Application of variable splicing of long non-coding RNA gene LAIR in rice

Abstract

The application belongs to the technical field of genetic breeding, and particularly relates to application of variable splicing of long-chain non-coding RNA gene LAIR of rice, and the variable splicing subtype or functional equivalent of the long-chain non-coding RNA gene LAIR has the use of improving yield traits of rice, and finally, positive transgenic rice strains are screened, and the plant height and / or total grain number of the main ear of the positive transgenic rice strains are improved to different degrees.

Description

Technical Field

[0001] This invention belongs to the field of gene breeding technology, specifically relating to the application of alternative splicing of the rice long non-coding RNA gene LAIR. Background Technology

[0002] Rice is one of the world's most important food crops, with over 3 billion people worldwide relying on it as their staple food. Given issues such as environmental and climate change and population growth, it is estimated that rice production will need to increase by 40% by 2030 to meet demand. Therefore, yield-increasing traits in rice have always been a key area in crop genetics and breeding. With the development of molecular genetics and genomics, an increasing number of biological macromolecules are being identified. Applying these cutting-edge discoveries to rice molecular genetic breeding helps uncover genetic resources for increasing crop yields and provides planting reserves for future food security.

[0003] A major discovery in recent years in genomics research is the presence of a large number of non-coding RNAs (ncRNAs) in the genomes of higher organisms. Long non-coding RNAs (lncRNAs) are defined as large transcripts longer than 200 nt that perform biological functions in a non-coding form. Using high-throughput transcriptome sequencing, researchers have found that lncRNAs are widely distributed from lower organisms to higher plants, and that lncRNAs participate in various biological processes through cis-regulation and trans-regulation.

[0004] Furthermore, most annotated lncRNAs are transcribed by class II RNA polymerases, so it is speculated that they may undergo capping and tailing like mRNAs, resulting in alternative splicing. Alternative splicing, as an important process for the diversity of products produced by single-gene mRNAs, plays a key role in the regulation of tissue differentiation, species pattern differences, and transcriptomic diversity in multicellular eukaryotic organisms.

[0005] Based on mRNA-related research, it is believed that alternative splicing greatly increases the diversity of genomic information. However, research on lncRNA alternative splicing has only resulted in reports of isolated phenomena, with very few in-depth studies on its functional mechanisms, and even fewer studies on its production and application value.

[0006] In rice, there are currently no reports of lncRNA gene alternative splicing being used to improve yield traits. As a novel breeding approach, lncRNA gene alternative splicing will greatly enrich the genetic resources of crop breeding and promote the development of refined breeding based on phenotypic polymorphism. Summary of the Invention

[0007] To address the shortcomings of existing technologies, this application provides an application of LAIR alternative splicing of rice lncRNA genes in improving yield traits in rice.

[0008] This application describes the use of LAIR alternative splicing of rice lncRNA genes in improving yield traits in rice, employing the following technical solution:

[0009] The application of alternative splicing of the rice long non-coding RNA gene LAIR, wherein the alternative splicing subtype of the rice long non-coding RNA gene LAIR or its functional equivalent has the purpose of improving the yield trait of rice.

[0010] Preferably, the sequence of the variable splice subtype is as shown in SEQ.ID NO.1-9;

[0011] Including one of LAIR-a, LAIR-b, LAIR-c, LAIR-d, LAIR-e, LAIR-f, LAIR-g, LAIR-h, and LAIR-i;

[0012] The functional equivalents of the alternative splicing subtypes have 99% homology with the sequences shown in SEQ ID NO. 1-9, and all originate from the cDNA of the rice transcriptome.

[0013] Preferably, overexpression of the alternative splicing subtype in rice lines can increase the plant height and / or the total number of grains in the main panicle of transgenic rice.

[0014] Preferably, the application method of the LAIR alternative splicing of the rice long non-coding RNA gene is as follows:

[0015] First, the alternative splicing subtype was obtained by PCR amplification from the cDNA of the rice transcriptome. Then, the alternative splicing subtype was inserted downstream of the constitutive promoter of the vector to construct the expression vector. The expression vector was then used to transform recipient rice. Finally, positive transgenic rice lines were identified and screened by PCR.

[0016] Preferably, the carrier is a pCAMBIA1304 carrier, and the constitutive promoter is a CaMV 35s constitutive promoter.

