Nucleic Acid Amplification Kits and Applications

Abstract

The present application discloses a yeast Rad protein hybrid and a use of yeast Rad protein in combination in nucleic acid amplification and a nucleic acid amplification kit. The present application utilizes yeast protein homologues to form a hybrid dimer, which has a conserved ATP binding domain and the ability to catalyze ATP hydrolysis, and can promote yeast Rad protein to displace single-stranded DNA binding protein bound to single-stranded DNA, thereby improving the strand displacement activity of yeast Rad protein, mediating the strand displacement activity between primers and nucleic acid templates, and improving the affinity of yeast Rad protein for low-abundance templates, thereby improving the specificity and sensitivity of nucleic acid isothermal amplification.

Description

Technical Field

[0001] The present application relates to the field of biological detection technology, and in particular, to a nucleic acid amplification kit and its application. Background Art

[0002] Polymerase chain reaction (PCR) is a typical representative of nucleic acid amplification technology. This technology was invented by Mullis et al. in the Human Genetics Laboratory of PE-Cetus Corporation in the United States in 1985. It uses linear DNA as a template for replication reaction. PCR reactions are usually carried out in a thermocycler, which can provide the required high temperature, low temperature and medium temperature environment for PCR reactions. Each three stages constitute a cycle. After each cycle of the PCR reaction, the number of target genes is amplified by 1 times. In this way, after N cycles, a target gene molecule may be amplified to 2 N PCR technology is often used in various aspects such as detection and identification of infectious diseases, identification of transgenics and detection of gene mutations.

[0003] Due to the characteristics of PCR temperature cycle dependence, nucleic acid amplification technology is divided into two categories: non-isothermal nucleic acid amplification technology represented by PCR, and the new generation of isothermal nucleic acid amplification technology. The non-isothermal nucleic acid amplification technology needs to be implemented by a temperature cycler to achieve three basic reaction steps of high temperature denaturation-low temperature renaturation-medium temperature extension: after the template DNA is heated above 90°C for a period of time, the double-stranded template DNA is denatured and becomes a single strand; after the template DNA becomes a single strand, the temperature drops to 50-60°C, and the primer and the template single strand are complementary paired; when the temperature rises to about 72°C, the primer and the template single strand are combined under the action of the polymerase and the dNTPs in the system as raw materials to extend and synthesize the chain according to the semi-conservative replication principle. In this way, the target gene fragment can be amplified a million times in 2-3 hours.

[0004] Different from traditional PCR technology, the characteristic of nucleic acid isothermal amplification technology is that it can achieve exponential amplification of target nucleic acid under specific temperature conditions, and can even achieve efficient amplification of nucleic acid under low temperature conditions of 45°C. The entire process of nucleic acid isothermal amplification reaction is carried out at the same temperature, which greatly simplifies the requirements for instruments and greatly shortens the reaction time. The reaction can be completed by simple or even non-professional equipment such as heating modules and water baths. Therefore, nucleic acid isothermal amplification reaction can better meet the "fast and easy" requirements of modern molecular detection technology and has great practical application value.

[0005] Recently, a series of new isothermal nucleic acid amplification technologies have been developed, either based on new discoveries in the study of DNA / RNA biosynthesis mechanisms or using nucleases with special functions to achieve the purpose of isothermal nucleic acid amplification. Nucleic acid isothermal amplification technology is mainly a "target amplification" technology with DNA as the amplification object, and the detection purpose is achieved by increasing the copy number of the target sequence. Typical examples include the relatively mature loop-mediated nucleic acid isothermal amplification technology (LAMP), single primer isothermal amplification technology (SPIA), helicase-dependent isothermal amplification technology (HDA), strand displacement amplification technology (SDA), nicking endonuclease nucleic acid constant temperature amplification technology (NEMA), a new type of recombinase polymerase amplification technology (RPA) created with reference to the T4 phage DNA replication system, and recombinase-mediated isothermal nucleic acid amplification technology (RAA) technology that is different from the source of RPA recombinase. Nucleic acid sequence-dependent amplification technology (NASBA) is a "target amplification" technology with RNA as the amplification object, and the amplified product of this technology is also RNA. It is worth noting that rolling circle amplification (RCA) technology belongs to the "signal amplification" technology, which achieves the detection purpose by amplifying the signal obtained after detecting the target sequence. Rolling circle amplification (RCA) technology uses DNA as the amplification object.

