Targets and applications of SARS-CoV-2 and SFTSV virus therapy

Abstract

The present invention belongs to the field of biomedical technology, and specifically relates to a target and application for the treatment of SARS-CoV-2 and SFTSV viruses. The target is RIPK3, and the specific application is to use a substance for knocking down, knocking out or inhibiting RIPK3 protein expression when preparing products for resisting SARS-CoV-2 and SFTSV viral infection or preparing products for treating diseases caused by SARS-CoV-2 and SFTSV. The research results of the present invention show that RIPK3 plays a key role in the inflammatory response and tissue pathological damage induced by SARS-CoV-2 and SFTSV, providing new insights into how SARS-CoV-2 and SFTSV infections trigger inflammatory responses and organ damage, and revealing the therapeutic potential of targeting RIPK3 to treat COVID-19 and fever with thrombocytopenia syndrome (SFTS).

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and specifically relates to a target and application for the treatment of SARS-CoV-2 and SFTSV viruses. Background Art

[0002] Receptor-interacting serine / threonine protein kinase 3 (RIPK3) is a member of the receptor interacting protein kinase (RIP) family. It forms a protein complex with receptor-interacting serine / threonine protein kinase 1 (RIPK1). Through hetero-oligomerization via their C-terminal RIP homotypic interaction motifs (RHIMs), they form a functional amyloid protein, activating the downstream mixed lineage kinase domain-like (MLKL) protein, inducing necroptosis and inflammatory responses. RIPK3 is a key regulator of necroptosis, mediating the transmission of necroptosis and inflammatory signals. RIPK3 plasma concentrations are significantly elevated in a variety of patients, including patients with acute kidney injury due to sepsis, acute respiratory distress syndrome caused by sepsis and brain trauma, and critically ill patients with COVID-19 infection. Plasma concentrations of RIPK3 have also been shown to be highly correlated with mortality and organ failure in critically ill patients. In preclinical animal models, knocking out RIPK3 has been shown to effectively alleviate symptoms of various immune and degenerative diseases, including sepsis-induced acute kidney injury, emphysema, and chronic obstructive pulmonary disease.

[0003] Necroptosis is a key immune mechanism in the fight against viruses, as evidenced by the pathogen clearance defects seen in mice lacking necroptotic effectors and the fact that many pathogens encode proteins that inhibit necroptosis. In animals, necroptotic cell lysis can prevent pathogen replication by releasing pathogen- and damage-associated molecular patterns into the extracellular environment, triggering an immune response that eliminates infection. Although necroptosis has been implicated in the pathology of numerous human diseases, therapeutics targeting necroptosis have not yet reached clinical stages, and the extent to which necroptosis contributes to disease pathology remains incompletely understood. Mechanistically, necroptosis differs from typical programmed cell death pathways as a lytic form of cell death that is independent of the caspase family of proteases. Necroptotic signaling is triggered by various inflammatory signals, including through activation of transmembrane Toll-like receptors (TLRs), intracellular nucleic acid sensors such as Z-DNA binding protein 1 (ZBP1), or pathogen recognition through ligation of death receptors. Extreme environmental conditions, such as heat shock, hyperosmotic pressure, or elevated intracellular pH, have also recently been identified as inducers of necroptosis.

[0004] As an important mediator of the necroptosis mechanism, there are many reports of viral inhibition of host RIPK3 function. For example, vaccinia virus specifically degrades host RIPK3 protein through the viral protein vIRD; HSV1 and HSV2 specifically inhibit the formation of the RIPK3 and RIPK1 protein complex through the R1 protein. Various viruses, such as poxviruses, inhibit the function of RIPK3 to suppress host cell necroptosis and the release of inflammatory factors. In the early stages of infection, they increase the efficiency of viral infection by reducing the host's immune response. However, severe patients infected with SFTSV and the new coronavirus often suffer from excessive inflammatory responses and cytokine storms. Our team has also confirmed necroptosis of lung tissue and cells caused by excessive inflammatory responses in pathological sections of deceased COVID-19 patients.

