Fluorescent Quantitative PCR Detection Method for the Concentration of Spongospora subterranea f. sp. subterranea Resting Sporangia

Abstract

The present invention discloses a fluorescence quantitative PCR detection method for the concentration of resting sporangia of potato powdery scab pathogen. In this method, the fluorescence quantitative PCR primer set for detecting the concentration of resting sporangia of potato powdery scab pathogen is composed of the nucleotide shown in Sequence 1 in the sequence listing and the nucleotide shown in Sequence 2 in the sequence listing. The method of the present invention has a fast detection speed, high sensitivity and strong specificity, is more conducive to the detection of resting sporangia of potato powdery scab pathogen in potato seeds and soil, and provides a basis for the prevention of potato powdery scab.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology. Specifically, the present invention relates to a fluorescence quantitative PCR detection method for the concentration of resting sporangia of Spongospora subterranea f. sp. subterranea, the causative agent of potato powdery scab. Background Art

[0002] Potato (Solanum tuberosum L.) is the fourth largest food crop in the world, after wheat, rice, and corn. China is a major potato-producing country, ranking first in both planting area and total output in the world. Potato powdery scab is a fungal soil-borne disease caused by Spongospora subterranea f. sp. subterranea, belonging to the class Chytridiomycetes and the genus Spongospora. It is a very important soil-borne disease in potato production and occurs in potato cultivation areas around the world. When the disease is severe, it can cause a reduction in potato yield of more than 20%. Even when the disease is mild, it will also affect the quality of potatoes.

[0003] The pathogen of potato powdery scab overwinters in potato seeds or in the soil with diseased residues in the form of resting sporangia. Diseased potato seeds and soil become the primary infection sources of potato powdery scab in the following year. The pathogen of potato powdery scab is an obligate intracellular parasite and cannot be cultured in vitro. Currently, there is no specific fungicide for the control of potato powdery scab. Usually, soil treatment and seed potato treatment are mainly used for prevention and control. However, the research and reports on the detection methods for the pathogen of potato powdery scab are very few. At the same time, traditional pathogen detections mainly include etiological detections (Gram staining method, morphological structure observation method, indicator plant inoculation and identification method) and immunological detections (latex agglutination test, enzyme-linked immunosorbent assay, fluorescence immunoassay), etc. These detections are time-consuming, have low sensitivity, require a large amount of manpower and material resources, and have extremely high requirements for classical taxonomy, and are no longer applicable to the rapid detection of diseases. Therefore, the development of rapid, sensitive, accurate, and convenient molecular detection technologies for soil and seed potatoes is of great significance for the prevention of potato powdery scab. Summary of the Invention

[0004] The purpose of the present invention is to overcome the deficiencies in the prior art, adopt fluorescence quantitative PCR technology, and establish a detection method with fast detection speed, high sensitivity, and strong specificity, which is more conducive to the detection of resting sporangia of the pathogen of potato powdery scab in potato seeds and soil, and provides a basis for the prevention of potato powdery scab.

[0005] Based on this, the present invention provides a fluorescence quantitative PCR primer set for detecting the concentration of resting sporangia of the pathogen of potato powdery scab, which is composed of the nucleotide shown in Sequence 1 in the sequence listing and the nucleotide shown in Sequence 2 in the sequence listing.

[0006] The present invention also provides a fluorescence quantitative PCR kit for detecting the concentration of dormant sporangia of potato powdery scab pathogen, which includes the fluorescence quantitative PCR primer set described in claim 1.

[0007] The kit also includes PCR reaction reagents.

[0008] The application of the above-mentioned fluorescence quantitative PCR primer set and the kit in detecting the concentration of dormant sporangia of potato powdery scab pathogen also belongs to the protection scope of the present invention.

[0009] The fluorescence quantitative PCR method provided by the present invention for detecting the concentration of dormant sporangia of potato powdery scab pathogen includes the following steps:

[0010] 1) Suspending the sample to be tested with water to obtain a suspension;

[0011] 2) Extracting the DNA of the suspension of the sample to be tested;

[0012] 3) Using the DNA of the sample to be tested as a template, performing fluorescence quantitative PCR detection with the fluorescence quantitative PCR primer set described in claim 1 to obtain a Ct value;

[0013] 4) Substituting the Ct value obtained in step 3) into the linear curve relationship y = -4.6904x + 47.18 between the concentration of dormant sporangia of potato powdery scab pathogen and the Ct value obtained in step 1), where y is the Ct value, x = lgA, and A is the concentration of dormant sporangia of potato powdery scab pathogen, with the unit of number / ml, to convert and obtain the concentration of dormant sporangia of potato powdery scab pathogen in the suspension of the sample to be tested.

