[0008] Another object of the present invention is to provide a culture of a strain for degrading pleuromutilin, which is a substance obtained by culturing the strain HB in a microbial medium.
[0009] Preferably, the culture includes a bacterial suspension, a spore suspension, a fermentation broth or a metabolite of the strain HB.
[0010] Preferably, the microbial medium includes a solid potato medium or a liquid potato medium.
[0011] Another object of the present invention is to provide a preparation, including the strain HB and / or the above-mentioned culture.
[0012] Preferably, the strain HB or the culture is freeze-dried or dissolved in a suitable solvent.
[0013] Preferably, the solvent includes sterile water or a microbial medium.
[0014] The present invention also provides the application of the above-mentioned strain HB, the above-mentioned culture or the above-mentioned preparation in degrading pleuromutilin.
[0015] As an embodiment, the strain HB and / or the culture are inoculated into a matrix containing pleuromutilin.
[0016] Preferably, the inoculation amount of the strain HB is not less than 5×10 8 spores / ml or 5×10 8 spores / g.
[0017] Compared with the prior art, the present invention has the following advantages and effects:
[0018] The strain HB of the present invention belongs to the fungus of the genus Talaromyces, and has the effect of rapidly degrading pleuromutilin. The relative degradation rate of pleuromutilin by the strain HB is 29.43% when the culture time is relatively short (7d), and the relative degradation rate of pleuromutilin is 19.91% when the culture time is relatively long (28d). The strain HB of the present invention is more conducive to degrading pleuromutilin in the initial stage of inoculation, and is combined with other long-acting strains for degrading pleuromutilin in the later stage of inoculation, so as to achieve a better effect of degrading pleuromutilin. The strain HB of the present invention can be used for preventing and controlling the pollution risk of pleuromutilin flowing into the environment, and has strong operability, low cost, good effect and good safety.
[0019] Deposit description
[0020] The strain (Talaromyces sp.) HB was deposited at the General Microbiology Center of the China Microbial Culture Collection Center on July 13, 2022, with the deposit number CGMCC NO. 40244; Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. Description of the Drawings
[0021] Figure 1 It is the colony morphology of strain HB cultured for 1 week.
[0022] Figure 2 It is the sequence alignment diagram of strain HB on NCBI.
[0023] Figure 3 It is the relative degradation rate of pleuromutilin in the LPD culture solution of strain HB. Detailed Implementation Modes
[0024] In the present invention, strain HB (Talaromyces sp.) was isolated and purified from the composting process of pleuromutilin pharmaceutical bacterial residues. This strain has the function of rapidly degrading pleuromutilin, and the relative degradation rate of pleuromutilin reaches 29.43% when cultured for 7 days.
[0025] Currently, strain HB has been deposited at the General Microbiology Center of the China Microbial Culture Collection Center, with the deposit number: CGMCC NO. 40244; Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences; Deposit date: July 13, 2022, and the taxonomic name is Talaromyces sp.
[0026] The morphological characteristics of strain HB of the present invention are: grayish-white powder.
[0027] The ITS sequence of strain HB of the present invention is:
[0028] CTTTTGATATGCTTAAGTTCAGCGGGTAACTCCTACCTGATCCG
[0029] AGGTCAACCATAATGGAAAATGTGGTGGTGACCAACCCCCGC
[0030] AGGTCCTTCCCGAGCGAGTGACAGAGCCCCATACGCTCGAGGA
[0031] CCAGACGGACGTCGCCGCTGCCTTTCGGGCAGGTCCCCGGGGG
[0032] GACCACACCCAACACACAAGCCGTGCTTGAGGGCAGAAATGA
[0033] CGCTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAAT
[0034] GTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCAC
[0035] ATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACC
[0036] AAGAGATCCATTGTTGAAAGTTTTGACAATTTTCATAGTACTCA
[0037] GACAGCCCTTCTTCATCAGGGTTCACGAAGCGCTTCGGCGGGC
[0038] GCGGGCCCGGGGACGGGTGTCCCCCGGCGACCAGGGAGCCCC
[0039] AGTGGGCCCGCCAAAGCAACAGGTGTAGAGAGACAAGGGTGG
[0040] GAGGTTGGGCCGCGAGGGCCCGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGCT, the strain HB was identified as a fungus of the genus Talaromyces (Talaromyces sp.).