[0005] Currently, there are no specific RIPK3 inhibitors in clinical use or clinical trials. Several RIPK3 small molecule inhibitors are in preclinical studies, attempting to reduce necroptosis in target cells by inhibiting the kinase activity of RIPK3. However, the RIPK3 protein skeleton, even without kinase activity, still performs important signaling functions, and the RIPK3 protein skeleton function has not been reported in SARS-CoV-2 or SFTSV-induced cell necroptosis. Summary of the Invention

[0006] The main purpose of the present invention is to explore technical solutions for treating RIPK3-related diseases by directly targeting RIPK3 protein.

[0007] To achieve the above objectives, based on the research results of the present invention, the present invention provides the following technical solutions:

[0008] Substances that knock down, eliminate or inhibit RIPK3 protein expression are used to prepare products for combating SARS-CoV-2 and SFTSV virus infection or to prepare products for treating diseases caused by SARS-CoV-2 and SFTSV viruses.

[0009] As some more specific embodiments, knocking down, knocking out or inhibiting RIPK3 protein expression can be achieved by: products that degrade RIPK3 protein; products that degrade RIPK3 protein mRNA; products that inhibit RIPK3 protein transcription at the gene level.

[0010] As a more specific embodiment, the substance for knocking down RIPK3 gene expression is siRNA, and the siRNA includes sense: GAACUGUUUGUUAACGUAAAC; anti-sense: UUACGUUAACAAACAGUUCUG or sense: GCUGCUGUCUCCACGGUAAAG; anti-sense: UUACCGUGGAGACAGCAGCAU.

[0011] As a more specific embodiment, the substance for stably knocking down RIPK3 expression is shRNA for knocking down RIPK3 expression; its specific target sequence is: CTGAGAGACAAGGCATGAACT and / or GCACTCTCGTAATGATGTCAT.

[0012] Furthermore, as some embodiments, reagents for detecting the protein expression level of RIPK3 can be used to screen drugs for anti-SARS-CoV-2 and SFTSV virus infections or to screen drugs for treating diseases caused by SARS-CoV-2 and SFTSV viruses.

[0013] As a more specific embodiment, reagents for detecting the expression levels of RIPK3, IL-1β, TNF-α, IL-6, CCL2 and CXCL8, or reagents for detecting RIPK3 alone, can be used to screen anti-SARS-CoV-2 and / or SFTSV viral drugs that knock down, knock out or inhibit RIPK3 expression. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 .siRNA knockdown of RIPK3 inhibits THP-1 PMA Schematic diagram of the expression level of inflammatory factor IL-1β after cells were infected with SFTSV

[0015] THP-1 cells were induced with PMA (40 ng / ml) for 24 h and then transfected with siRNA (20 pmol). 48 h after transfection, cells were infected with SFTSV (MOI=5). Cell samples were collected 48 h after infection and the levels of related proteins were detected by Western Blot.

[0016] Figure 2 Schematic diagram of the stable knockdown of RIPK3 gene that significantly inhibited the expression levels of inflammatory factors and chemokines in THP-1 cells infected with SFTSV

[0017] A. RIPK3 was stably knocked down in THP-1 cells. After PMA induction, SFTSV was infected. After 24 hours, the cells were lysed and the supernatant was collected. The levels of related proteins were detected by Western Blot.

[0018] B. RIPK3 was stably knocked down in THP-1 cells. After PMA induction, SFTSV was infected. After 24 hours, the cells were lysed to extract RNA, and qRT-PCR was used to detect the inflammatory factors TNF-α, CXCL-8, CXCL-10, CCL2, and CCL4.

[0019] Figure 3 .Image showing the effect of RIPK3 on regulating the transcriptional levels of inflammatory factors induced by SFTSV in mice.

[0020] Wild-type C57BL / 6 mice (n=8), Ripk3 - / - Mice (n=8) were intraperitoneally infected with SFTSV (2.5×10 6 FFU), and a wild-type uninfected group (n=3) was set as a control. Spleen samples were collected 3 days after infection, and the transcription levels of the indicated genes were detected by qRT-PCR.

[0021] Data shown are mean ± SEM. Means between the two groups were compared using a t-test. **P < 0.01; ns, not significantly different.

[0022] Figure 4 Schematic diagram of the stable knockdown of RIPK3 gene that significantly inhibited the expression levels of inflammatory factors and chemokines after Calu-3 cells were infected with SARS-CoV-2.

