Application of Tomato SlCab12 Gene in Enhancing Resistance to Tomato Chlorotic Virus

Abstract

The present invention discloses an application of a tomato SlCab12 gene in enhancing disease resistance to tomato chlorotic virus, and the application method is: the tomato SlCab12 gene is overexpressed in a plant to enhance the disease resistance of the plant to tomato chlorotic virus, and the nucleotide sequence of the tomato SlCab12 gene is shown in SEQ ID NO: 1. The present invention introduces the tomato SlCab12 gene as a target gene into a tomato plant, and by changing the overexpression of the tomato SlCab12 gene in the tomato plant and increasing the photosynthesis capacity of the tomato, the disease resistance to tomato chlorotic virus is improved, and the harm caused by the tomato chlorotic virus is greatly reduced. The application method is safe and reliable, and has a good application prospect in the research of new tomato variety breeding and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of plant protection, and in particular to an application of a tomato SlCab12 gene in enhancing disease resistance to tomato chlorosis virus. Background Art

[0002] Tomato is one of the important agricultural economic crops in my country. It is loved by people for its good taste and high nutritional value. With the continuous development of the tomato industry, the circulation of tomato varieties in different regions and the outbreak of vector insects have provided opportunities for the occurrence of diseases. Tomato chlorosis virus (ToCV) belongs to the family Closteroviridae and the genus Crinivirus. It is a virus mainly transmitted by whiteflies in a semi-persistent manner. When infecting tomatoes, it will cause the interveinal yellowing and leaf curling of the leaves. In severe cases, the interveinal yellowing and leaf chlorosis will occur completely, the leaves will become brittle and thick, and the fruit will completely lose its commercial value. The virus has a long incubation period and a high incidence rate. It seriously harms the growth of tomatoes and can cause a yield reduction of more than 50%. In recent years, the coverage of the virus has been gradually expanding.

[0003] Photosynthesis is an important way to maintain plant growth and development. LHCA4 encoded by SlCab12 is a major and highly conserved chlorophyll a / b binding protein in plant photosystem I. It can combine with some pigment molecules to capture light energy, which plays a vital role in the photosynthesis process.

[0004] At present, the prevention and control of diseases such as tomato chlorosis virus can only be carried out by using relatively simple yellow boards and spraying chemical agents to kill insects. This method has low treatment efficiency, serious pesticide residues, and will cause a certain degree of reduction in tomato production. Therefore, breeding and planting disease-resistant varieties is the most economical, effective, and environmentally friendly prevention and control method with greater application prospects. Summary of the invention

[0005] In view of the above technical problems to be solved, the present invention provides an application of tomato SlCab12 gene overexpression to enhance the disease resistance of tomatoes to tomato chlorosis virus, which can be used to cultivate new tomato varieties with resistance to tomato chlorosis virus.

[0006] In order to achieve the above-mentioned object, the present invention provides an application of a tomato SlCab12 gene in enhancing disease resistance to tomato chlorotic virus. The application method is: overexpressing the tomato SlCab12 gene in a plant to enhance the plant's disease resistance to tomato chlorotic virus. The nucleotide sequence of the tomato SlCab12 gene is shown in SEQ ID NO: 1.

[0007] The above application, further, the method of the application is:

[0008] S1. Construction of an overexpression vector containing the tomato SlCab12 gene;

[0009] S2, transferring the overexpression vector containing the tomato SlCab12 gene into Agrobacterium competent cells to obtain Agrobacterium engineering bacteria containing the tomato SlCab12 gene overexpression vector;

[0010] S3. Transforming the engineered Agrobacterium into tomato plants to obtain transgenic tomato plants containing the tomato SlCab12 gene overexpression vector.

[0011] In the above application, further, the S1 specifically includes the following steps:

[0012] S1-1, designing primer pairs according to the tomato SlCab12 gene, and performing PCR amplification to obtain the tomato SlCab12 gene fragment;

[0013] S1-2, enzyme digestion of the tomato SlCab12 gene fragment and the vector;

[0014] S1-3, connecting the tomato SlCab12 gene fragment after enzyme digestion with a vector to obtain an overexpression vector containing the tomato SlCab12 gene.

[0015] In the above application, further, the DNA sequences of the primer pair are shown as SEQ ID NO:2 and SEQ ID NO:3.

[0016] In the above application, further, the vector is pCAMBIA1300-GFP.