[0014] Among them, the reaction system of the fluorescence quantitative PCR is a 50 μL system, including 1 μL of template, 1 μL of Taq enzyme, 1 μL of the nucleotide shown in sequence 1 in the sequence listing with a concentration of 10 μM, 1 μL of the nucleotide shown in sequence 2 in the sequence listing with a concentration of 10 μM, 5 μL of PCR Buffer, 4 μL of dNTP, and 37 μL of ddH2O.

[0015] The reaction program of the fluorescence quantitative PCR is: first at 95°C for 2 min, then at 95°C for 15 s, at 60°C for 1 min, for 45 cycles, and finally at 50°C for 2 min and at 95°C for 10 min.

[0016] In the above step 2), the method for extracting the DNA of the suspension of the sample to be tested is to freeze it with liquid nitrogen, grind it for 1 min, boil it in boiling water for 3 - 6 min, centrifuge it at 14000 r / min for 10 min, and take the supernatant as the DNA solution.

[0017] The method of the present invention has a fast detection speed, high sensitivity and strong specificity, which is more conducive to the detection of resting sporangia of Spongospora subterranea f. sp. subterranea in potato seeds and soil, and provides a basis for the prevention of potato powdery scab. The method of the present invention can avoid the defects that when the soil sample is examined under a cell counter, the concentration of resting sporangia in the soil sample is too low, the detection concentration by the cell counter is quite different from the calculated concentration, or the number of resting sporangia cannot be counted during the limited sample counting, and is more sensitive and accurate. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 For the morphological identification of resting sporangia of the pathogen causing potato powdery scab

[0019] A. Morphology of resting sporangia of Spongospora subterranea f. sp. subterranea (quoted from Francisco G. Bittara), B - D. Morphology of sporangia identified in this experiment.

[0020] Figure 2 For the linear relationship diagram between the concentration of resting sporangia of the pathogen causing potato powdery scab and the DNA concentration

[0021] Figure 3 For the electrophoretic detection results of PCR products amplified by primers A - E

[0022] M: Marker, A - E, are primer numbers, 1 - 3, are three replicates of each pair of primers.

[0023] Figure 4 . Linear relationship diagram between the logarithm of the DNA concentration of resting sporangia of the pathogen causing potato powdery scab and the Ct value

[0024] Figure 5 . Linear relationship diagram between the logarithm of the concentration of resting sporangia of the pathogen causing potato powdery scab and the Ct value DETAILED DESCRIPTION OF THE EMBODIMENTS

[0025] The present invention will be further described below with reference to the accompanying drawings and specific embodiments for better understanding. For those not specified in the embodiments, the techniques or conditions described in the literature in this field or according to the product specifications are followed. For reagents or instruments not specified by the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0026] Example 1. Fluorescent quantitative PCR method for detecting resting sporangia of the pathogen causing potato powdery scab

[0027] 1. Materials

[0028] 1.1 Diseased potato tubers and soil infected with potato powdery scab

[0029] In this study, diseased potato tubers, soil infected with potato powdery scab, control potatoes and soil samples were all collected from the potato production base in Guyuan County, Hebei Province.

[0030] 1.2 Reagents and Instruments

[0031] Table 1. Reagents and Instruments

[0032]

[0033] 1.3 Observation on the Morphology of the Dormant Sporangia of the Potato Powdery Scab Pathogen

[0034] In this study, the morphology of the dormant sporangia of the pathogen causing potato powdery scab was first observed. The soil on the surface of the diseased potato tubers was washed off with ddH2O and air-dried. The scabs on the surface of the potato skin were gently scraped off slowly, made into a smear, and the morphology of the dormant sporangia of the potato powdery scab pathogen was observed under an optical microscope.

