Photoperiod-sensitive genetic recessive male sterility gene Ghpsm5 and its application in cotton

Abstract

The present invention discloses a photosensitive nuclear recessive male sterile gene Ghpsm5 and its application in cotton, and relates to the technical fields of genetic engineering and agricultural crop genetic breeding. The present invention provides a photosensitive nuclear recessive male sterile gene Ghpsm5 of cotton, which can cause the cotton to be male sterile under long-day conditions with a sunshine duration of greater than or equal to 12.5 hours by changing the sequence of the Ghpsm5 gene in normal cotton plants so that it cannot be normally expressed; male fertility can be restored under short-day conditions with a sunshine duration of less than or equal to 12.0 hours; and the cotton cannot self-pollinate and produce bolls when the sunshine duration is greater than 12.0 hours but less than 12.5 hours, and can still be used for hybrid seed production. Changing the gene has no effect on female fertility. By preventing the expression of the gene through biotechnology, a photosensitive nuclear recessive male sterile line of cotton can be created for cotton breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering and agricultural crop genetic breeding, and in particular relates to a photosensitive nuclear recessive male sterile gene Ghpsm5 and an application thereof in cotton. Background Art

[0002] Cotton is one of the most important crops in the world. Currently, it is grown in more than 70 countries. China, India and the United States are the main cotton producers. Improving cotton yield and quality is the main task of cotton scientific research. Hybrid vigor is a biological phenomenon that has been most successfully applied by humans in agriculture. Cotton is also an economic crop with obvious hybrid vigor. Cotton hybrids have nutritional growth advantages, yield advantages, and stress resistance advantages such as high temperature resistance, moisture resistance, drought resistance, barrenness resistance, and disease resistance. Therefore, the application of hybrids has become an important means of cotton breeding. The United States began relevant research on the use of cotton hybrid vigor in the 1940s. It was not until the 1970s that the cytoplasmic male sterile line of Harknessi cotton was cultivated and the three-line matching was achieved. China's hybrid cotton breeding has developed rapidly, and the three-line method using the cytoplasmic male sterile line, the two-line method of the recessive nuclear male sterile line, and the artificial emasculation assisted pollination method have all been applied. The use of hybrid cotton in my country reached its peak in 2007, of which more than 90% of the cotton area in the Yangtze River Basin was hybrid cotton, but hybrids were mainly produced by artificial emasculation assisted pollination. After 2007, with the increase in labor costs, the cost of hybrid cotton seeds rose sharply, and the planting area of ​​hybrid cotton decreased rapidly. The successive success of hybrid rice by the "three-line method" and "two-line method" of rice has produced huge social and economic benefits, but the screening of the restorer line of the "cytoplasmic mutual sterile line" of cotton is difficult, and there is no good advantage combination; 50% of the fertile plants must be removed when producing cotton nuclear sterile lines, and its seed production is limited. Therefore, the production of cotton hybrids is still mainly based on artificial emasculation. Creating a "dual-purpose line" material that can be used as a sterile line and can reproduce itself is a key technology to solve the application of cotton hybrids, and it is also a world problem.

[0003] There are many types of cotton nuclear sterile lines. So far, a total of 17 different types of nuclear sterile lines have been discovered, including 9 recessive nuclear sterile lines, namely ms1, ms2, ms3, ms5ms6, ms8ms9, ms13, ms14, ms15 and ms16; 8 dominant nuclear sterile lines, namely Ms4, Ms7, Ms10, Ms11, Ms12, Ms17, Ms18 and Ms19. Among these 17 sterile lines, 12 were found in upland cotton and 5 were found in sea island cotton; ms2 and Ms4 are completely sterile, ms1 and ms3 are only partially sterile, and ms8ms9 is characterized by anthers that do not dehisce. Among them, ms5, ms8 and ms9 have molecular markers located on chromosomes. The research on nuclear male sterile genes is in the stage of finding markers, and no patents or reports on the above-mentioned related genes have been found.