[0017] Compared with the prior art, the advantages of the present invention are:

[0018] The present invention provides an application of a tomato SlCab12 gene in enhancing disease resistance to tomato chlorotic virus. By constructing a tomato SlCab12 gene overexpression vector and overexpressing it in tomato plants, the chlorophyll content, soluble sugar content and viral gene expression level of control tomatoes and overexpressed tomatoes before and after infection with tomato chlorotic virus are measured, and it is found that the chlorophyll content of overexpressed tomatoes is higher than that of control tomatoes. At the same time, the soluble sugar content of overexpressed tomatoes, which reflects the strength of photosynthetic capacity, is also higher than that of the control. After infection with tomato chlorotic virus, the virus content of overexpressed tomato plants is lower than that of control plants. It is thus confirmed that overexpressing the tomato SlCab12 gene can enhance the disease resistance of tomatoes to tomato chlorotic virus. Therefore, the tomato SlCab12 gene provided by the present invention can be introduced into tomato plants as a target gene, and by changing the overexpression of the tomato SlCab12 gene in tomato plants and increasing the photosynthesis capacity of tomatoes, the disease resistance of tomato chlorotic virus is improved, and the harm caused by tomato chlorotic virus is greatly reduced. The application method is safe and reliable, and has a good application prospect in the research of new tomato variety selection. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to make the purpose, technical solution and advantages of the embodiments of the present invention more clear, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention.

[0020] Figure 1 This is a diagram of the tomato SlCab12 gene expression vector in Example 2 of the present invention.

[0021] Figure 2 This is a comparison of the chlorophyll content of the tomato SlCab12 gene overexpression strain and the wild type MicroTom before and after infection with tomato chlorosis virus in Experiment 1 of the present invention.

[0022] Figure 3 This is a comparison chart of the soluble sugar content of MicroTom between the tomato SlCab12 gene overexpression strain and the wild type before and after infection with tomato chlorosis virus in Experiment 2 of the present invention.

[0023] Figure 4 This is a comparison chart of the relative virus content of the tomato SlCab12 gene overexpression strain and the wild type against MicroTom before and after infection with tomato chlorosis virus in Experiment 3 of the present invention. DETAILED DESCRIPTION

[0024] The present invention is further described below in conjunction with specific preferred embodiments, but the protection scope of the present invention is not limited thereby.

[0025] Unless otherwise defined, all the professional terms used below have the same meanings as those generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0026] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods. The methods in the following embodiments are conventional methods in the art unless otherwise specified.

[0027] Example

[0028] The materials and instruments used in the following examples are all commercially available.

[0029] Embodiment 1:

[0030] A SlCab12 gene, whose DNA sequence is shown in SEQ ID NO: 1, specifically:

[0031] Embodiment 2:

[0032] The cloning of the tomato S1Cab12 gene and the construction of the overexpression vector of Example 1 include the following steps:

[0033] (1) Primer design: Based on the SlCab12 gene sequence in Example 1, primers pSlCab12-F and pSlCab12-R were designed using primer premier 5.

[0034] pSlCab12-F: cagtggtctcacaacatggccactgtaacaacgca (SEQ ID NO: 2).

[0035] pSlCab12-R: cagtggtctcatacagttggaaaatgtttggataa (SEQ ID NO: 3).

[0036] (2) PCR reaction: Using the cDNA of tomato (MicroTom) leaves as a template, PCR was performed to amplify the coding region sequence of the SlCab12 gene with restriction endonuclease sites.

[0037] The PCR reaction system is as follows:

[0038]

[0039]

[0040] PCR amplification conditions are:

[0041] Pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 sec, annealing at 50°C for 45 sec, extension at 72°C for 45 sec, cycle denaturation, annealing and extension steps 30 times, final extension at 72°C for 1 min, and storage at 16°C for 30 min.

[0042] The PCR products obtained by PCR amplification are separated by agarose gel electrophoresis, and the target DNA fragments with the same size as the target band are purified and recovered. After the detection is correct, subsequent operations are carried out.

[0043] (3) Connection carrier:

[0044] 3.1. Enzyme digestion of vector and fragment plasmid: The target DNA fragment and pCAMBIA1300-GFP vector were digested with BsaI and Eco31I respectively.

[0045] The enzyme digestion reaction process is as follows: 13 μL sterile ultrapure water, 2 μL 10ⅹBuffer, 1 μL BsaI, 1 μL Eco31I, 4 μL target DNA fragment plasmid / vector plasmid, mixed to form a 20 μL reaction system. The above reaction system was subjected to the enzyme digestion procedure at 37°C for 1 hour to obtain the vector enzyme digestion product and the target DNA fragment enzyme digestion product.