[0017] Preferably, the construction of the expression vector involves the following specific steps:

[0018] a) First, the alternative splicing subtype was obtained by amplifying cDNA from the rice transcriptome using PCR;

[0019] b) Resynthesize the inserted restriction enzyme sites to obtain a purified PCR product containing the restriction enzyme sites, namely SpeI (5' end) and BstEII (3' end);

[0020] c) Then, the alternative splicing isotype is inserted downstream of the 35S constitutive promoter of the pCAMBIA1304 vector to obtain the pCAMBIA1304 expression vector with the alternative splicing isotype.

[0021] d) Finally, the ligation product of the pCAMBIA1304 expression vector of the alternative splicing isotype was added to DH5α competent cells for activation and revival, and PCR was used to identify whether the ligation was successful.

[0022] Preferably, the steps for converting the expression vector into the rice receptor are as follows:

[0023] First, mature rice seeds are dehulled and disinfected, then inoculated onto dedifferentiated plant tissue culture medium to induce callus formation, resulting in callus cells. Then, the purified expression vector is introduced into the callus cells using the Agrobacterium-mediated transformation method, thus completing the transformation of the expression vector into the rice receptor.

[0024] Preferably, the primers used for the PCR identification are as follows:

[0025] The primer sequences for LAIR-a are as follows, and the amplified fragment length is 127 bp;

[0026] Fa:AGGACGCATACCTTTTGATACT; Ra:GCAGCCAGTCGTGCTATGT;

[0027] The primer sequences for LAIR-b are as follows, and the amplified fragment length is 136 bp;

[0028] Fb: AGGACGCATACCTTTTGATACT; Rb: GCCCAATCACCCACCAGTC;

[0029] The primer sequences for LAIR-c are as follows, and the amplified fragment length is 138 bp;

[0030] Fc: ACGCATACCTTTTGATACTACATGC; Rc: TCAAGCACCAATCACCCACC

[0031] The primer sequences for LAIR-d are as follows, and the amplified fragment length is 136 bp;

[0032] Fd: ACGCATACCTTTTGATACTACATGC; Rd: AACAACCAATCACCCACCAGT;

[0033] The primer sequences for LAIR-e are as follows, and the amplified fragment length is 242 bp;

[0034] Fe: AGGACGCATACCTTTTGATACT; Re: CGTTGGAGCAAATAAGCCG;

[0035] The primer sequences for LAIR-f are as follows, and the amplified fragment length is 192 bp;

[0036] Ff: TGGTAAGGAGCAAAAGACTCGT; Rf: GCCCAATCACCCACCAGTC;

[0037] The primer sequences for LAIR-g are as follows, and the amplified fragment length is 197 bp;

[0038] Fg: TGGTAAGGAGCAAAAGACTCGT; Rg: TCAAGCACCAATCACCCACC;

[0039] The primer sequences for LAIR-h are as follows, and the amplified fragment length is 195 bp;

[0040] Fh: TGGTAAGGAGCAAAAGACTCGT; Rh: AACAACCAATCACCCACCAGT;

[0041] The primer sequences for LAIR-i are as follows, and the amplified fragment length is 299 bp;

[0042] Fi: TGGTAAGGAGCAAAAGACTCGT; Ri: CGTTGGAGCAAATAAGCCG;

[0043] The primer sequences for the vector resistance marker Hygromycin gene are as follows:

[0044] Fr: ACGGTGTCGTCCATCACAGTTTGCC; Rr: TTCCGGAAGTGCTTGACATTGGGGA, the amplified fragment length is 289 bp.

[0045] Secondly, this application provides an expression carrier that includes the aforementioned variable splicing subtype or its functional equivalent.

[0046] Thirdly, this application improves an expression vector for transforming Agrobacterium, which is generated by transforming Agrobacterium using an expression vector containing the aforementioned alternative splicing subtype or its functional equivalent.

[0047] The alternative splicing isoform of the rice lncRNA gene LAIR described in this application, after being constructed with an expression vector, transformed into recipient rice, and overexpressed in rice lines, has the following beneficial effects:

[0048] 1) It can significantly increase the plant height and / or the total number of grains in the main panicle of transgenic rice, as shown below:

[0049] The average growth rate of plant height of the lines using the indica rice variety MH63 as the recipient was 2.5-13.9%, and the average growth rate of total grains in the main panicle was 10.7-25.0%.

[0050] The average growth rate of plant height of the Jap rice variety was 5.3-10.4%, and the average growth rate of total grains in the main panicle was 11.0-21.1%.

[0051] 2) It also provides a new breeding approach and application, greatly enriching the genetic resources of crop breeding and promoting the development of refined breeding based on phenotypic polymorphism. Attached Figure Description

[0052] Figure 1 This refers to the alternative splicing structure of the LAIR gene in rice.