[0004] The Cotton Research Institute of the Chinese Academy of Agricultural Sciences used space-induced mutagenesis to cultivate the yellow-bud photosensitive male sterile mutant Zhong 9106, which was male sterile under long-day conditions with a photoperiod greater than 13.5h, and fertile under short-day conditions with a photoperiod less than 13.5 hours and a daily average temperature greater than or equal to 21.5℃. Zhang Chaojun used cotton material W10 for large-scale tissue culture and obtained a photosensitive nuclear recessive male sterile mutant psm4 (ZL201810132189.8); and obtained molecular markers related to the photosensitive nuclear recessive male sterile trait (ZL202010869171.3). Through the verification of the gene function of the molecular marker association interval, the gene Ghpsm5 that controls the photosensitive nuclear recessive male fertility of cotton was found; by editing the Ghpsm5 gene, the photosensitive nuclear recessive male sterile material ps201 was obtained. Summary of the invention

[0005] The purpose of the present invention is to provide a photosensitive nuclear recessive male sterile gene Ghpsm5 and its application in cotton, based on the gene and / or promoter, using the change of photoperiod to change plant fertility, thereby creating cotton or other plant photosensitive nuclear recessive male sterile materials.

[0006] The invention provides a cotton photosensitive nuclear recessive male sterile gene Ghpsm5, wherein the amino acid sequence of the protein encoded by the photosensitive nuclear recessive male sterile gene Ghpsm5 comprises the sequence shown in SEQ ID NO.2, or a protein having more than 75% identity with the amino acid sequence shown in SEQ ID NO.2.

[0007] The present invention also provides a cotton photosensitive nuclear recessive male sterile gene Ghpsm5, wherein the nucleotide sequence of the photosensitive nuclear recessive male sterile gene Ghpsm5 includes the nucleotide sequence of a derivative protein having the function of regulating anther dehiscence obtained by replacing and / or deleting and / or adding one or more amino acid residues to the protein shown in SEQ ID NO.2.

[0008] The present invention also provides a promoter for regulating the expression of the cotton photosensitive nuclear recessive male sterility gene Ghpsm5, and the nucleotide sequence of the promoter is shown in SEQ ID NO.3.

[0009] The present invention also provides the use of the cotton photosensitive nuclear recessive male sterile gene Ghpsm5 or the promoter in creating plant photosensitive nuclear male sterile materials.

[0010] Preferably, the plant photosensitive nuclear recessive male sterile material has abnormal pollen development and anthers that do not dehisce under the condition that the sunshine hours are greater than or equal to 12.5 hours, resulting in male sterility; when the sunshine hours are less than or equal to 12.0 hours, the pollen development returns to normal, the anthers dehisce normally, and the male fertility is restored; when the sunshine hours are greater than 12.0 hours but less than 12.5 hours, some anthers near the base of the flower occasionally dehisce and shed pollen, and the shed pollen has normal vitality but a small number (generally less than 5 anthers), and it is difficult to self-pollinate and produce bolls, but it can still be used for hybrid seed production; under long-day conditions, The photosensitive nuclear recessive male sterile cotton material that blooms under short-day conditions can be transformed into male fertile after 15-18 days of short-day treatment. The specific transformation time is affected by the bud development speed. The transformation time of the Ghpsm5 gene-edited material ps201 was 17 days when it was treated in Anyang in August; the photosensitive nuclear recessive male sterile cotton material that blooms under short-day conditions shows normal fertility. It can be transformed into male sterile after 15-18 days of long-day planting. The specific transformation time is affected by the bud development speed. The transformation time of ps201 was 17 days when it was treated in Anyang in August.

[0011] The present invention also provides a method for creating a plant photosensitive nuclear recessive male sterile material, comprising regulating and / or changing the activity and / or expression pattern of the cotton photosensitive nuclear recessive male sterile gene Ghpsm5.

[0012] Preferably, the method of regulation and / or change includes one or more of gene editing, RNAi, antisense RNA and DNA methylation.

[0013] Preferably, the method of regulating and / or changing comprises constructing an expression vector by genetic engineering method using the above promoter as a promoter to express a protein, RNA and / or DNA sequence that can act on the development of male organs.

[0014] Preferably, the male organ comprises anthers.

[0015] The present invention also provides the use of the photosensitive nuclear recessive male sterile material obtained by the above creation method in plant breeding.