[0046] 3.2. Ligation: The vector digestion product and the target DNA fragment digestion product are combined and purified using a PCR purification kit, and then a ligation reaction is performed to obtain a recombinant.

[0047] The connection system is as follows:

[0048]

[0049] The connection procedure was 20°C, 1 h.

[0050] 3.3. Screening of positive recombinants: The recombinants obtained in step 3.2 were transformed into E. coli DH5α to obtain transformants, and then transformed into LB medium coated with kanamycin resistance and cultured at 37°C for 12 hours. Single white colonies in the LB medium were picked, positive recombinants were screened, and colony PCR was performed for identification.

[0051] The specific method of colony PCR identification is:

[0052] 35seq-F and Noseq-R were used as primers for identification of pCAMBIA1300.

[0053] 35seq-F: TTCATTTGGAGAGAACACGGGGGAC (SEQ ID NO: 4).

[0054] Noseq-R: CAAGACCGGCAACAGGATTCAATC (SEQ ID NO: 5).

[0055] The reaction system is:

[0056]

[0057] The PCR amplification conditions were pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 sec, annealing at 50°C for 30 sec, extension at 72°C for 30 sec, 30 cycles of denaturation, annealing, and extension, and a final extension at 72°C for 10 min.

[0058] After the PCR products were subjected to electrophoresis to observe the bands, bacterial liquid of the correct size was selected to amplify the positive recombinants using LB culture medium containing kanamycin, and the cloned plasmid was extracted.

[0059] The cloned plasmid was sequenced using a fully automatic sequencer, and the SlCab12 gene fragment shown in SEQ ID NO.1 was obtained as a positive recombinant.

[0060] (4) Transformation: The positive recombinant pCAMBIA1300-GFP-SlCab12 obtained in step (3) was transformed into the competent Agrobacterium GV1301 by heat shock method to obtain transformants, which were spread on LB medium containing 100 mg / L kanamycin (Kan) and rifampicin (Rif) resistance and cultured inverted at 28°C for 2 to 3 days.

[0061] Single clones were selected and positive clones were detected by PCR; positive clone single colonies were added to 500 μL LB liquid medium containing 50 mg / L Kan and Rif resistance, and cultured overnight in a shaker at 28°C and 200 rpm. After colony PCR identification, Agrobacterium containing pCAMBIA1300-GFP-SlCab12 overexpression vector was obtained.

[0062] Figure 1 This is the structure diagram of the tomato SlCab12 gene expression vector.

[0063] Example 2

[0064] Application of the tomato SlCab12 gene in enhancing resistance to tomato chlorosis virus, and the application method comprises the following steps:

[0065] (1) Take a few grams of tomato seeds and place them in a sterile conical flask. First wash them with sterile water, then wash them with 75% alcohol, then soak them in 5% hypochlorous acid solution, wash them with sterile water, wash them twice, and place them in a sterile filter paper to dry.

[0066] (2) Sow the sterilized seeds in the culture bottle, seal the remaining sterilized seeds and place them in a dry place for the next use. Frequent ultraviolet light exposure in the clean bench will reduce the germination rate of seeds. The sown culture bottle is placed in a dark place for 2 to 3 days. After the seeds turn white and germinate, they are placed in a light tissue culture box for 4 to 5 days. Culture conditions: 23±2℃, 16h / d light and 8h / d dark.

[0067] (3) After the tomato seeds have grown for 7 to 8 days, the cotyledons are fully expanded. Remove the cotyledons with a scalpel, cut off the cotyledon petiole and cotyledon tip, and cut the middle part into 2 to 3 sections as explants. Pre-culture the tomato explants for 1 to 2 days to allow the edges of the explants to swell, which is conducive to tomato infection and transformation.

[0068] (4) Prepare Agrobacterium MS suspension, co-transfect with explants, and dry on sterile filter paper. Replace the filter paper several times to absorb excess Agrobacterium.

[0069] (5) Place the dried explants in co-cultivation medium and culture in the dark for 2 days at 23±2°C. The co-cultivation medium is the same as the pre-cultivation medium.

[0070] (6) After 2 days of co-culture, the tomato cotyledons were transferred to differentiation culture plates (containing 50 mg·L Kan). -1 , Cb 400mg·L -1 ) Select resistant calli and replace the culture medium every 7 to 10 days.

