Specific molecular markers developed based on KASP technology for identification of Nanfeng mandarin orange variety Mi Guang 1
The primer pair combined with KASP and SSR molecular marker technology solved the problem of Miguang No. 1 variety identification, achieved rapid and accurate variety distinction, and improved market supervision and farmers' interests protection.
Patent Information
- Application Number
- CN202310075539.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-14
- Publication Date
- 2025-08-08
- Estimated Expiration
- 2043-01-14
AI Technical Summary
It is difficult to quickly and accurately distinguish the Nanfeng tangerine ‘Miguang No. 1’ variety from other Nanfeng tangerine varieties, resulting in serious effect on counterfeit and inferior seedlings and fruits on the market, affecting the interests of growers and consumers.
Using the core SNP labeling primer combined with SSR molecular labeling technology developed based on KASP technology, specific primers were designed to quickly identify the Miguang No. 1 variety through PCR amplification and fluorescence detection.
The rapid and accurate identification of Miguang No. 1 variety has been achieved, market supervision efficiency has been improved, the rights and interests of growers and consumers have been protected, and the healthy development of the industry has been promoted.
Smart Images

Figure BDA0004065982100000041 
Figure BDA0004065982100000051 
Figure BDA0004065982100000061
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic breeding and molecular biology, and specifically relates to molecular marker primers for identifying the Nanfeng mandarin orange variety 'Mi Guang No. 1' and its application. Background Art
[0002] The Nanfeng mandarin orange (Citrus reticulate 'Kinokuni') is a local specialty citrus variety native to my country. Known as the "King of Mandarins," it boasts small, thin-skinned fruit, rich juice without pulp, and a sweet, easy-to-peel flavor. As a premium variety among my country's wide-skinned citrus, the Nanfeng mandarin orange is exported year-round to Southeast Asia and other countries, generating considerable returns for local fruit farmers in Nanfeng. Nanfeng mandarin cultivation has a long history, and through long-term natural development, a rich variety of varieties has emerged around its origin, including the 'Early Ripening', 'Osmanthus Di', 'Large Fruit', 'Small Fruit', 'Nanfeng Hongguang', and 'Nanfeng Miguang No. 1' varieties. However, the different varieties of Nanfeng mandarin oranges are similar in appearance, making them difficult to distinguish based solely on morphology, which directly limits the optimal utilization of the Nanfeng mandarin variety. Due to industrial restructuring, Nanfeng County, in collaboration with local agricultural research institutions, conducted a survey of citrus cultivation resources throughout the county. They initially categorized Nanfeng mandarins into two main types: traditional Nanfeng mandarins and Nanfeng Guang mandarins, which carry Nanfeng mandarin ancestry. The Mi Guang 1 variety belongs to this Nanfeng Guang mandarin category, characterized by early fruiting, high yields, strong resistance to adverse conditions, and a juicy, crumb-free appearance. However, due to severe fruit cracking, it was only planted sporadically in its early years. In 1989, Nanfeng suffered extreme cold damage, resulting in widespread demise of the local Nanfeng mandarin varieties. The Mi Guang 1 variety, with its greater cold resistance and less severe frost damage, immediately attracted the attention of research institutions, which initiated a selection process for its superior varieties. After more than a decade of continuous breeding, the Mi Guang 1 mandarin variety, with consistent quality and yield, has been established. However, due to limitations in early identification technology, the Nanfeng mandarin orange varieties were mixed, and the problem of homonymous and homonymous varieties was widespread. Furthermore, the market was plagued by counterfeit and substandard Mi Guang No. 1 seedlings and fruit, seriously infringing on the rights of growers and consumers. Therefore, a stable and rapid identification method for distinguishing Mi Guang No. 1 varieties was urgently needed.
[0003] Currently, most new citrus varieties are derived from natural bud mutations. Accurately and rapidly identifying these mutations is crucial for their protection and promotion. Traditional methods for identifying bud mutations primarily rely on morphology, cytology, and biochemistry, but these methods suffer from environmental susceptibility, poor polymorphism, and limited differentiation. Given the high incidence of uneven quality and impure seedlings in the market, traditional identification techniques alone are currently insufficient to meet the needs of identifying new varieties, hindering the healthy development of the industry.