[0016] Beneficial effects: The present invention provides a cotton photosensitive nuclear recessive male sterility gene Ghpsm5, which can change the sequence of the Ghpsm5 gene in normal cotton plants so that it cannot be expressed normally, thereby causing the cotton to have inactive pollen and non-dehiscent anthers under long-day conditions with a sunshine duration of 12.5 hours or more, resulting in male sterility; under short-day conditions with a sunshine duration of 12.0 hours or less, the pollen develops normally, the anthers dehisce normally, and the male fertility is restored; when the sunshine duration is higher than 12 hours but lower than 12.5 hours, some anthers close to the base of the flower can dehisce and shed pollen, and the shed pollen has normal vitality but a small number (generally less than 5 anthers), and is difficult to self-pollinate and produce bolls, but can still be used for hybrid seed production.

[0017] Changing this gene has no effect on female fertility, and Ghpsm5 is not related to the low-temperature yellowing of psm1. Therefore, by preventing the expression of this gene through biotechnology, a cotton photosensitive nuclear recessive male sterile line can be created for use in cotton breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0019] Figure 1 This is a schematic diagram of the plant CRISPR / Cas9-Ghpsm5 vector;

[0020] Figure 2 The process of cotton genetic transformation CRISPR / Cas9-Ghpsm5 (A) and photos of various growth and development stages (B), in which a: hypocotyl segment, b, c: early callus, d: late callus, e: embryonic callus, f: globular embryo, g: heart-shaped embryo, h: torpedo embryo, i: cotyledon embryo, j: regenerated cotton seedling; scale: ae: 5 mm, fj: 1 mm.

[0021] Figure 3Figure 2 shows the performance of the cotton photosensitive nuclear recessive male sterile line ps201 obtained by gene editing and the results of editing site analysis; ad in the figure: male fertile plants of ps201 under winter southern breeding conditions at the southern breeding base of the China Cotton Research Institute in Yacheng, Hainan Province, anthers and stigmas on the day of flowering, anthers that normally shed pollen, and pollen grain activity detection (active); eh in the figure: ps201 plants under normal male sterile conditions planted in the experimental field of the China Cotton Research Institute in Anyang, Henan Province (leaves removed manually), anthers and stigmas on the day of flowering, anthers that could not dehiscence, and pollen grain activity detection (inactive) manually removed; ij is the editing site. DETAILED DESCRIPTION

[0022] The invention provides a cotton photosensitive nuclear recessive male sterile gene Ghpsm5, wherein the amino acid sequence of the protein encoded by the photosensitive nuclear recessive male sterile gene Ghpsm5 comprises the sequence shown in SEQ ID NO.2, or a protein having more than 75% identity with the amino acid sequence shown in SEQ ID NO.2.

[0023] The present invention mainly utilizes the photosensitive nuclear recessive male sterile material psm5, and through genome sequencing, association analysis and molecular marker research of the hybrid offspring of psm5 and W10, a tightly linked molecular marker of the trait has been obtained. Through functional research on candidate genes of the marker segment, a photosensitive nuclear recessive male sterile gene of cotton was obtained, named Ghpsm5. By changing the sequence of the Ghpsm5 gene in normal cotton plants so that it cannot be expressed normally, the pollen of cotton can be inactive under long-day conditions with a sunshine duration of more than 12.5 hours, and the anthers do not crack, resulting in male sterility; under short-day conditions with a sunshine duration of less than 12.0 hours, the pollen develops normally, the anthers crack normally, and the male fertility is restored; when the sunshine duration is between 12.5 and 12 hours, some anthers close to the base of the flower occasionally crack and scatter pollen, and the scattered pollen has normal vitality, but the number is small (generally less than 5 anthers), and it is difficult to self-pollinate and form bolls, and it can still be used for hybrid seed production. Changing this gene has no effect on female fertility, and Ghpsm5 has nothing to do with the low-temperature yellowing of psm1. The W10 somatic cell regeneration plants and various mutants such as psm5 involved in the present invention have been disclosed in the article (Cultivation of cotton photosensitive nuclear recessive male sterile line psm5 and its fertility transformation law; Creation of cotton photosensitive nuclear recessive male sterile mutant psm4 and its characteristics research), and it is promised to be released to the public within 20 years from the date of application.