[0035] From the epidermis of the potato tubers with powdery scab, we isolated the dormant sporangia of the potato powdery scab pathogen ( Figure 1 ), which are spherical in shape, brown or dark brown (B - D). It is reported that the number of spores in a single dormant sporangium can reach 500.

[0036] 1.4 Preparation of the Suspension of the Dormant Sporangia of the Potato Powdery Scab Pathogen

[0037] Take the potato tubers with powdery scab. After cleaning with water, cut 0.5 g of the powdery scab lesion and soak it in 5 ml of 1% NaCl solution for 1 min. After taking out the lesion and putting it into a centrifuge tube, add 1 ml of ddH2O, vortex for 1 min, transfer all the liquid to a new centrifuge tube, centrifuge at 14000 rpm for 10 min, discard the supernatant, and re - add 0.4 ml of ddH2O to prepare a suspension of dormant sporangia, and count the concentration of the dormant sporangia under a cell counter.

[0038] 1.5 DNA Extraction and Quantification of the Potato Powdery Scab Pathogen

[0039] The suspension of the dormant sporangia of the potato powdery scab pathogen prepared in 1.4 was serially diluted 2 - fold in a centrifuge tube. After putting the centrifuge tube into a mortar and adding liquid nitrogen to freeze the sporangia suspension, use a grinding rod to grind the sporangia suspension in the centrifuge tube for 1 min, boil in boiling water for 6 min, centrifuge at 14000 r / min for 10 min, then take the supernatant as the DNA solution, and measure the DNA concentration using a multi - functional microplate reader.

[0040] As shown in Table 2, the DNA extraction method established in this study can stably extract DNA from dormant sporangia of the pathogen in potato lesions with powdery scab. The OD260 / 280 values are stable within the range of 1.56-1.88, meeting quality requirements. It also shows a certain correlation with the number of dormant sporangia, y = 8E-5x - 6.5127, where y is the DNA concentration in ng / ul and x is the dormant sporangium concentration in counts / ml. The correlation coefficient R2 value reached 0.999 ( Figure 2 The results showed that the DNA extraction method for dormant sporangia of potato powdery scab established in this study is reliable, simple to operate and economical.

[0041] Table 2. Results of DNA concentration determination of potato powdery scab infected potatoes

[0042]

[0043] 1.6 Establishment of a fluorescence quantitative PCR method for detecting the concentration of dormant sporangia of potato powdery scab pathogen

[0044] Specific primers targeting the 18S RNA gene of the pathogen causing potato powdery scab (Access No. AY604172.1) were designed using Primer 5.0 software, synthesized by Beijing Liuhe BGI Genomics Co., Ltd., and screened for amplification efficiency. A fluorescence quantitative PCR reaction system was established based on the selected primers.

[0045] As shown in Table 3, this study designed 10 pairs of specific primers for the 18S RNA of the potato powdery scab pathogen. Based on primer specificity and amplification efficiency, primer D was selected to further establish a fluorescence quantitative PCR method for detecting dormant sporangia of potato powdery scab pathogen. Gel electrophoresis results showed that primer D amplified a single, clear target band ( Figure 3 ), and the results of fluorescence quantitative PCR showed (Table 4) that as the concentration of pathogen DNA decreased, the fluorescence quantitative PCR Ct value increased, and the logarithmic value of DNA concentration and Ct value showed a good linear relationship y = 1.2721x + 26.91, where y is the Ct value, x is the logarithmic value of DNA concentration log2A, and A is the DNA concentration in ng / μl. The correlation coefficient R2 value was 0.9919 ( Figure 4 ), indicating that primer D can be well used for quantitative and qualitative analysis of potato powdery scab pathogen sporangia detection. The logarithm of the concentration of dormant sporangia of potato powdery scab pathogen was plotted as the horizontal axis and the Ct value was plotted as the vertical axis. A linear curve between the concentration of dormant sporangia of potato powdery scab pathogen and the Ct value was established, which showed a good correlation y=-4.6904x+47.18, where y is the Ct value, x is the logarithm of the concentration of dormant sporangia lgA, and A is the concentration of dormant sporangia in units of pieces / ml. The R2 value reached 0.9952( Figure 5) That is, by using the 18S RNA detection primers for the resting sporangia of potato powdery scab pathogen designed in this study, the concentration of the resting sporangia of potato powdery scab pathogen can be quantitatively detected.