[0023] A. Calu-3 cells with stable RIPK3 knockdown were infected with SARS-CoV-2 (MOI = 0.1). After 48 hours, the cells were lysed and the supernatant was collected. Western blot was used to detect the P17 level in the supernatant and the expression levels of RIPK3, pMLKL, Pro-IL-1β, or NP in the cell lysate.

[0024] B. Calu-3 cells with stable RIPK3 knockdown were infected with SARS-CoV-2 (MOI = 0.1). After 48 hours, the cells were lysed to extract RNA, and qRT-PCR was used to detect the inflammatory factors IL-1β, IL-6, TNF-α, CCL2, and CXCL-8.

[0025] Figure 5 .Image showing the effect of RIPK3 regulating the production of chemokines in lung inflammation caused by SARS-CoV-2.

[0026] Ripk3 - / - Mice (n=4) were intranasally transduced with adenovirus Ad5-hACE2 expressing human ACE2

[0027] (2.5×10 8 PFU) and infected with SARS-CoV-2 (1×10 5 TCID 50 Wild-type C57BL / 6 mice (n=4) were used as controls. Lung samples were collected 2 days after infection, and the transcript levels of the indicated genes were detected by qRT-PCR.

[0028] Data shown are mean ± SEM. Means between the two groups were compared using the t-test. *P < 0.05; ***P < 0.001; ns, not significantly different.

[0029] Figure 6 .Knockout of the RIPK3 gene significantly alleviated the immune cell infiltration and alveolar septum expansion in the lung tissue of mice after infection with SARS-CoV-2.

[0030] A.Ripk3 - / - Lung samples were collected from C57BL / 6 and wild-type C57BL / 6 mice 2 days after infection with SARS-CoV-2, and histopathological changes were evaluated by H&E staining. Arrows show immune cell infiltration (green arrows) and dilation of alveolar septa (red arrows).

[0031] BD. Immunostaining of mouse lung tissue sections for CD45, CD68, and CD3, representing immune cell infiltration.

[0032] E. Co-staining of CD8 (red) and CXCR3 (green), representing wild type and Ripk3 - / - CD8 in mouse lung sections + CXCR3 + T cell recruitment. DETAILED DESCRIPTION

[0033] The following will clearly and completely describe the concept and technical effects of this application in conjunction with the embodiments to fully understand the purpose, features and effects of this application. Obviously, the embodiments described are only part of the embodiments of this application, not all of them. Based on the embodiments of this application, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of this application.

[0034] For commodities purchased in the test method, the brand is marked after the reagent name. If the specific conditions are not specified, the test shall be carried out according to the conventional conditions or the conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not indicated, they can be conventional products purchased from the market.

[0035] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings commonly understood by those skilled in the art. Exemplary methods and materials are described below, but methods and materials similar or equivalent to those described herein can also be used in the practice and testing of the present disclosure.

[0036] As used herein, the following words and terms shall have the meanings indicated:

[0037] The term "knockout" refers to gene knock-out, which refers to a technique in which a DNA fragment containing a certain known sequence undergoes homologous recombination with a gene with the same or similar sequence in the recipient cell genome, is integrated into the recipient cell genome and expressed, causing the loss of specific gene function and thus blocking some functions.

[0038] The term "knockdown" refers to gene knock-down, which means using double-stranded small RNA to efficiently and specifically degrade homologous mRNA in cells, thereby blocking the expression of the target gene in the body and causing the cells to exhibit a phenotype of target gene deletion. Optional technologies for knocking out / reducing target genes include RNA interference (RNAi), CRISPR-Cas9 technology, TALEN technology, etc.

[0039] The present invention found through research that in SFTSV and SARS-CoV-2 infected cell and mouse models, knocking out or knocking down RIPK3 strongly reduced the production of inflammatory cytokines and chemokines. Further, in the SARS-CoV-2 infected mouse model, knocking out RIPK3 strongly reduced the infiltration of multiple immune cell types and alleviated lung damage. In particular, the infiltration of macrophages and T cells was significantly reduced. T cell and macrophage infiltration has been observed in patients with severe new coronavirus infection (COVID-19), and this is believed to lead to severe disease development. Recent studies on SARS-CoV-2 infection in rhesus monkey models reported that CXCR3 +Correlation between cell infiltration and virus-induced lung injury and proposed quantification of CXCR3 + The potential application of RIPK3 in predicting the severity of COVID-19 infection. RIPK3 deficiency strongly reduced the infiltration of CXCR3+ and CD8+CXCR3+ cells into the lungs of SARS-CoV-2-infected mice, a result that further supports the key role of RIPK3 in the pathogenesis of SARS-CoV-2-induced lung injury.