[0004] Molecular marker technology directly studies DNA sequence differences, reflecting changes in genetic material at the molecular level. Compared with other identification methods, it has many excellent characteristics such as high efficiency, convenience, and high polymorphism. SSR (Simple Sequence Repeat Marker) and SNP (Single Nucleotide Polymorphism) both have rich variable sites, high polymorphism, and stable and reliable identification results. They have gradually become the primary means of bud mutation identification. Selecting appropriate molecular marker types based on the characteristics of the identification materials and establishing corresponding variety fingerprints can provide corresponding technical support for later variety authenticity testing and rapid seedling identification. The application of molecular marker technology is of great significance in combating counterfeit and inferior seedlings, protecting the interests of breeders and growers, improving market supervision efficiency, and maintaining the healthy development of the industry.
[0005] KASP genotyping technology detects SNPs based on specific primer end base matching, PCR technology, and fluorescence detection. The KASP reaction system includes two specific forward primers, each with its 3' end corresponding to the SNP site, competing with each other during PCR amplification. A specific fluorescent sequence is added to the 5' end of each primer, and a universal reverse primer is also included. Compared to other SNP detection technologies, KASP has the advantages of high accuracy, good stability, and low cost, and has been widely used in the identification of horticultural crop varieties such as citrus, apple, and corn.
[0006] The Nanfeng mandarin orange variety 'Mi Guang No. 1' features early fruiting, high yields, strong cold resistance, and a juicy, pulpy texture. It matures in early to mid-November, with a yellow-orange peel. Each fruit weighs approximately 44.88 grams, contains 13-16% soluble solids, 0.68% titratable acid, 25.64 mg / 100g of vitamin C, and an edible rate of 77.59%. The fruit is seedless. After fruiting, it can yield over 3,500 kilograms per mu, demonstrating high and stable yields with minimal alternate bearing. The development of specific molecular markers for the 'Mi Guang No. 1' Nanfeng mandarin orange will facilitate molecular differentiation from currently cultivated Nanfeng mandarin varieties and provide technical support for variety protection and rapid identification. Summary of the Invention
[0007] In order to solve the above problems, the present invention provides a method for rapid identification of Nanfeng mandarin orange 'Mi Guang No. 1' variety by using core SNP marker primers developed based on KASP technology and combined with SSR molecular marker technology.
[0008] In order to achieve the above object, the present invention adopts the following technical solutions:
[0009] The molecular marker primer pair used for rapid identification of the Nanfeng mandarin orange variety Mi Guang No. 1 includes a set of KASP primers and a pair of SSR primers. The nucleotide sequences of the two forward primers of the KASP primers are shown in SEQ ID NO.1-2, the universal primer is shown in SEQ ID NO.3, and the nucleotide sequences of the SSR primers are shown in SEQ ID NO.4 and 5.
[0010] The application of the above primer pair in the identification of the Nanfeng mandarin orange Mi Guang No. 1 variety includes the following steps:
[0011] (1) KASP PCR reaction was performed using the above KASP primers. If the genotype was C / T, it was Guiju No. 1, Miguang No. 1, or Huoju;
[0012] (2) The above SSR primers were used to further perform PCR amplification in Guiju No. 1, Miguang No. 1 or Huoju, respectively. A 222 bp band was amplified in Miguang No. 1, a 269 bp band was amplified in Guiju No. 1, and two bands of 153 bp and 158 bp were amplified in Huoju.
[0013] Compared with the prior art, the present invention has the following advantages:
[0014] 1. Molecular marker technology is easy to use and is unaffected by tissue type, developmental stage, or environmental conditions. It directly reflects genetic polymorphism at the DNA level. SNP and SSR markers offer advantages such as high genetic stability, wide distribution, high polymorphism, and suitability for studies between closely related varieties.
[0015] 2. The molecular marker primers of the present invention can amplify DNA bands of varying sizes between 'Mi Guang No. 1' and 19 other Nanfeng mandarin orange varieties / lines. The molecular marker amplification is stable and can be used for rapid differentiation and identification of 'Mi Guang No. 1' varieties.
[0016] 3. The molecular marker primers provided by this invention have broad applicability and can be used to identify the 'Mi Guang No. 1' variety among 20 currently cultivated Nanfeng mandarin orange varieties / lines. Using KASP technology, the selected SNP loci were amplified and typed for 'Mi Guang No. 1' and other varieties. SSR primers were then designed based on the typing results, yielding a 222bp specific band after amplification.