[0053] Figure 2 This is a structural diagram of the T-DNA insertion region of the LAIR-a / h / i-pCAMBIA1306 expression vector;

[0054] Figure 3 PCR verification diagram of stable positive transformation lines of rice for LAIR-a, LAIR-h and LAIR-i genes;

[0055] Figure 4 Phenotypic diagrams of rice overexpressing LAIR-a, LAIR-h, and LAIR-i genes;

[0056] Figure 5 Bar chart showing yield trait data for rice lines overexpressing LAIR-a, LAIR-h, and LAIR-i genes. Detailed Implementation

[0057] The present application will be further illustrated below with reference to specific embodiments and accompanying drawings, but this does not limit the present application. The composition of various culture media used in the present application is shown in the table below:

[0058]

[0059] Note: *All the above culture media contain 30g / L sucrose + 2.5g / L plant agar;

[0060] Unless otherwise specified, the experimental methods used in the specific embodiments of this application are all conventional methods, and the materials and reagents used are all commercially available unless otherwise specified.

[0061] Rice lncRNA LAIR is an antisense transcript located at the 5' end of the LRK gene cluster. The encoding gene LRK1 is located in the first intron of LAIR. The LAIR alternative splicing region occurs only in a portion of the exons in the middle of the sequence. Genomic location and alternative splicing structure are as follows: Figure 1 As shown.

[0062] It should be noted that in the indica rice variety Minghui 63, there are LAIR subtypes with alternative splicing. Although only 9 alternative splicing forms have been identified so far, other subtypes are still under research.

[0063] The information for LAIR-a, LAIR-b, LAIR-c, LAIR-d, LAIR-e, LAIR-f, LAIR-g, LAIR-h, and LAIR-i in this application can be found in the NCBI database under Gene ID: JX512719-JX512727.

[0064] The shortest subtype is LAIR-a, with a full sequence length of 1585 bp; the main subtype with high transcriptional abundance is LAIR-h, with a full sequence length of 1797 bp; and the longest subtype is LAIR-i, with a full sequence length of 1912 bp. Therefore, the embodiments of this application preferentially use the above three as examples.

[0065] Furthermore, it should be emphasized that its functional equivalent, namely, sequences that have 99% homology with the sequences shown in SEQ.ID NO.1-9 after partial base pair substitution, addition, or deletion, still have similar performance and efficacy.

[0066] Example 1

[0067] The application of the rice long non-coding RNA gene LAIR is as follows:

[0068] S1. Construction of expression vectors for rice LncRNA genes LAIR-a, LAIR-h, and LAIR-i:

[0069] The construction steps are as follows:

[0070] a) First, the full-length transcribed sequences of LAIR-a, LAIR-h, and LAIR-i genes were amplified from the transcriptome cDNA of the rice variety Minghui 63 using PCR.

[0071] b) Resynthesize and insert restriction enzyme sites to obtain a purified PCR product containing restriction enzyme sites, namely SpeI (5' end) and BstEII (3' end);

[0072] ① Prepare the enzyme digestion system. The composition and content of each raw material are shown in the table below (total volume 20 μL):

[0073] reagents Usage Restriction endonucleases 0.5μl 10×NEBuffer 2.0μl 10×BSA 2.0μl DNA fragments / vectors ≤500ng <![CDATA[Sterile ddH2O]]> Up to 20μl

[0074] First, prepare the SpeI restriction endonuclease reaction system, digest at 37℃ for 1 hour, and then separate and recover the SpeI digested fragment product by gel electrophoresis.

[0075] Then, using the SpeI digestion product as a sample, a BstEII restriction endonuclease reaction system was prepared, the digestion temperature was 60℃, the digestion time was 1h, and the SpeI+BstEII digestion product was separated by gel electrophoresis and recovered by gel recovery.

[0076] ② The raw material composition of the bonding system is shown in the table below.

[0077] reagents Dosage / 10μl DNA fragments 4.0μl carrier 1.0μl Solution I 5.0μl

[0078] The ligation system was prepared by digesting the target fragment with SpeI+BstEII enzymes from the DNA fragment and the vector.

[0079] c) After ligation at 16℃ for 30 min, the full-length sequences of LAIR-a, LAIR-h, and LAIR-i were inserted downstream of the 35S constitutive promoter of the pCAMBIA1304 vector.