[0040] Based on the above research results, as some specific examples, in the process of preparing products for resisting SARS-CoV-2 or SFTSV virus infection or preparing products for treating diseases caused by SARS-CoV-2 or SFTSV virus, relevant technical solutions for knocking down, knocking out or inhibiting RIPK3 protein expression can be adopted.

[0041] As some more specific embodiments, knocking down, knocking out or inhibiting RIPK3 protein expression can be achieved by: products that degrade RIPK3 protein (such as PROTAC drugs); products that degrade RIPK3 protein mRNA (such as siRNA); products that inhibit RIPK3 protein transcription at the genetic level (such as CRISPER or epigenetic drugs).

[0042] As a more specific embodiment, the substance for knocking down RIPK3 gene expression is siRNA, the sequence of which is as follows:

[0043] sense: GAACUGUUUGUUAACGUAAAC;

[0044] anti-sense:UUACGUUAACAAACAGUUCUG;

[0045] or sense: GCUGCUGUCCACGGUAAAG;

[0046] anti-sense: UUACCGUGGAGACAGCAGCAU.

[0047] As another more specific embodiment, the substance for stably knocking down RIPK3 expression is shRNA for knocking down RIPK3 expression; the sequence is as follows:

[0048] CTGAGAGACAAGGCATGAACT and GCACTCTCGTAATGATGTCAT.

[0049] Pathogen infection can trigger autocrine TNF production, which can lead to RIPK1-RIPK3-MLKL-dependent necroptosis. SARS-CoV-2 infection triggers TNF-α production, so it is possible that a parallel RIPK1-RIPK3-MLK-dependent necroptosis pathway may also contribute to virus-induced inflammation. However, RIPK3 is a key adaptor mediating the necroptosis pathway, and targeting RIPK3 is an attractive strategy for developing anti-inflammatory drugs in the context of viral infection. Several RIPK3 kinase inhibitors are already in development for RIPK-driven inflammatory diseases. The results of this study suggest that the development of anti-inflammatory drugs that target the RIPK3 protein itself may achieve better efficacy.

[0050] Based on the above research findings, as some embodiments, reagents for detecting RIPK3 expression levels can be used to screen anti-SFTSV or SARS-CoV-2 virus drugs that knock down, knock out or inhibit RIPK3 expression.

[0051] The present invention demonstrates through the following specific examples that knockdown or knockout of RIPK3 at the cellular and mouse levels can effectively inhibit the inflammatory response caused by SARS-CoV-2 and SFTSV viral infection, thereby alleviating inflammatory pathological damage caused by viral infection.

[0052] Example 1

[0053] Knockdown of RIPK3 by siRNA inhibits THP-1 PMA Expression level of inflammatory factor IL-1β after cells were infected with SFTSV

[0054] SFTSV infection of THP-1 PMA The cells will induce the upregulation of inflammatory factors such as IL-1β. When we transfect THP-1 through siRNA PMA When RIPK3 was knocked down in cells, the upregulation of IL-1β expression induced by SFTSV infection was significantly inhibited (see Figure 1 ).

[0055] Example 2

[0056] Stable knockdown of RIPK3 inhibits the inflammatory response induced by SFTSV infection

[0057] Stable knockdown of RIPK3 was achieved by stably expressing shRNA targeting RIPK3 in THP-1 cells. After PMA induction and SFTSV infection, cells and supernatant samples were collected 48 h after infection, and the knockdown effect of RIPK3 was confirmed by Western blot analysis ( Figure 2A), After RIPK3 knockdown, the expression levels of pMLKL and IL-1β were significantly decreased compared with the control group, and the mature form of IL-1β (P17) in the supernatant was also significantly reduced ( Figure 2 A). qRT-PCR detection of the transcriptional levels of a series of intracellular cytokines showed that the expression of TNF-α, CCL2, CCL4, CXCL8, and CXCL10 induced by SFTSV infection was significantly reduced in RIPK3 knockdown cells compared with control cells ( Figure 2 B).