[0006] Among them, LAMP technology, as a new type of nucleic acid amplification method, has the characteristics of simple operation, strong specificity, and easy product detection. During DNA synthesis, pyrophosphate ions precipitated from deoxyribonucleic acid triphosphate substrates (dNTPs) react with magnesium ions in the reaction solution to produce a large amount of magnesium pyrophosphate precipitate, which appears white. Therefore, turbidity can be used as an indicator of the reaction. Only by observing the white turbid precipitate with the naked eye can the amplification be identified, without the need for cumbersome electrophoresis and ultraviolet observation.

[0007] Since the loop-mediated isothermal amplification reaction does not require a PCR instrument and expensive reagents, it has a wide range of application prospects. However, due to the chain displacement synthesis during LAMP amplification, the target sequence length is preferably within 300bp, and it is difficult to amplify if it is greater than 500bp; due to its high sensitivity, it is very easy to be contaminated during operation and produce false positive results; it is inferior to the traditional PCR method in product recovery, identification, cloning, and single-strand separation. The amplified product cannot be used for cloning and sequencing, but can only be used for judgment; although the LAMP instrument is simpler and cheaper, the primer design of LAMP is difficult, and the reagent cost will be correspondingly higher than qPCR; LAMP technology is difficult to multiplex amplification; LAMP technology can only be qualitative, not suitable for quantitative.

[0008] The core of SPIA technology is a mixed primer and an RNase that can cut the RNA part of the DNA / RNA hybrid chain, which is composed of a 3' DNA part and a 5' RNA part. During the reaction, RNaseH continuously degrades the RNA part of the DNA / RNA double strand in the primer region, exposing the site on the template that binds to the primer RNA part, and then a new primer binds to it for strand displacement synthesis. After a cycle of RNA degradation, new primer binding, and strand displacement, rapid amplification of the template complementary sequence is achieved. However, the template of SPIA is a single-stranded nucleic acid. If double-stranded nucleic acid amplification is required, thermal denaturation treatment is required, and the primer design is complex.

[0009] Although RCA technology has high sensitivity and strong amplification ability, it is limited to the nucleic acid amplification of some viruses, plasmids and circular chromosomes with circular nucleic acids.

[0010] Although RPA / RAA technology usually only requires a small amount of nucleic acid molecules to amplify to a detectable level within 3 to 10 minutes at a reaction temperature of 37 to 42°C, this depends on the length of the target nucleic acid; and the primer length required for this technology is 30 to 35 bp, and primers are more likely to form dimers or produce non-specific amplification; in addition, since this technology involves more materials, when used for RNA amplification, the RNA template is likely to form a complex with substances present in the system and affect RNA template detection, or some reverse transcriptases and the auxiliary protein T4 UvsY in RPA inhibit each other and affect the efficiency of reverse transcription; in addition, the reaction system of this technology is relatively viscous, and the substances in the system are unevenly dispersed, which affects the detection sensitivity.

[0011] Therefore, how to meet the various performance requirements such as improving nucleic acid amplification efficiency, sensitivity and multiple amplification is a difficult point in improving nucleic acid isothermal amplification methods. Summary of the invention

[0012] In order to solve the above problems and take into account various performance requirements such as improving nucleic acid amplification efficiency, sensitivity and multiple amplification, the first purpose of the present application is to provide a yeast Rad protein hybrid and a yeast Rad protein for combined use in nucleic acid amplification for non-disease diagnosis and / or treatment purposes, the yeast Rad protein has strand displacement activity, and the yeast Rad protein hybrid has an ATP binding domain and catalytic ATP hydrolysis activity.