[0080] This yielded the LAIR-a / h / i-pCAMBIA1304 expression vector, whose plant transformation T-DNA insertion region is as follows: Figure 2 As shown.

[0081] d) Finally, the ligation product of the LAIR-a / h / i-pCAMBIA1304 expression vector was added to DH5α competent cells for activation and revival, and PCR was used to identify whether the ligation was successful.

[0082] S2, LAIR-a / h / i-pCAMBIA1304 expression vector transformed into rice receptor

[0083] The rice materials were the indica rice variety Minghui 63 (MH63) and the japonica rice variety Jap. The transformation recipient material was the callus induced by the mature embryos of these varieties. The plant culture medium used in the transformation process was MS basal medium.

[0084] The transformation method was Agrobacterium transformation, and the Agrobacterium strain was Agrobacterium tumefaciens LBA4404. The microbial culture medium used to culture the Agrobacterium during the transformation process was YEP medium. The specific transformation method is as follows:

[0085] a) Induction of rice callus

[0086] ① Remove the husks from mature indica rice variety MH63 or japonica rice variety Jap seeds;

[0087] ② Under aseptic conditions, soak in 70% ethanol for 5 minutes and rinse with sterile water 3 times;

[0088] ③ Soak in 0.1% mercuric chloride for 20 minutes, then rinse 5 times with sterile water;

[0089] ④ Remove all moisture and inoculate the seeds onto the induction and subculture medium;

[0090] ⑤ Cultured in the dark at 26℃ for 20 days, then the induced callus was isolated, subcultured, and the callus tissue was prepared for use.

[0091] b) Transformation of Agrobacterium tumefaciens with vector plasmid

[0092] ① Take 200 μl of Agrobacterium competent cells, add 1 μg of the vector plasmid, mix well, and place on ice for 5 min to obtain a mixture;

[0093] ② The mixture is placed in liquid nitrogen for quick freezing for 5 minutes, and then in a water bath at 37°C for 5 minutes;

[0094] ③ Add liquid YEP medium to the mixture after quick-freezing water bath in step ②, and dilute to 1 ml. Then, incubate the bacteria at 28°C for 4 hours to obtain the bacterial culture.

[0095] ④ Centrifuge at 5000 rpm for 2 min to enrich the bacterial culture obtained in step ③, remove 900 μl of supernatant, resuspend the bacterial culture and spread it on YEP solid plates containing rifampicin and kanamycin, and incubate at 28℃ for 3 days to obtain transformant single clones;

[0096] ⑤ Pick a single colony and shake it to identify positive transformation clones. Add 20% glycerol and flash freeze in liquid nitrogen at -80 degrees Celsius.

[0097] c. Obtaining transformed rice lines using Agrobacterium-mediated transformation.

[0098] ① First, inoculate 500 μL of Agrobacterium into 50 ml of YEP liquid medium and culture it at 28℃ and 200 rpm until the OD600 is 0.6-0.8. Then add 40 μl of AS (acetylsuccinone) to each 40 ml of bacterial solution to obtain Agrobacterium bacterial solution.

[0099] ②The callus particles are then soaked in the Agrobacterium bacterial solution prepared in ① for 30 minutes, during which the solution is manually shaken 5 times every 5 minutes to ensure that the bacterial solution and callus are evenly distributed, thus obtaining infected callus tissue.

[0100] ③ Remove the infected callus from step ②, blot off excess bacterial solution on sterile filter paper, and transfer it to a co-culture medium. Incubate in the dark at 26°C for 6 days. Cover the surface of the co-culture medium with a layer of sterile filter paper, ensuring that the callus does not directly contact the medium on the filter paper. The part of the infected callus that comes into contact with the YEP liquid medium will have a bacterial film, thus obtaining the callus infected with Agrobacterium LBA4404.

[0101] ④ Remove the callus tissue infected with Agrobacterium LBA4404 from ③, wash it 5 times with sterile water, and then wash it 5 times with sterile water containing rifampicin (50mg / L) and kanamycin (50mg / L) resistance. Use sterile filter paper to absorb the excess water to obtain the dried callus.

[0102] ⑤ The dried callus was then transferred to the primary screening medium and cultured in the dark at 26°C for 15 days to obtain callus tissue infected with Agrobacterium LBA4404 that was weakly resistant to hygromycin. The callus tissue was then dried using sterile filter paper.

[0103] Then, the dried hygromycin-resistant callus infected with Agrobacterium LBA4404 was transferred to a secondary culture medium and cultured in the dark at 26°C for 20 days for secondary screening. After screening, hygromycin-resistant callus infected with Agrobacterium LBA4404 was obtained.