[0041] In the present invention, the culture of the above-mentioned strain HB refers to the substance obtained by culturing the strain HB in a microbial culture medium, including but not limited to the bacterial suspension, spore suspension, fermentation broth or its metabolites of the strain HB. The microbial culture medium herein refers to a culture medium that can achieve the growth and propagation of the strain HB, including but not limited to solid potato medium or liquid potato medium, as well as improved culture media for better growth or metabolism of the strain HB on the potato medium. Those skilled in the art can adjust or improve the culture medium and culture conditions according to the actual culture situation.
[0042] On the other hand, the present invention also provides a preparation for degrading pleuromutilin, which contains the above-mentioned strain HB of the present invention and / or its culture. The type of the preparation of the present invention can be in the form of a solution, a dispersant, a suspending agent, a granule, etc. The preparation can be produced according to methods well-known to those skilled in the art. In one embodiment, the strain HB of the present invention or its culture can be prepared into a preparation by freeze-drying or dissolving in a suitable solvent. Freeze-drying uses conventional methods in the art. The solvent can be selected from water, microbial culture medium, etc.
[0043] In one embodiment, the preparation of the present invention may further include different microbial strains having the same pleuromutilin-degrading activity as the strain HB of the present invention. Different microorganisms are used in combination, and the degradation characteristics of different microorganisms on pleuromutilin are utilized to improve the degradation effect on pleuromutilin.
[0044] The strain HB of the present invention and its culture, as well as the preparation containing the strain HB and / or its culture, have the function of degrading pleuromutilin and can be applied to degrade the residual pleuromutilin in the environment or waste. It can also be used as the sole or partial active ingredient of a pleuromutilin degrading agent.
[0045] In one embodiment, the strain HB of the present invention, and / or the culture, and / or the preparation are mixed in a matrix containing pleuromutilin for cultivation to achieve the effect of degrading pleuromutilin. Preferably, the inoculation amount of the strain HB is not less than 5×10 8 spores / ml or 5×10 8 spores / g. It has been experimentally confirmed that the relative degradation rate of pleuromutilin by the strain HB of the present invention is 29.43% at 7 days of cultivation and 19.91% at 28 days of cultivation, and it has a relatively high degradation efficiency for pleuromutilin in the initial stage of inoculation.
[0046] The present invention will be further described below in conjunction with specific embodiments, but the present invention is not limited to the following embodiments. The experimental methods used in the embodiments are all conventional methods unless otherwise specified, and the materials, reagents, etc. used are all commercially available unless otherwise specified.
[0047] Example 1
[0048] Isolation and purification of strain HB
[0049] At different stages of pleuromutilin pharmaceutical residue composting, samples were collected from the compost pile and spot-inoculated on Martin's (MB, Martin Broth) plate medium, and incubated at 30°C for 1 week. Fungi with different morphologies were selected and spot-inoculated on Modified Martin's (MMB, Modified Martin Broth) plate medium, and incubated at 30°C for 1 week.
[0050] Fungi of various morphologies were selected and inoculated onto solid potato (PDA, Potato Dextrose Agar) culture medium, cultured at 30°C for one week and then transferred to PDA culture medium. The process was repeated until purified colonies were formed.
[0051] Add 100 ml of liquid potato (LPD, Liquid Potato Dextrose) culture medium to a 250 ml conical flask and add 5 × 10 8 Each purified strain was inoculated with an inoculum of spores / ml. Each inoculated treatment and blank culture solution had 12 bottles, and pleuromutilin was added at a concentration of 200 mg / L, and cultured in a shaking table at 30°C and 150 rpm. Three bottles of inoculated treatment and blank culture solution were taken every 7 days for pleuromutilin content detection, and strains with higher pleuromutilin degradation rates were screened to obtain strain HB.
[0052] Figure 1 The morphology of HB strain after 1 week of culture on PDA (solid potato culture medium) plate. The morphological characteristics of strain HB are: off-white powder.
[0053] Example 2
[0054] Molecular identification of strain HB
[0055] The strain HB was identified and screened using ITS sequencing.
[0056] The specific method is as follows:
[0057] 1. Pick a small amount of bacteria, mix them thoroughly with 50 μl of Lysis Buffer A (TSINGKE, Beijing), incubate at 95°C for 10 min, shake, centrifuge, take 25 μl of the supernatant and mix it with an equal volume of Dilution Buffer B (TSINGKE, Beijing).