[0024] The term "identity" as used herein refers to sequence similarity with natural nucleic acid sequences. "Identity" includes nucleotide sequences that are 75% or higher, or 85% or higher, or 90% or higher, or 95% or higher identical to the DNA molecule, cDNA molecule, or RNA molecule represented by the nucleotides of SEQ ID No. 1 and / or SEQ ID NO. 3 of the present invention, and the protein composed of the amino acid residues represented by / or SEQ ID NO. 2. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0025] The present invention also provides a cotton photosensitive nuclear recessive male sterile gene Ghpsm5, wherein the nucleotide sequence of the photosensitive nuclear recessive male sterile gene Ghpsm5 includes the nucleotide sequence of a derivative protein having an anther dehiscence regulating function obtained by replacing and / or deleting and / or adding one or more amino acid residues to the protein shown in SEQ ID NO.2. The cotton photosensitive nuclear recessive male sterile gene Ghpsm5 of the present invention is isolated from upland cotton.

[0026] The present invention also provides a promoter for regulating the expression of the cotton photosensitive nuclear recessive male sterility gene Ghpsm5, and the nucleotide sequence of the promoter is shown in SEQ ID NO.3.

[0027] It is particularly noted that the nucleotide sequences of the Ghpsm5 gene or promoter isolated from the present invention have 75% or higher identity and encode the SEQ ID NO.2 protein, which are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention.

[0028] The present invention also provides the use of the cotton photosensitive nuclear recessive male sterile gene Ghpsm5 or the promoter in creating plant photosensitive nuclear recessive male sterile materials.

[0029] The present invention operates the Ghpsm5 gene at the DNA level or the RNA level, so that the Ghpsm5 gene loses its complete expression ability and / or loses its ability to be translated into protein; the promoter can also be operated at the DNA level, so that the promoter loses its ability to start the expression of downstream genes and / or changes its ability to start downstream genes, thereby changing the expression of the Ghpsm5 gene and creating cotton or other plant photosensitive nuclear recessive male sterile materials. The plant photosensitive nuclear recessive male sterile material of the present invention has abnormal pollen development and no anther dehiscence under normal field cultivation conditions when the sunshine hours are equal to or greater than 12.5 hours, resulting in male sterility; when the sunshine hours are equal to or less than 12.0 hours, the pollen development returns to normal, the anthers dehiscence normally, and the male fertility is restored; when the sunshine hours are higher than 12.0 hours but lower than 12.5 hours, some anthers close to the base of the flower occasionally dehiscence and scatter pollen, and the scattering pollen has normal vitality but a small number (generally less than 5 anthers), and no self-pollination bolls are observed, so the plant can still be used for hybrid seed production.

[0030] The present invention also provides a method for creating a plant photosensitive nuclear recessive male sterile material, comprising regulating and / or changing the activity and / or expression pattern of the cotton photosensitive nuclear recessive male sterile gene Ghpsm5.

[0031] The method of regulating and / or changing of the present invention preferably includes one or more of gene editing, RNAi, antisense RNA and DNA methylation, and preferably also includes constructing an expression vector by genetic engineering methods using the above promoter as a promoter to express a protein, RNA and / or DNA sequence that can act on the development of male organs. The male organ of the present invention preferably includes anthers.

[0032] In the present invention, the Ghpsm5 gene and / or promoter sequence is changed by at least one of methods including gene editing, RNAi, antisense RNA, DNA methylation, etc., so as to change the activity and / or expression pattern of the Ghpsm5 gene, and create a plant photosensitive nuclear recessive male sterile material of cotton but not limited to cotton. The nucleotide sequence of the Ghpsm5 gene of the present invention includes any one of a)-d): a) a DNA molecule or cDNA molecule whose coding sequence is SEQ ID NO.1, b) a cDNA molecule or genomic DNA molecule having 75% or more identity with the nucleotide sequence shown in SEQ ID NO.1 and encoding the protein described in SEQ ID NO.2, c) a cDNA molecule or genomic DNA molecule that hybridizes with the nucleotide sequence of SEQ ID NO.1 under stringent conditions and encodes the SEQ ID NO.1 gene; d) a DNA molecule that is reverse complementary to the DNA molecule described in a) or b) or c). The sequence of the promoter of the present invention is preferably any one of the following 1)-3): 1) a DNA molecule whose nucleic acid sequence is SEQID NO.3; b) a genomic DNA molecule having 75% or more identity with the nucleotide sequence defined in a); c) a DNA molecule that is reverse complementary to the DNA molecule in a) or b).

[0033] The present invention does not specifically limit the operation steps of the method capable of causing the change of the Ghpsm5 gene and / or promoter sequence, and the method can be performed using conventional methods in the art.