[0104] ⑥ The callus tissues that were highly resistant to hygromycin and infected with Agrobacterium LBA4404 in ⑤ were transferred to the primary differentiation medium and cultured for 15 days at 26℃ and 16h light / day. Then they were transferred to the secondary differentiation medium and cultured for another 15 days at 26℃ and 16h light / day until 1-5cm green shoots grew.

[0105] ⑦ After the green seedlings have differentiated, first peel off the excess callus around them, cut off the roots (leaving 0.5cm), and then transfer them into the rooting and seedling strengthening culture medium for rooting culture to obtain differentiated seedlings.

[0106] ⑧ Once the differentiated seedlings have grown to 10-15cm in height and have vigorous root growth, open the cover and harden the seedlings for about 7 days. Remove them from the rooting medium, wash off the residual medium, and transplant them to a greenhouse or field.

[0107] ⑨ PCR amplification was used to detect candidate transformed plants, and positive T0 generation plants containing the LAIR-a / h / i transformation fragment were obtained and propagated in the field.

[0108] ⑩ Homozygous lines transformed with LAIR-a, LAIR-h, and LAIR-i genes were obtained and validated using PCR. The validation targets included exogenous LAIR-a, LAIR-h, and LAIR-i genes and the vector resistance marker Hygromycin gene. Specific primers are shown in the table below. PCR identification results of positive transformed lines are as follows: Figure 3 As shown.

[0109] Table: Specific primers for PCR verification of stable rice transformation lines of the LAIR-a / h / i gene

[0110]

[0111] The PCR reaction system is shown in the table below:

[0112] Reagent (stock solution concentration) Dosage / 25μl DNA polymerase 0.2μl 10×PCRBuffer 2.5μl dNTPMixture(2.5mM) 2.0μl PCRForwardPrimer (10μM) 1.0μl PCRReversePrimer (10μM) 1.0μl template 2.0μl <![CDATA[Sterile ddH2O]]> 16.3μl

[0113] PCR reaction procedure:

[0114] 95℃ for 5 minutes

[0115] [95℃ 40sec 60℃ 40sec 72℃ 40sec] × 30 cycles

[0116] 72℃ for 10 minutes (extended).

[0117] Investigation and statistics on yield traits in rice lines overexpressing S3 and LAIR-a / h / i genes

[0118] Seeds of the LAIR-a / h / i gene-overexpressing positive rice lines and the recipient group (as wild-type control) were sown in the experimental field in Shanghai (31°11'N, 121°29'E) in the summer. Phenotypic and yield traits of wild-type and transformed lines were analyzed at the waxy ripening stage of rice.

[0119] Among them, rice lines overexpressing the LAIR-a, LAIR-h, and LAIR-i genes exhibited increased plant height and increased number of grains in the main panicle, promoting yield growth compared to wild-type rice plants. The phenotypes of the overexpressing rice lines are as follows: Figure 4 As shown.

[0120] Statistically correlated trait data and calculate the average value. The bar charts of the average values ​​are shown below. Figure 5 As shown in the table below, the statistical results are as follows:

[0121] strain Plant height (cm) Total number of grains in the main ear LAIR-a-M1 93.2±4.38 177.8±19.99 LAIR-a-M2 94.5±2.01 178.6±21.19 LAIR-h-M1 103.5±7.32 198.5±30.23 LAIR-h-M2 100.5±7.71 190.8±30.83 LAIR-i-M1 94.0±2.90 175.8±15.88 LAIR-i-M2 91.5±7.42 185.9±26.78 MH63-CK control group 90.9±9.98 158.8±18.15 LAIR-a-J1 66.8±2.09 64.2±4.87 LAIR-a-J2 67.6±3.47 66.8±8.11 LAIR-h-J1 67.5±3.29 62.5±10.47 LAIR-h-J2 66.7±4.08 65.6±8.58 LAIR-i-J1 68.2±2.52 68.2±12.52 LAIR-i-J2 65.1±3.67 64.9±6.88 Jap-CK control group 61.8±2.79 56.3±9.60

[0122] Note: In the table, LAIR-a / h / i-(letter + number) is the transformation line number, where the letter M represents the transformation recipient MH63 and the letter J represents the transformation recipient Jap.

[0123] As can be seen from the table above, compared with the control group, the plant height of rice lines overexpressing the LAIR-a / h / i gene was increased. In the indica rice MH63 variety recipient, the increase in LAIR-h gene lines was more significant; in the japonica rice Jap variety recipient, the increase in LAIR-a / h / i gene lines was significant in all. This trait indicates that different alternative splicing subtypes have different phenotypes in different indica rice varieties.