[0058] Example 3

[0059] Knockout of RIPK3 in mice inhibits the upregulation of cytokine transcription levels induced by SFTSV infection

[0060] Ripk3 - / - C57BL / 6 mice were housed in an SPF environment, and C57BL / 6 wild type mice were used as controls. The mice were divided into three groups: (1) wild type mice uninfected (mock) group (n=3), (2) wild type mice infected group (n=8), (3) Ripk3 - / - The mice were infected by intraperitoneal injection with a dose of 100 μL (2.5×10 6 FFU / mouse), and the mock group received an equal volume of DMEM medium. The entire experimental process strictly adhered to the guidelines of the National Institutes of Health as stipulated in the Animal Care and Use Committee. Daily monitoring indicators of mice included: arched back, erect hair, activity, stress response, body weight, etc. On the third day of SFTSV infection, mice were dissected and spleens were removed to detect viral load and cytokine transcription levels. The results are shown in Figure 3 As shown, compared with the wild type group, Ripk3 - / - There was no significant difference in the viral load in the spleens of mice in the two groups, and the transcription levels of cytokines such as TNF-α, IL-1β, and CCL2 were significantly downregulated, suggesting that RIPK3 knockout can significantly inhibit the upregulation of cytokines induced by SFTSV infection in mice.

[0061] Example 4

[0062] Stable knockdown of RIPK3 inhibits inflammatory responses induced by SARS-CoV-2 infection

[0063] By stably expressing shRNA targeting RIPK3 in Calu-3 cells, stable knockdown of RIPK3 was achieved. SARS-CoV-2 infection was performed, and cells and supernatant samples were collected 48 hours after infection. The knockdown effect of RIPK3 was confirmed by Western blot analysis ( Figure 4A), After RIPK3 knockdown, the expression levels of pMLKL and IL-1β were significantly decreased compared with the control group, and the mature form of IL-1β (P17) in the supernatant was also significantly reduced ( Figure 4 A). qRT-PCR detection of the transcriptional levels of a series of intracellular cytokines showed that the expression of IL-1β, TNF-α, IL-6, CCL2, and CXCL8 induced by SFTSV infection was significantly reduced in RIPK3 knockdown cells compared with control cells ( Figure 4 B).

[0064] Example 5

[0065] Knockout of RIPK3 in mice inhibits SARS-CoV-2 infection-induced cytokine production

[0066] Next, we explored whether RIPK3 regulates inflammatory responses during SARS-CoV-2 infection in vivo. To this end, wild-type mice and Ripk3 - / - Mice were transduced with Ad5-hACE2 via intranasal drops, allowing them to be effectively infected with SARS-CoV-2. SARS-CoV-2 was infected via intranasal drops with an infection dose of 50 μL (1×10 5 TCID 50 / ), 2 days after infection, lung samples were collected and cytokines and chemokines were analyzed by quantitative PCR. - / - The levels of SARS-CoV-2 replication were comparable between the two groups of mice, but the Ripk3 - / - In mice, the expression of pro-inflammatory cytokines and chemokines (including IL-6, CXCL10, CCL2, CCL4 and CCL5) was significantly reduced ( Figure 5 These results indicate that RIPK3 is critical for SARS-CoV-2-induced inflammation in vivo and are consistent with in vitro observations that the RIPK3 protein itself is critical for SARS-CoV-2-induced inflammatory signaling.

[0067] Example 6

[0068] Knockout of RIPK3 reduces SARS-CoV-2 infection-induced lung immune cell infiltration and lung injury

[0069] Since RIPK3 deficiency leads to reduced expression of inflammatory factors in the SARS-CoV-2 infection mouse model, we further explored whether RIPK3 mediates the pathogenesis of SARS-CoV-2 in vivo. - / -The wild type group of mice was infected with SARS-CoV-2 according to the above method. The lung sections of the mice were stained with hematoxylin-eosin (HE). The results showed that the lungs of the wild type group of mice infected with SARS-CoV-2 had obvious inflammatory cell infiltration and alveolar septum expansion ( Figure 6 A). RIPK3 knockout significantly reduced SARS-CoV-2-induced immune cell infiltration and alveolar septum expansion ( Figure 6 A). Compared with wild-type control, Ripk3 - / - The infiltration of leukocytes in the lungs of mice was significantly reduced ( Figure 6 B). CD68 ( Figure 6 C) and CD3( Figure 6 D) Staining results suggest that SARS-CoV-2 infects Ripk3 - / - The recruitment of macrophages and T cells into the lungs of mice was significantly reduced.