[0071] (7) After about 15 days, green callus will grow on both ends of the cotyledons. When seedlings grow on the callus, transfer the callus in the culture plate to a culture bottle. When the seedlings grow to 2 to 3 cm, transfer them to MS rooting medium for rooting culture. There is no need to change the medium until the root system is fully developed in about 20 to 30 days.

[0072] (8) After the root system is well developed and the plants are growing well, open the bottle cap and pour a little sterilized water into the bottle to keep it moist. Then put the bottle in a transparent plastic bag to harden the seedlings.

[0073] (9) After three days, wash the culture medium on the roots with water and transfer the seedlings to a sterilized substrate for hardening. When hardening the seedlings in the substrate, pay attention to prevent water loss and cover them with a transparent plastic bag. After two days, tear a small hole in the top of the plastic bag and gradually expand the tear. After 7 to 10 days, the hardening is completed and the seedlings are transferred to a light culture box for routine management.

[0074] (10) Identification of transgenic tomatoes after transformation:

[0075] The T0 generation transgenic plants were self-pollinated to produce offspring. The transgenic tomato leaves were taken and the total RNA was extracted using the TRIzol method. After quantification, the first chain of cDNA was synthesized.

[0076] The genomic DNA removal system is: 16 μL of RNase free water, 4 μL of 4×gDNA wiper mix, and X μL calculated by RNA quantification. Mix by pipetting, 72°C, 2 min, and add 5×HiScript II qRT SuperMix II 4 μL, for a total of 20 μL.

[0077] The reaction procedure was 50°C, 15 min, 85°C, 5 sec.

[0078] qPCR amplification was performed using the qPCR specific primers qSlCab12-F and qSlCab12-R of SlCab12.

[0079] qSlCab12-F:CCCTCCATCCGCCACTAA (SEQ ID NO:6).

[0080] qSlCab12-R: CACCCGCAAGACTTCCAT (SEQ ID NO:7).

[0081] The amplification system is:

[0082]

[0083]

[0084] The reaction procedure was: 94°C for 5 min, 95°C for 10 sec, 60°C for 30 sec, and 95°C for 10 sec, 60°C for 30 sec, 40 cycles.

[0085] The internal reference gene is Actin. Each sample is guaranteed to have 3 biological and technical replicates. The Ct values ​​of the target gene and the internal reference gene are substituted into Formula 2. -△△Ct , calculate the virus content of each plant, and screen out the positive plants with overexpression. Subsequently, the homozygous plants of transgenic plants were selected as the next experimental plants, and the non-transgenic plants were used as control plants.

[0086] Experiment 1: Investigate the chlorophyll content of MicroTom in tomato SlCab12 gene overexpression strains and wild type before and after infection with tomato chlorosis virus.

[0087] (1) Tomato chlorosis virus infects tomatoes

[0088] Plasmids containing RNA1 (pCa-ToCR1) and RNA2 (pCa-ToCR2) were placed in two liquid YEP media containing 50 mg / mL kanamycin and 50 mg / mL rifampicin, respectively. Overnight culture at 28°C was performed to obtain bacteria containing ToCV-RNA1 and ToCV-RNA2. After the bacterial solution was collected and centrifuged, the prepared suspension (including 10 mM MES, 10 mM MgCl 2, and 200 mM acetosyringone) was used to resuspend the precipitated bacteria and further diluted to OD 600 =1.0. The suspensions of Agrobacterium pCa-ToCR1 and pCa-ToCR2 were mixed at a volume ratio of 1:1. Then, 0.5 mL of ToCV infectious cDNA was cloned and injected into tomato plants at the 3rd true leaf stage through a disposable 1 mL syringe and treated in the dark for 16 hours. After 3 weeks, plant phenotype and molecular (RT-PCR) examinations were performed to confirm virus infection. The primers used were ToCV-1F and ToCV-1R, and the correct band size was about 500, specifically:

[0089] ToCV-1F: AAACTGCCTGCATGAAAGTCTC (SEQ ID NO: 8);

[0090] ToCV-1R: GGTTTGGATTTTGGTACTACATTCAGT (SEQ ID NO: 9).

[0091] (2) Determination of chlorophyll content in control and overexpressed tomatoes after infection with tomato chlorosis virus:

[0092] The chlorophyll content of the leaves of control tomatoes and overexpressing tomatoes infected with tomato chlorosis virus was measured using an OK-Y104 chlorophyll meter. Each tomato plant was measured three times on the upper, middle and lower leaves to prevent measurement errors.