[0124] Further analysis of the table above shows that, compared with the control group, the total number of grains in the main panicle of rice lines overexpressing the LAIR-a / h / i gene was significantly increased in all different varieties of recipients. This trait indicates that different alternative splicing subtypes have a consistent promoting ability in different varieties of indica rice.

[0125] It is evident that the LAIR alternative splicing subtype of the lncRNA gene can promote yield-increasing traits such as plant height and total number of grains in the main panicle of rice, and shows subtle phenotypic differences among different indica rice varieties, which can be applied to refined breeding based on phenotypic polymorphism.

[0126] It should also be noted that rice lines overexpressing LAIR alternative splicing subtypes, such as LAIR-b, LAIR-c, LAIR-d, LAIR-e, LAIR-f, and LAIR-g, are still in experimental fields, and the corresponding experimental results are expected to be obtained after October 2022.

[0127] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.

Claims

1. The application of LAIR alternative splicing in rice long non-coding RNA genes, characterized in that, The alternative splicing subtype of the rice long non-coding RNA gene LAIR has the potential to improve rice yield traits. The variable splicing subtype includes one of LAIR-a and LAIR-i; The sequences of LAIR-a and LAIR-i are shown in SEQ.ID NO.1 and 9, respectively; Overexpression of the aforementioned alternative splicing subtype in rice lines can increase the plant height and / or the total number of grains in the main panicle of transgenic rice; The application method of the rice long non-coding RNA gene LAIR is as follows: First, the alternative splicing subtype was obtained by PCR amplification from the cDNA of the rice transcriptome. Then, the alternative splicing subtype was inserted downstream of the constitutive promoter of the vector to construct the expression vector. The expression vector was then used to transform recipient rice. Finally, positive transgenic rice lines were identified and screened by PCR.

2. The application of LAIR alternative splicing in rice long non-coding RNA genes according to claim 1, characterized in that, The vector is pCAMBIA1304, and the constitutive promoter is CaMV 35s constitutive promoter.

3. The application of LAIR alternative splicing in rice long non-coding RNA genes according to claim 2, characterized in that, The specific steps for constructing the expression vector are as follows: a) First, the alternative splicing subtype was amplified from the cDNA of the rice transcriptome using PCR; b) Resynthesize the inserted restriction enzyme site to obtain a purified PCR product containing the restriction enzyme site, which is: SpeI (5' end) and BstEII (3' end); c) Then, the alternative splicing isotype is inserted downstream of the 35S constitutive promoter of the pCAMBIA1304 vector to obtain the pCAMBIA1304 expression vector with the alternative splicing isotype. d) Finally, the ligation product of the pCAMBIA1304 expression vector of the alternative splicing isotype was added to DH5α competent cells for activation and revival, and PCR was used to identify whether the ligation was successful.

4. The application of LAIR alternative splicing of long non-coding RNA genes according to claim 2, characterized in that, The steps for converting the expression vector into the rice receptor are as follows: First, mature rice seeds are dehulled and disinfected, then inoculated onto dedifferentiated plant tissue culture medium to induce callus formation, resulting in callus cells. Then, the purified expression vector is introduced into the callus cells using the Agrobacterium-mediated transformation method, thus completing the transformation of the expression vector into the rice receptor.

5. The application of LAIR alternative splicing of long non-coding RNA genes according to claim 2, characterized in that, The primers used for the PCR identification are as follows: The primer sequences for LAIR-a are as follows, and the amplified fragment length is 127 bp; Fa:AGGACGCATACCTTTTGATACT; Ra:GCAGCCAGTCGTGCTATGT; The primer sequences for LAIR-i are as follows, and the amplified fragment length is 299 bp; Fi: TGGTAAGGAGCAAAAGACTCGT; Ri: CGTTGGAGCAAATAAGCCG; The primer sequences for the vector resistance marker Hygromycin gene are as follows: Fr: ACGGTGTCGTCCATCACAGTTTGCC; Rr: TTCCGGAAGTGCTTGACATTGGGGA, the amplified fragment length is 289 bp.

6. An expression carrier, characterized in that, It includes the variable splicing subtype LAIR-a or LAIR-i as described in claim 1.

7. An expression vector for transforming Agrobacterium, characterized in that, It is derived from Agrobacterium using the expression vector described in claim 6.

Images