[0034] The present invention also provides the use of the photosensitive nuclear recessive male sterile material obtained by the above creation method in plant breeding.

[0035] To further illustrate the present invention, the photosensitive nuclear recessive male sterility gene Ghpsm5 provided by the present invention and its application in cotton are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the protection scope of the present invention.

[0036] The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0037] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0038] The China Cotton Research Institute 24 (Wang Xinyong, Liu Yining. Performance and cultivation technology of China Cotton Research Institute 24 in northern Xinjiang [J]. China Cotton, 1998, 25 (1): 31-31.) in the following examples can be obtained by the public from the National Cotton Germplasm Medium-term Bank of the Cotton Research Institute of the Chinese Academy of Agricultural Sciences. This biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0039] The Agrobacterium LBA4404 in the following examples is a product of Beijing Dingguo Changsheng Biotechnology Co., Ltd., with a product catalog number of MCC026.

[0040] Example 1

[0041] Using gene editing technology to edit the Ghpsm5 gene to obtain cotton photosensitive recessive male sterile material

[0042] 1. Construction of editing vector

[0043] The DNA fragment containing two gRNAs was connected to the CRISPR / Cas9 linear plasmid obtained by BSAI digestion, and the ligation product was transformed into Escherichia coli competent cells. Single clones were picked and tested for positive results. Plasmids were extracted from positive clones to obtain CRISPR / Cas9-Ghpsm5 recombinant vectors ( Figure 1 ).

[0044] gRNA:

[0045] SEQ ID NO.4:CCAAGCCTCCACATTAGAAACGG

[0046] SEQ ID NO.5: CATTCCAGAAAGCAAACAACAGG

[0047] Positive detection using primers:

[0048] CAS9-F (SEQ ID NO.6): 5'-ACACAGGAGCGTTTATATAAGCGA-3',

[0049] CAS9-R (SEQ ID NO. 7): 5'-TGGTTTTGTTGGTCGCCGTTAG-3'.

[0050] The reaction conditions for PCR amplification were as follows: pre-denaturation at 94°C for 5 min; 30 cycles of 94°C for 30 sec, 58°C for 30 sec, and 72°C for 1 min; and extension at 72°C for 5 min.

[0051] 2. Cultivation of photosensitive nuclear recessive male sterile materials using gene editing technology

[0052] The CRISPR / Cas9-Ghpsm5 vector was transformed into Agrobacterium tumefaciens LBA4404 to obtain a recombinant Agrobacterium containing CRISPR / Cas9-Ghpsm5, which was named LBA4404 / Ghpsm5.

[0053] According to the method of the literature (Firoozabady E, DeBoer DL, Merlo DJ, et al. Transformation of cotton (Gossypium hirsutum L.) by Agrobacterium tumefaciens and regeneration of transgenic plants [J]. Plant Molecular Biology, 1987, 10 (2): 105-116.), the Agrobacterium-mediated genetic transformation method was used to transform the hypocotyls of the Zhongmian Institute 24 cotton using LBA4404 / Ghpsm5, and the edited gene was transferred into the cotton genome. After kanamycin selection and regeneration, the transgenic cotton was transplanted ( Figure 2 ). The T1 generation self-breds from the T0 generation kanamycin-resistant plants were harvested, and the photosensitive nuclear recessive male sterile individuals in the T1 generation were subjected to molecular detection.

[0054] DNA was extracted from leaves, and PCR amplification was performed using the DNA as a template and the following primers as primers. The amplification primers were recovered, connected to the T vector, and transferred into Escherichia coli. Single clones were selected for sequencing to detect gene editing. Sequencing revealed that the Ghpsm5 gene editing target 1 segment of the photosensitive nuclear recessive male sterile plant had a 5-base deletion and the target 2 segment had a 2-base deletion (site sequence and detection results are shown in Figure 3 (i and j).

[0055] Ghpsm5-F1 (SEQ ID NO.8): 5'-GGGCAGGATCGGAGATTGTT-3'

[0056] Ghpsm5-R1 (SEQ ID NO.9): 5'-GCATCGGAACCCAACAGGA-3',

[0057] Ghpsm5-F2 (SEQ ID NO.10): 5'-GGTTCTCGGTTGTTGCCAAT-3'

[0058] Ghpsm5-R2 (SEQ ID NO.11): 5'-AGATAGGACAGCTACACAGGC-3'

[0059] The gene-edited material was planted again, and it was found that the photosensitive nuclear recessive male sterility characteristics were maintained from the T1 generation to the T3 generation, and was named ps201 ( Figure 3 ).