[0070] A recent study of SARS-CoV-2 pathogenesis in a rhesus macaque model proposed that virus-induced CD8 + CXCR3 + Cell infiltration into the lung is crucial for virus-induced lung injury. Since RIPK3 knockout leads to reduced upregulation of CXCL10 (CXCR3 ligand) during SARS-CoV-2 infection, we analyzed the expression of RIPK3 in SARS-CoV-2 infected controls and Ripk3 - / - CD8 in mice + CXCR3 + The presence of cells. Figure 6 As shown in E, RIPK3 deficiency strongly reduced the infiltration of CXCR3+ cells. In addition, double labeling with CD8 and CXCR3 antibodies showed that RIPK3 - / - CD8 in mouse lung tissue + CXCR3 + The infiltration of cells was significantly reduced ( Figure 6 E). These results collectively indicate an important role for RIPK3 in SARS-CoV-2-induced immune cell infiltration and lung injury in vivo.

[0071] Materials and Methods

[0072] 1. Cell lines

[0073] The THP-1 cell line (ATCC) was cultured in RPMI-1640 medium (Gibco) containing 10% fetal bovine serum (Gibco) and 1% penicillin / streptomycin (Gibco) at 37°C in the presence of 5% CO2.

[0074] The cell line, Calu-3 (ATCC), was cultured in MEM medium (Gibco) containing 10% fetal bovine serum (Gibco), 1% MEM non-essential acids (Gibco), 1% sodium pyruvate (100 mM, Gibco), and 1% penicillin / streptomycin (Gibco). The cells were cultured at 37°C in an atmosphere of 5% CO2.

[0075] 2. Viruses

[0076] SARS-CoV-2 (IVCAS 6.7512) was obtained from the National Virus Resource Center, propagated in Vero E6 cells, and the viral titer (TCID 50 )The new coronavirus infection experiment was carried out in a biosafety level 3 (BSL-3) laboratory.

[0077] New bunyavirus (severe fever with thrombocytopenia syndrome virus, SFTSV) isolated from HBMC16 cells at the Wuhan Institute of Virology, Chinese Academy of Sciences (Wuhan, Hubei, China) (GenBank: KY440775.1, KY440776.1, and KY440777.1) was propagated in Vero cells and used in this study. Virus titers were determined in Vero cells.

[0078] 4. Mice

[0079] Wild-type C57 / BL6 mice, Ripk3 - / - C57 / BL6 mice. Mouse infection studies were approved by the WIV Animal Welfare Committee.

[0080] 5. Antibodies and Reagents

[0081] Monoclonal rabbit anti-MLKL (#14993), anti-RIPK3 (#13526), ​​anti-pRIPK3 (#91702), and anti-pMLKL (S358, #91689) were obtained from Cell Signaling Technology (Beverly, MA, USA). Polyclonal anti-IL1β (A16288) was purchased from Abclonal (Wuhan, China). Rabbit anti-α-tubulin (11224-1-AP) polyclonal was obtained from Proteintech. Rabbit anti-COVID-19 NP antibody was homemade. 4,6-Diamino-2-phenylindole (DAPI, C1002) was obtained from Beyotime (Shanghai, China).

[0082] 6. siRNA transfection to knock down RIPK3 THP-1 cells were induced with PMA (40 ng / ml) for 24 h, and then transfected with siRNA (20 pmol). 48 h after transfection, SFTSV virus (MOI=5) was infected, and samples were collected 48 h after infection.