[0017] 4. In addition to specifically identifying the 'Mi Guang No. 1' variety, the present invention can also differentiate and identify the Nanfeng mandarin orange varieties 'Gui Ju No. 1' (269 bp) and 'Huo Ju' (153 bp, 158 bp) based on the number and size of the bands amplified by the SSR primer CAT01. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1Genotyping of different Nanfeng mandarin orange lines based on primer MG-B00-SNP 3.
[0019] Figure 2 This is the result of genotyping 20 Nanfeng mandarin orange lines using Sanger sequencing.
[0020] Figure 3 This is the differential banding map of Mi Guang No. 1, Huo Ju and Gui Ju No. 1 based on SSR molecular markers. DETAILED DESCRIPTION
[0021] In order to make the technical solutions and objectives of the present invention more clear and detailed, the following drawings will be used for illustration. The technical solutions of the present invention, unless otherwise specified, are conventional solutions in the field; the reagents or materials, unless otherwise specified, are from commercial or public sources.
[0022] Example 1
[0023] The development of the KASP marker for 'Mi Guang No. 1' includes the following steps:
[0024] S1: Nanfeng mandarin oranges from 20 varieties, including 'Mi Guang No. 1' (Table 1), were resequenced. The raw data were filtered to generate high-quality data. Fastp (v0.20.0) was used to filter the raw data using a sliding window method. The main criteria included the following: ① Adapter contamination removal: 3'-end adapter contamination was removed. ② Quality filtering: A sliding window method was used for quality filtering, with a window size of 5 bp and a step size of 1 bp. Each time a base was moved forward, the average Q value of the window was calculated for 5 bases. If the Q value of the last base was ≤2, only the bases before that position were retained. If the average Q value of the window was ≤20, only the bases before and after the penultimate base in the window were retained. ③ Length filtering: If the length of any double-end read was ≤50 bp, the double-end read was removed.
[0025] Table 1 Information on 20 Nanfeng mandarin oranges
[0026]
[0027]
[0028] S2, after filtering based on the above criteria, yielded a total sequencing data size of approximately 129.561 Gb, with approximately 122.70 Gb of high-quality clean data. The GC content accuracy of the sequencing was 38.48% to 39.24%, the Q20 value was 96.09% to 96.58%, and the Q30 value was 90.86% to 91.86%. This indicates that the sequencing data quality met the requirements for subsequent SNP detection. The filtered, high-quality data were then compared with the reference sweet orange genome sequence (http: / / citrus.hzau.edu.cn / download.php) using the BWAmem program, using the default BWAmem parameters. The average sequencing alignment rate was 95%, the average sequencing depth was 13×, and the average coverage was 82%. The alignment data demonstrated that the sequencing results of this sample met the standards for subsequent resequencing analysis with the sweet orange reference genome. A total of 54,224,258 SNP variant sites were detected in the resequencing data of 20 Nanfeng mandarin orange varieties, of which 4,853,447 and 7,342,466 were in the exon and intron regions, respectively, and 32,186,233 were in the intergenic regions.
[0029] S3. Establishment of a SNP library for 'Mi Guang No. 1'. The resequencing SNP data for 19 Nanfeng mandarin orange lines, excluding 'Mi Guang No. 1', were used as Group A, and the resequencing SNP data for 'Mi Guang No. 1' as Group B. Groups A and B were compared to identify SNPs unique to each group. After this intergroup comparison, each line had four genotypes: 0 / 0, 0 / 1, 1 / 1, or missing. When the genotype of 'Mi Guang No. 1' was 0 / 0, the genotypes of the other lines could be any of the other three. During the screening process, the number of lines meeting these criteria was gradually reduced. The following SNPs were eliminated: SNPs with other SNPs 20 bp upstream or 40 bp downstream; SNPs with a qual < 1000; SNPs located within the chromosome chrun; and SNPs with synonymous mutations. Based on these criteria, a total of 13,430 SNPs were obtained, and 119 SNPs were ultimately identified.
[0030] S4. Design of KASP primers for 'Mi Guang No. 1'. Forward primer development: Download the 200 bp sequence above and below the SNP site. Count 20 bp above the SNP site as forward primer F. The two alleles of the SNP site serve as the 20th base of the forward primers, resulting in two forward primers, F1 and F2. Reverse primer development: Using PrimerPremier 5.0, the forward primers F1 / F2 were fixed and reverse primer R was generated by blast. The PCR amplification product was between 60 and 120 bp, with a Tm of 55–65°C and a GC content of 40%–60%.