[0060] 3. Genetic analysis of fertility of gene-edited male sterile materials

[0061] Test materials: Non-transgenic Zhongmian 24 was used as the male parent, and the photosensitive nuclear recessive male sterile material ps201 obtained by gene editing was used as the female parent to prepare hybrid combinations. The F1 generation was normal and fertile, and photosensitive nuclear recessive male sterile individuals were isolated in the F2 generation. The segregation ratio was consistent with the single recessive gene inheritance law of 3:1. Molecular identification found that the photosensitive nuclear recessive male sterile trait was co-segregated with the gene editing site.

[0062] Molecular identification method: The F2 generation was planted in the experimental field of Anyang Cotton Research Institute. Male fertile plants and male sterile plants were identified after the cotton flowers bloomed; 32 male sterile plants were identified in the 136 F2 populations, and DNA was extracted from the 32 plants separately. Then, DNA from 23 of them was mixed in equal amounts and formed into 10 samples with the remaining 9 plants for testing. Three fertile plants in the field were tested to detect one editing site. The test results showed that no unedited sequences were detected in male sterile plants and mixed samples. 30 plants were selected from normal fertile plants for testing, and 17 heterozygous plants with edited and non-edited sequences and 13 plants without gene editing were detected.

[0063] 3.1 The specific detection method is as follows

[0064] a: Take the leaves of F2 plants grown in the field and bring them back to the laboratory in an ice box and store them in a -80℃ refrigerator. Use the CTAB method to extract leaf DNA.

[0065] b: Use KOD high-fidelity enzyme to amplify the sequence of the two editing sites from DNA, recover the band with the same fragment size as the target fragment, connect the T vector and transform Escherichia coli, spread LB solid culture medium containing kanamycin, and invert in a 37°C incubator overnight (12-24h).

[0066] c: (1) Observe the single colonies that have grown and make sure they can be picked; in an ultra-clean workbench, add the corresponding volume of kana antibiotics to LB at a ratio of 1 ml: 1 μl and shake gently; add 300-500 μl of the above LB solution to a centrifuge tube, then pick up a single colony and inject it into the centrifuge tube together with the pipette tip; place it in a 37°C shaker for more than 3 hours to prepare for detection; send the E. coli with the same detection fragment size as the target fragment size to the company for sequencing

[0067] d: Compare the sequencing results with the target sequence to determine whether it has been edited.

[0068] 4. Photoperiod response time of gene-edited photosensitive nuclear recessive male sterile lines

[0069] During the normal growth period of cotton in Anyang, Henan, ps201 was planted in a flower pot. When the cotton entered the flowering period, it was observed that the anthers of ps201 did not crack and the pollen was inactive, showing male sterility. In the afternoon, the flower pots were moved indoors for shading treatment, and after 20 o'clock in the evening, the flower pots were moved out to the outdoor normal light area. After 17 days of being moved out of the flower pot, when the light hours were controlled to less than 12.0 hours, the treatment began to shed pollen normally, and the treatment greater than 12.5 hours did not shed pollen. It can be inferred that ps201 is male sterile when the sunshine hours are greater than 12.5 hours, and becomes fertile when the sunshine hours are less than 12.0 hours.

[0070] When ps201 was planted in the Hainan Yacheng Zhongmian Institute's southern breeding base, it was sown in late October and was normally fertile when it bloomed in December. In mid-April of the following year, after the southern breeding ended, Hainan's sunshine hours began to exceed 12 hours, and it turned into male sterility after 17 days, but a small number of flowers had occasional pollen shedding at the base of the anthers. When planted in Anyang, Henan, from mid- to late September, when the sunshine hours changed from 12.5 hours to 12 hours, a small amount of anthers were seen shedding pollen. When the sunshine hours were less than 12 hours after 17 days, it began to shed pollen and form bolls like normal cotton, showing male fertility characteristics.

[0071] Example 2

[0072] Cultivation of photosensitive nuclear recessive male sterile lines using gene editing materials

[0073] 1. The photosensitive nuclear recessive male sterile plant obtained in Example 1 is planted in an area with less than 12.0 hours of sunshine and self-pollinated to breed a photosensitive nuclear recessive male sterile line.