[0083] 6. Stable knockdown of RIPK3

[0084] RIPK3 was knocked down by lentiviral transduction into Calu-3 or THP-1 cells. The targeting shRNA sequences used in this study were:

[0085] 7. Animal research

[0086] SFTSV mouse experiments: Ripk3 - / - C57BL / 6 mice were housed in an SPF environment, and C57BL / 6 wild-type mice were used as controls. The mice were divided into three groups: (1) wild-type mice uninfected (mock) group (n=3), (2) wild-type mice infected group (n=8), (3) Ripk3 - / - The mice were infected by intraperitoneal injection with a dose of 100 μL (2.5×10 6 FFU / mouse). The mock group received an equal volume of DMEM medium. On day 3 after SFTSV infection, mice were dissected, spleens were removed, and viral load and cytokine transcription levels were measured by qPCR.

[0087] SARS-CoV-2 mouse experiments: Ripk3 in a C57BL / 6 background - / - Mice were treated with Ad5-hACE2 (2.5×10 8 PFU) were transduced intranasally. Five days after transduction, mice were intranasally infected with SARS-CoV-2 (1×10 5 TCID 50 Wild-type C57BL / 6 mice were used as controls. Mice were euthanized at 2 days post-incubation, and lung samples were collected for qPCR assays, histology, and immunohistochemistry. Animal experiments were approved by the Animal Welfare Committee of the Wuhan Institute of Virology.

[0088] 8. Histology and Immunohistochemistry

[0089] Lung specimens from infected and mock-infected mice were fixed with 4% paraformaldehyde, embedded in paraffin, and cut into 4 μm sections for further immunohistochemistry (IHC). Hematoxylin and eosin (H&E) staining was performed, and lung sections were stained with Gill's hematoxylin and eosin Y. For IHC, the indicated antibodies were used as primary antibodies, and sections were incubated with secondary antibodies (Rabbit / Mouse Envision, Dako, Denmark) and then visualized with DAPI or a detection kit (DAB, Dako, Denmark).

[0090] 9. Western Blotting

[0091] Cell samples were collected, separated by polyacrylamide gel electrophoresis, and transferred to a 0.45 μm PVDF membrane. Primary antibodies used included RIPK3, pMLKL, and MLKL (Cell Signaling, USA), Tubulin (Proreintech), viral NP (homemade), and IL-1β (ABclonal, China); secondary antibodies included HRP-conjugated Affinipure Goat Anti-Rabbit IgG (H+L) (Proteintech, USA). Chemiluminescence (ECL) kits (Millipore) were used for color development, and signals were detected using a Chemiscope 600 pro.

[0092] 10. Mature IL-1β Detection

[0093] Proteins in 500 μl of the collected supernatant were precipitated with an equal volume of methanol and a quarter volume of chloroform. The precipitate was dissolved in 2× SDS loading buffer for Western blot analysis as described above using an antibody against IL-1β (ABclonal, China).

[0094] 11. RNA Isolation and Quantitative RT-PCR

[0095] Cell or tissue samples were collected and total RNA was extracted using the FastPure Cell / Tissue Total RNA Isolation Kit (Vazyme, China) according to the manufacturer's instructions. qRT-PCR was performed in two steps using II Q Select RT SuperMix for qPCR (+gDNAwiper) (Vazyme, China) and ChamQ Universal SYBR qPCR Master Mix (Vazyme, China). Quantitative qPCR was performed on a Roche LightCycler 96 real-time fluorescence quantitative PCR instrument (Roche fluorescence quantitative instrument), and each sample was amplified in triplicate.

[0096] Reaction conditions included a pre-denaturation step (stage 1) at 95°C for 30 seconds; a cycling step (stage 2) at 95°C for 10 seconds and 60°C for 30 seconds, followed by 40 cycles of amplification. Melting curves were generated according to the instrument's default settings, with GAPDH as the internal reference gene. PCR primers used are listed in Table 1.

[0097] Table 1: qRT-PCR primers

[0098]

[0099]

[0100]

[0101] Although preferred embodiments of the present invention have been shown and described, those skilled in the art will appreciate that improvements and modifications may be made without departing from the technical principles of the present invention, and such improvements and modifications are still considered to be within the scope of protection of the present invention.

Claims

1. The use of the substance siRNA in the preparation of a product for inhibiting SFTSV infection, characterized in that: The siRNA is anti-sense: UUACGUUAACAAACAGUUCUG or anti-sense: UUACCGUGGAGACAGCAGCAU.

Images