[0031] Furthermore, forward primers F1 and F2 were modified with linker sequences A1 (FAM linker) or A2 (HEX linker), respectively, i.e., F1 = A1F1 and F2 = A2F2. Both A1 and A2 are specific linkers (A1:GAAGGTGACCAAGTTCATGCTC, A2:GAAGGTCGGAGTCAACGGATT). Primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. (Wuhan) and purified using OPC. The synthesized left primer powders F1 and F2 were dissolved in ddH2O to a 36 μM solution, and the right primer R was dissolved to a 90 μM solution. The three primers were then mixed in a 1:1:1 ratio to form a primer mix. A total of 78 KASP primer pairs were designed, of which 34 pairs were subsequently eliminated using sweet orange genomic diversity testing, resulting in a total of 44 primer pairs being validated. Detailed primer information is shown in Table 2.
[0032] Table 2 KASP primer sequences
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040] S5, KASP polymorphism verification of 'Mi Guang No. 1':
[0041] The modified CTAB method was used to extract DNA from Nanfeng mandarin oranges. After extraction, the quality and concentration of DNA were detected by ultraviolet spectrophotometer. The OD260 / OD280 ratio was 1.8<A260 / A280<2.0. When A260 / A230>2.0, the DNA quality was higher. Samples that met the requirements were diluted with ultrapure water to 90ng / μL~110ng / μL and stored at -20℃ for use.
[0042] Set up the KASP PCR reaction system on ice. Protect from light when adding KASP PCR MIX. Centrifuge at 4000 rpm for 6 minutes at room temperature. The PCR reaction system is shown in Table 3. Run at least two technical replicates for each marker, i.e., run at least two independent PCR wells. Negative blank controls (NTCs) should be prepared using ddH2O.
[0043] Table 3 KASP PCR reaction system
[0044]
[0045] KASP reaction and data reading. After centrifugation, PCR amplification and endpoint fluorescence signal reading were performed using an LC480Ⅱ fluorescence quantitative PCR instrument (Roche, Switzerland). The PCR reaction procedure was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 61°C for 60 s, followed by a 0.6°C decrease in each cycle to 55°C for a total of 10 cycles; denaturation at 94°C for 20 s, annealing at 55°C for 60 s, for a total of 26 cycles; cooling to 37°C for 1 min, and then holding at 37°C for 1 s.
[0046] KASP genotyping data analysis. PCR products were analyzed for SNP genotyping using the LC480II's included software v1.5.1. Genotypes displayed in green, clustered near channels 533-580 on the Y-axis, represent alleles linked to the HEX fluorescent tag sequence. Genotypes displayed in red, clustered near the central diagonal line, represent heterozygous alleles. Genotypes displayed in blue, clustered near channels 465-510 on the X-axis, represent alleles linked to the FAM fluorescent tag sequence. The gray sample in the lower left corner represents the blank control NTCs.
[0047] S6, KASP genotyping analysis. Using primer MG-B00-SNP 3, Mi Guang 1 can be distinguished from 17 Nanfeng mandarin orange varieties, excluding Guiju 1 and Huoju. The red color clustered near the middle diagonal line indicates heterozygous C:T alleles, specifically Guiju 1, Mi Guang 1, and Huoju. The green color clustered near channels 533-580 (Y-axis) indicates T:T alleles linked to the HEX fluorescent tag sequence, specifically Liucheng mandarin orange, Nanfeng 2, Nanfeng 1, 2007-6, SS-28, Dayehongju, Yangxiao 2-6, 97-1 Small Fruit, Guihuadi, 97-1 Early Maturity, 97-1 Large Fruit, Xiaoyehongju, 97-2 Small Fruit, Xiaoyeguangju, Very Early Maturity, Very Early Maturity Female, and Nanfeng mandarin orange. Genotyping of different Nanfeng mandarin orange lines based on primer MG-B00-SNP 3 Figure 1 shown.
[0048] Sanger sequencing was used to reverse-verify the KASP genotyping results. PCR amplification was performed using the Sanger sequencing primers MG-B00-SNP 3re F (ATTCCTCCAAGAGAGCCATTCAT) and MG-B00-SNP 3re R (AAGATAAATTGTGAACAGCGGTAGC) with DNA from 20 Nanfeng mandarin orange lines. The total PCR reaction volume was 25 μL, and the specific ratios are shown in Table 4.