[0074] 2. Hybridize the photosensitive nuclear recessive male sterile line material obtained in 1 with normal fertile materials, separate the photosensitive nuclear recessive male sterile materials in the offspring, plant the offspring materials in an area with sunshine hours greater than 12.5 hours, and select new cotton materials with photosensitive nuclear recessive male sterile characteristics.

[0075] Example 3

[0076] Application of Photosensitive Genic Recessive Male Sterility Line in Breeding

[0077] The normal expression of the Ghpsm5 gene is destroyed by gene editing technology, resulting in photosensitive nuclear recessive male sterility. In view of the fact that the sunshine hours in my country's cotton-producing areas and the cotton-producing areas of the world's major cotton-producing countries are greater than 12.5 hours during the normal growth stage of cotton, this type of photosensitive nuclear recessive male sterile materials all show male sterility and can be used as female parents for hybrid seed production. In the winter in tropical areas of the world, where cotton can grow normally, fertility is restored due to the sunshine hours being less than 12 hours, and self-fertilization can be achieved (such as Sanya City, Hainan Province, China). Normally planted cotton (except for male sterile materials caused by other reasons) without this gene editing is normal and fertile, and can be used as male parents to prepare hybrids with photosensitive nuclear recessive male sterile materials, and the hybrids are all normal and fertile. Therefore, normal cotton planted in production can be used as a restorer line for hybrid seed production, and its hybrids can be used for cotton hybrid production and breeding applications.

[0078] 1. The photosensitive nuclear recessive male sterile line obtained in Example 1 or Example 2 is hybridized with normal fertile cotton to cultivate hybrids.

[0079] 2. Use the photosensitive nuclear recessive male sterile line obtained in Example 1 or Example 2 to hybridize with normal fertile cotton, select excellent fertile materials from the hybrid offspring to cultivate new varieties; select excellent photosensitive nuclear recessive male sterile materials from the hybrid offspring to cultivate the photosensitive nuclear recessive male sterile line.

[0080] Example 4

[0081] Application of Photosensitive Genic Recessive Male Sterility Line in Intelligent Breeding

[0082] 1. Cultivate a photosensitive nuclear recessive male sterile line using the methods of Examples 1 to 3, and perform DNA sequencing.

[0083] 2. Plant the photosensitive nuclear recessive male sterile line sequenced in 1 and investigate its agronomic traits.

[0084] 3. Select superior lines as the male parent, hybridize with photosensitive nuclear recessive male sterile plants as the female parent, investigate the agronomic traits of the male parent and F1, and sequence the DNA of the male parent.

[0085] 4. Use the investigated parental traits, DNA sequences and F1 generation traits to establish a breeding model and form a parent selection algorithm for photosensitive nuclear recessive male sterile lines.

[0086] 5. Sequence the candidate paternal material, predict the F1 generation traits after hybridization of the material and the photosensitive nuclear recessive male sterile line through model calculation, eliminate the combinations with unsatisfactory prediction results, formulate the combinations with ideal hybrid vigor, enter hybrid breeding sequencing, and investigate the agronomic traits of the F1 generation. Repeat steps 3 and 4, and feed the results back to the model to improve the model. Form an intelligent breeding approach based on the photosensitive nuclear recessive male sterile line.

[0087] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Preventing the Photosensitive Nuclear Recessive Male Sterility Gene in Cotton Ghpsm5 The application of expression in creating cotton photosensitive nuclear recessive male sterile material is characterized by: Photosensitive nuclear recessive male sterility gene Ghpsm5 The nucleotide sequence is shown in SEQ ID NO.

1.

2. A method for creating a cotton photosensitive recessive male sterile material, characterized in that: Photosensitive recessive male sterility gene Ghpsm5 The expression of the photosensitive nuclear recessive male sterility gene Ghpsm5 The nucleotide sequence is shown in SEQ ID NO.

1.

3. The method according to claim 2, characterized in that: The creation method includes one or more of gene editing, RNAi, antisense RNA and DNA methylation.

4. The method according to claim 2, characterized in that: The creation method comprises constructing an expression vector by using a genetic engineering method and utilizing the promoter shown in SEQ ID No. 3 as a promoter.

5. Application of the photosensitive nuclear recessive male sterile material obtained by the creation method according to any one of claims 2 to 4 in cotton breeding.

Images