[0046]

[0047] Table 4. Ct values of fluorescence quantitative PCR

[0048]

[0049] The fluorescence quantitative PCR detection method for the concentration of the resting sporangia of potato powdery scab pathogen established by the present invention is as follows:

[0050] 1. Extract the DNA of the resting sporangia of potato powdery scab pathogen from diseased potatoes: Obtain the sporangia suspension, freeze the sporangia suspension in liquid nitrogen, grind it for 1 min, boil it in boiling water for 6 min, and after centrifuging at 14000 r / min for 10 min, take the supernatant as the DNA solution.

[0051] 2. Using the DNA solution obtained in step 1 as a template, perform PCR amplification.

[0052] The PCR primer sequences are as follows:

[0053] Forward primer: 5’TATCTTGGTTCCCACAACGATGA 3’ (Sequence 1 in the sequence listing);

[0054] Reverse primer: 5’CAAGGATATCTCGAAAGCGCAAC 3’ (Sequence 2 in the sequence listing).

[0055] The reaction system of PCR is: 50 μL system, including 1 μL of template, 1 μL of Taq enzyme, 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 5 μL of PCR Buffer, 4 μL of dNTP, and 37 μL of ddH2O.

[0056] The reaction program of PCR is: 95 °C for 5 min, (95 °C, 30 s, 58 °C 30 s, 72 °C 1 min for 36 cycles), 72 °C for 10 min, 4 °C, and the experiment is repeated at least 5 times.

[0057] 3. Substitute the Ct value of the PCR reaction into y = -4.6904x + 47.18, where y is the Ct value, x is the logarithm of the resting sporangia concentration lgA, and A is the resting sporangia concentration, with the unit of number / ml.

[0058] Example 2. Application of the fluorescence quantitative PCR detection method for the concentration of the resting sporangia of potato powdery scab pathogen

[0059] Using the method established in 1.6 of Example 1, the concentrations of resting sporangia of the potato powdery scab pathogen were detected in diseased potato tubers and soil collected from the potato production base in Guyuan County, Hebei Province. DNA of the resting sporangia of the potato powdery scab pathogen was extracted from the diseased potato tubers.

[0060] The method for DNA extraction from soil samples is as follows:

[0061] 1. Obtaining the sporangia suspension: The collected soil samples were passed through a 30-mesh sieve and then air-dried naturally. 10 g of the air-dried soil was weighed and soaked in 50 mL of ddH2O, stirred for 10 min, and then left to stand for 15 min. 1 mL of the supernatant was taken and used for microscopic examination and DNA preparation respectively.

[0062] 2. DNA preparation process: The sporangia suspension obtained in step 1 was treated with liquid nitrogen freezing, ground for 1 min, boiled in hot water for 3 min, centrifuged at 14000 rpm for 10 min, and the supernatant was taken as the DNA solution.

[0063] The DNA samples obtained from the diseased potato tubers and soil samples were respectively subjected to fluorescence quantitative PCR detection according to the method established in 1.6 of Example 1.

[0064] 1. Extracting DNA of the resting sporangia of the potato powdery scab pathogen from diseased potato tubers: The sporangia suspension was obtained, and the sporangia suspension was treated with liquid nitrogen freezing, ground for 1 min, boiled in boiling water for 6 min, centrifuged at 14000 r / min for 10 min, and the supernatant was taken as the DNA solution.

[0065] 2. Using the DNA solution obtained in step 1 as a template for PCR amplification.

[0066] The PCR primer sequences are as follows:

[0067] Forward primer: 5’TATCTTGGTTCCCACAACGATGA 3’ (Sequence 1 in the sequence listing);

[0068] Reverse primer: 5’CAAGGATATCTCGAAAGCGCAAC 3’ (Sequence 2 in the sequence listing).

[0069] The reaction system of PCR is: 50 μL system, including 1 μL of template, 1 μL of Taq enzyme, 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 5 μL of PCR Buffer, 4 μL of dNTP, and 37 μL of ddH2O.

[0070] The reaction program of PCR is: 95°C for 5 min, (95°C for 30 s, 58°C for 30 s, 72°C for 1 min for 36 cycles), 72°C for 10 min, 4°C, and the experiment was repeated at least 5 times.