[0049] Table 4 PCR reaction system
[0050]
[0051] The PCR reaction system consisted of 2 min of initial denaturation at 94°C, 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C–60°C for 30 s, and extension at 72°C for 30 s, followed by a final extension at 72°C for 2 min. All reactions were performed on an ABI gradient PCR instrument. PCR products were then sent to Wuhan Tianyi Huayu Gene Technology Co., Ltd. for unidirectional sequencing using primers MG-B00-SNP 3re F. The resulting sequencing peak files were then aligned using Chromas software to determine the genotype of each sample.
[0052] KASP typing results were verified. The results showed that the Sanger sequencing method was completely consistent with the KASP genotyping results. Figure 2As shown in Table 5, the sequencing peaks at MG-B00-SNP 3 in Guiju No. 1, Miguang No. 1, and Huoju were heterozygous C:T, while the sequencing peaks at MG-B00-SNP 3 in Liucheng Mandarin and the other 16 lines were homozygous T:T, consistent with the results of MG-B00-SNP 3-KASP. The SNP polymorphism was verified by KASP genotyping and reverse-validated by Sanger sequencing. The KASP molecular marker MG-B00-SNP 3-KASP was successfully developed, which can distinguish Miguang No. 1, Guiju No. 1, and Huoju from the other 17 Nanfeng mandarin lines.
[0053] Table 5 Genotype identification results of 20 Nanfeng mandarin orange lines by Sanger sequencing
[0054]
[0055] S7. Rapid identification of Mi Guang 1 using SSR combined with KASP. Primer CAT01, screened from 34 pairs of SSR primers, successfully distinguished Mi Guang 1 from Gui Ju 1 and Huo Ju. Polymorphic bands were evident across samples. Based on the amplification results of this primer between Mi Guang 1, Gui Ju 1, and Huo Ju, fingerprints of Mi Guang 1, Gui Ju 1, and Huo Ju were obtained based on the polymorphic primer CAT01. See Table 6 for details. Primer CAT01 amplified four polymorphic bands in Mi Guang 1, Gui Ju 1, and Huo Ju, with the following band sizes: Mi Guang 1 (222 bp), Gui Ju 1 (269 bp), and Huo Ju (153 bp and 158 bp, respectively). This indicates that combining KASP genotyping with SSR molecular marker technology can rapidly distinguish Mi Guang 1 from the remaining 19 Nanfeng mandarin orange varieties, providing technical support for the identification of Mi Guang 1.
[0056] Table 6 Amplification results of SSR primer CAT01 in Miguang 1, Guiju 1 and Huoju
[0057]
[0058] In step S7, the sequences of the 34 pairs of SSR primers used are shown in the table below. Primer synthesis was completed by Wuhan Tianyi Huiyuan Biotechnology Co., Ltd., and the primer purification method was OPC. The primer concentration was 100 μM / μL.
[0059] Table 7 34 pairs of SSR primer sequences
[0060]
[0061]
[0062] In step S7, the CAT01 primers used to amplify the fingerprints of 20 varieties of Nanfeng mandarin oranges are shown in Table 8.
[0063] Table 8 Amplification results of SSR primer CAT01 in 20 Nanfeng mandarin orange lines
[0064]
[0065] Note: At the same migration position, "1" and "0" are used to mark the presence or absence of polymorphism in the amplified fragment. The presence of a band is marked with "1" and the absence of a band is marked with "0".
Claims
1. A molecular marker primer pair for rapid identification of Nanfeng tangerine Mi Guang No. 1 variety, characterized in that: It includes a set of KASP primers and a pair of SSR primers. The nucleotide sequences of the two forward primers of the KASP primers are shown in SEQ ID NO.1-2, the universal primer is shown in SEQ ID NO.3, and the nucleotide sequences of the SSR primers are shown in SEQ ID NO.4 and 5.
2. Use of the primer pair according to claim 1 in the identification of the Nanfeng mandarin orange variety Mi Guang No.
1.
3. The use according to claim 2, characterized in that This includes the following methods: (1) Using the KASP primers described in claim 1 to perform a KASP PCR reaction, if the genotype is C / T, it is Guiju No. 1, Miguang No. 1, or Huoju; (2) PCR amplification was further performed using the SSR primers described in claim 1 in Guiju No. 1, Miguang No. 1, or Huoju, respectively. A 222 bp band was amplified in Miguang No. 1, a 269 bp band was amplified in Guiju No. 1, and two bands of 153 bp and 158 bp were amplified in Huoju.