[0058] 2. PCR system (25 μl): 1 μl of lysate, 12.5 μl of Mix (T5 Plant, TSINGKE, Beijing), 1 μl each of primers ITS4 (5'-TCCTCCGCTTATTGATATGC-3') and ITS5 (5'-GGAAGTAAAAGTCGTAACAAGG-3'), and 9.5 μl of water.
[0059] 3. PCR program: 98℃3min; 98℃10s, 56℃10s, 72℃15s, 34 cycles; 72℃3min; 16℃indefinitely.
[0060] After amplification, first-generation sequencing was performed, and the sequencing results were BLAST-aligned on NCBI (National Center for Biotechnology Information, https: / / www.ncbi.nlm.nih.gov / ) Figure 2 ), and the strain was identified as Talaromyces sp. (a fungus of the genus Talaromyces).
[0061] Example 3
[0062] Degradation effect of strain HB on pleuromutilin
[0063] Add 100 ml of liquid potato (LPD, Liquid Potato Dextrose) medium to a 250 ml Erlenmeyer flask, and inoculate strain HB at an inoculation amount of 5×10 8 spores / ml. There were 12 bottles each for the inoculated treatment and the blank culture solution. Pleuromutilin was added at a concentration of 200 mg / L, and the cultures were incubated on a shaker at 30 °C and 150 rpm. Three bottles each of the inoculated treatment and the blank culture solution were taken every 7 days for the determination of the pleuromutilin content.
[0064] Pour the test bacterial liquid into a Buchner funnel and filter it with a vacuum pump. Take 1 ml of the filtrate, pass it through a 0.22 μm filter membrane, and collect it in a 1.5 ml injection vial for high-performance liquid chromatography. The chromatographic conditions were as follows: injection volume 1.8 μl, flow rate 0.5 ml / min, column temperature 30 °C, and the mobile phase was methanol:acetonitrile:water with a volume ratio of 1:4:5.
[0065] The formula for calculating the relative degradation rate of pleuromutilin is as follows:
[0066] Relative degradation rate (%) = (C kt - C t ) / C kt * 100%
[0067] Where C kt is the concentration (mg / kg) of pleuromutilin in the culture solution after t days of culture in the blank treatment, and C t is the concentration (mg / kg) of pleuromutilin in the culture solution after t days of culture in the treatment inoculated with strain HB.
[0068] Figure 3 The relative degradation rates of pleuromutilin for strain HB cultured in LPD culture solution for 7, 14, 21, and 28 days. From Figure 3It can be seen that the relative degradation rate of pleuromutilin by strain HB was the highest at the initial inoculation stage (7 days), reaching 29.43%. As the culture time extended, the degradation rate of pleuromutilin by strain HB slightly decreased. Therefore, strain HB of the present invention is suitable for achieving the technical effect of highly degrading pleuromutilin at the initial inoculation stage. To improve the degradation effect of pleuromutilin during the overall culture process, strain HB of the present invention is suitable for co-culturing with strains that can degrade pleuromutilin with long-term effectiveness to degrade pleuromutilin.
[0069] The above embodiments are the best implementation manners of the present invention, but the implementation manners of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement manners and are all included in the protection scope of the present invention.
Claims
1. A strain HB for degrading pleuromutilin, characterized in that, Its preservation number is CGMCC NO. 40244.
2. A culture of the pleuromutilin-degrading strain according to claim 1, characterized in that, The culture is a bacterial suspension, spore suspension or fermentation broth obtained by culturing the strain HB described in claim 1 in a microbial culture medium; the microbial culture medium is a solid potato culture medium or a liquid potato culture medium.
3. A preparation, characterized in that, It includes the strain HB described in claim 1, and / or the culture described in claim 2.
4. The preparation according to claim 3, characterized in that, The strain HB or the culture is freeze-dried or dissolved in a solvent.
5. The preparation according to claim 4, characterized in that, The solvent includes sterile water or a microbial culture medium.
6. Use of the strain HB according to claim 1, the culture according to claim 2, and the preparations according to claims 3 to 5 in degrading pleuromutilin and in preparing products for degrading pleuromutilin.
7. The use according to claim 6, characterized in that, The strain HB and / or the culture is inoculated into a substrate containing pleuromutilin.
8. The use according to claim 7, characterized in that, The inoculation amount of the strain HB is not less than 5×10 8 spores / mL or 5×10 8 spores / g.
Citation Information
Patent Citations
Tylosin degrading bacterium and application thereof
CN107557315A
Tylosin degrading bacteria and application thereof
CN109652350A