[0093] Test results see Figure 2 : Figure 2 Statistical analysis showed that the chlorophyll content of the overexpression plants before and after virus infection was significantly higher than that of the control tomatoes, indicating that overexpression of SlCab12 can increase the chlorophyll content of tomato plants.

[0094] Experiment 2: Determination of soluble sugar content in control and overexpressed tomatoes after infection with tomato chlorosis virus.

[0095] The leaves of control tomatoes and overexpressing tomatoes infected with tomato chlorosis virus were taken respectively, and the soluble sugar content of the plant was determined according to the instructions of the Solebow plant soluble sugar content detection kit.

[0096] Test results see Figure 3 : After statistical analysis, it was found that the soluble sugar content of overexpression tomatoes was higher than that of control tomatoes before and after tomato chlorosis virus infection, indicating that overexpression of the SlCab12 gene can significantly enhance the photosynthesis capacity of tomatoes.

[0097] Experiment 3: Determination of virus content in tomatoes after infection with tomato chlorosis virus.

[0098] The leaves of control tomatoes and overexpressing tomatoes infected with tomato chlorosis virus were taken respectively, and the total RNA was extracted by TRIzol method. After quantification, the first chain of cDNA was synthesized and then quantitative PCR amplified. The primers used were ToCV-2F and ToCV-2R.

[0099] ToCV-2F:ATGGAGAACAGTGCCGTTGC (SEQ ID NO:10).

[0100] ToCV-2R: TTAGCAACCAGTTATCGATGC (SEQ ID NO: 11).

[0101] Test results see Figure 4 After statistical calculation, it was found that the virus content in the overexpressed tomatoes was significantly lower than that in the control tomatoes, indicating that overexpression of the SlCab12 gene can inhibit the infection of tomato chlorosis virus.

[0102] In summary, overexpression of the SlCab12 gene can significantly increase the chlorophyll content and soluble sugar content of tomato plants, thereby enhancing their photosynthesis capacity to improve resistance to tomato chlorosis virus. Through the tomato tissue culture transformation method, this gene is overexpressed in tomatoes, which enables tomatoes to acquire disease resistance to tomato chlorosis virus, thereby reducing the damage caused by the virus to tomatoes, which is of great value.

[0103] The above is only a preferred embodiment of the present invention and does not limit the present invention in any form. Although the present invention has been disclosed as above in the preferred embodiment, it is not used to limit the present invention. Any technician familiar with the art can make many possible changes and modifications to the technical solution of the present invention by using the methods and technical contents disclosed above without departing from the spirit and technical solution of the present invention, or modify it into an equivalent embodiment of equivalent changes. Therefore, any simple modification, equivalent replacement, equivalent change and modification made to the above embodiments according to the technical essence of the present invention without departing from the content of the technical solution of the present invention, still fall within the scope of protection of the technical solution of the present invention.

Claims

1. A use of a tomato SlCab12 gene in enhancing resistance to tomato chlorosis virus, characterized in that: The application method is: to overexpress the tomato SlCab12 gene in tomatoes to enhance the disease resistance of tomatoes to tomato chlorosis virus. The nucleotide sequence of the tomato SlCab12 gene is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The method of application is: S1. Construction of an overexpression vector containing the tomato SlCab12 gene; S2, transferring the overexpression vector containing the tomato SlCab12 gene into Agrobacterium competent cells to obtain Agrobacterium engineering bacteria containing the tomato SlCab12 gene overexpression vector; S3. Transforming the engineered Agrobacterium into tomato plants to obtain transgenic tomato plants containing the tomato SlCab12 gene overexpression vector.

3. The use according to claim 2, characterized in that: The S1 specifically includes the following steps: S1-1, designing primer pairs according to the tomato SlCab12 gene, and performing PCR amplification to obtain the tomato SlCab12 gene fragment; S1-2, enzyme digestion of the tomato SlCab12 gene fragment and the vector; S1-3, connecting the tomato SlCab12 gene fragment after enzyme digestion with a vector to obtain an overexpression vector containing the tomato SlCab12 gene.

4. The use according to claim 3, characterized in that: The DNA sequences of the primer pair are shown in SEQ ID NO:2 and SEQ ID NO:

3.

5. The use according to claim 3, characterized in that: The vector is pCAMBIA1300-GFP.

Images