[0071] 3. Substitute the Ct value of the PCR reaction into y = -4.6904x + 47.18, where y is the Ct value and x is the logarithm of the dormant sporangium concentration lgA, and A is the dormant sporangium concentration, with the unit of number per ml.

[0072] Using the method established in this study, potato tubers and soil samples with potato powdery scab collected from the potato production base in Guyuan County, Hebei Province were detected. As shown in Table 5, among the 8 diseased tuber samples, dormant sporangia of the powdery scab pathogen were detected in all samples. The Ct value range was 20.218 - 27.451, and the corresponding calculated range of dormant sporangium numbers was 1.61×10 4 -5.60×10 5 per mL, and the range of sporangium numbers detected by the cell counter was 1.01×10 4 -6.20×10 5 per mL. Among the 8 soil samples, 3 samples were not detected, and the Ct value range of the 5 detected samples was 25.389 - 19.523. The calculated concentration of dormant sporangia was 5.80×10 3 -4.40×10 4 per mL. However, due to the fact that when examining the soil samples under the cell counter, the concentration of dormant sporangia in the soil samples was too low, there was a large difference between the concentration detected by the cell counter and the calculated concentration, or the number of dormant sporangia could not be counted during the limited sample counting. That is, the method established in this study is more sensitive, but still considering the detection accuracy, when the Ct value detected by fluorescence quantitative PCR is higher than 29, it is recommended to carefully evaluate whether the detected sample contains dormant sporangia of the potato powdery scab pathogen and its quantity.

[0073] Table 5. Application of the fluorescence quantitative PCR detection method for the concentration of dormant sporangia of potato powdery scab

[0074]

[0075] N: Not detected

[0076] In summary, this study established a rapid and simple fluorescence quantitative PCR detection method for dormant sporangia of the potato powdery scab pathogen. This method is simple, economical, and rapid from sample DNA extraction to detection operation, and is of great significance for the monitoring and prevention of potato powdery scab in China.

[0077] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, equivalent transformations and modifications made without departing from the spirit and scope of the present invention should all be covered within the scope of the present invention.

Claims

1. A fluorescence quantitative PCR method for detecting the concentration of resting sporangia of potato powdery scab pathogen, comprising the following steps: 1) Suspending the test sample with sterilized distilled water to obtain a suspension of resting sporangia of potato powdery scab pathogen; 2) Extracting DNA from the suspension of resting sporangia of potato powdery scab pathogen in the test sample; 3) Using the DNA of the test sample as a template, performing fluorescence quantitative PCR detection with a fluorescence quantitative PCR primer set to obtain a Ct value; the fluorescence quantitative PCR primer set is composed of the nucleotide shown in Sequence 1 in the sequence listing and the nucleotide shown in Sequence 2 in the sequence listing; 4) Substitute the Ct value obtained in step 3) into the linear curve relationship between the concentration of the resting sporangia of the potato powdery scab pathogen and the Ct value: y = -4.6904x + 47.18, where y is the Ct value, x = lgA, A is the concentration of resting sporangia of potato powdery scab pathogen, with the unit of number / ml, and the concentration of resting sporangia of potato powdery scab pathogen in the suspension of the test sample is obtained through conversion; In the said step 2), the method for extracting DNA from the suspension of resting sporangia of potato powdery scab pathogen in the test sample is to freeze the sporangia suspension with liquid nitrogen, grind for 1 min, boil in boiling water for 3 - 6 min, centrifuge at 14000 r / min for 10 min, and take the supernatant as the DNA solution; The reaction system of the fluorescence quantitative PCR is a 50 μL system, including 1 μL of template, 1 μL of Taq enzyme, 1 μL of the nucleotide shown in Sequence 1 in the sequence listing with a concentration of 10 μM, 1 μL of the nucleotide shown in Sequence 2 in the sequence listing with a concentration of 10 μM, 5 μL of PCRBuffer, 4 μL of dNTP, and 37 μL of ddH2O; The reaction program of the fluorescence quantitative PCR is: first at 95°C for 5 min, then at 95°C for 30 s, 58°C for 30 s, 72°C for 1 min, for 36 cycles, and finally at 72°C for 10 min.

Images