[0013] The present application utilizes yeast protein homologs to form a hybrid dimer, which has a conserved ATP binding domain and the ability to catalyze ATP hydrolysis, and can promote the yeast Rad protein to displace the single-stranded DNA binding protein bound to the single-stranded DNA, thereby improving the strand displacement activity of the yeast Rad protein, mediating the strand displacement between the primer and the template, and enhancing the affinity of the yeast Rad protein for the low-abundance template, thereby improving the amplification efficiency and sensitivity.

[0014] In one embodiment, the yeast Rad protein hybrid comprises a dimer formed by a combination of yeast Rad55 protein and yeast Rad57 protein; and / or

[0015] Yeast Rad proteins include yeast Rad51 protein.

[0016] In one embodiment, during nucleic acid amplification, the yeast Rad protein hybrid and the yeast Rad protein are also used in combination with at least one of yeast RecQ helicase, single-stranded DNA binding protein, Bsu DNA polymerase and reverse transcriptase.

[0017] In one embodiment, the nucleic acid amplification satisfies at least one of the following characteristics (1) to (2):

[0018] (1) The object of nucleic acid amplification includes at least one of DNA and RNA;

[0019] (2) The reaction conditions for nucleic acid amplification include: an amplification temperature of 20°C to 45°C and an amplification time of 10 to 40 minutes.

[0020] In one embodiment, when the object of nucleic acid amplification is DNA, the reaction conditions of nucleic acid amplification include: an amplification temperature of 20° C. to 45° C., and an amplification time of 10 to 40 min;

[0021] When the object of nucleic acid amplification is RNA, the reaction conditions of nucleic acid amplification include: an amplification temperature of 37° C. to 45° C., and an amplification time of 10 to 40 minutes.

[0022] The second object of the present application is to provide a nucleic acid amplification kit, comprising a yeast Rad protein and a yeast Rad protein hybrid, wherein the yeast Rad protein has a strong chain displacement activity, and the yeast Rad protein hybrid has an ATP binding domain and catalytic ATP hydrolysis activity.

[0023] In one embodiment, the nucleic acid amplification kit satisfies at least one of the following features (1) to (4):

[0024] (1) Yeast Rad protein hybrids include dimers formed by the combination of yeast Rad55 protein and yeast Rad57 protein;

[0025] (2) yeast Rad proteins including yeast Rad51 protein;

[0026] (3) The nucleic acid amplification kit includes at least one of yeast RecQ helicase, single-stranded DNA binding protein, Bsu DNA polymerase and reverse transcriptase;

[0027] (4) The nucleic acid amplification kit includes at least one of Tris buffer, potassium chloride, magnesium chloride, zinc chloride, polyethylene glycol, DTT, ATP, creatine phosphate, dNTPs, a primer combination, a fluorescent probe or a fluorescent dye, creatine phosphate kinase, and an RNase inhibitor.

[0028] In one embodiment, each component in the nucleic acid amplification kit satisfies at least one of the following characteristics (1) to (25):

[0029] (1) The pH value of Tris buffer is 8.2;

[0030] (2) The working concentration of Tris buffer is 10mM to 100mM;

[0031] (3) The concentration of potassium chloride is 10 mM to 200 mM;

[0032] (4) Magnesium chloride 2.5 mM to 20 mM;

[0033] (5) Zinc chloride 0.1mM~2mM;

[0034] (6) The mass volume fraction of polyethylene glycol is 1% to 10%;

[0035] (7) The concentration of DTT is 1 mM to 5 mM;

[0036] (8) The concentration of ATP is 1mM to 5mM;

[0037] (9) The concentration of creatine phosphate is 10mM to 100mM;

[0038] (10) The concentration of dNTPs is 0.1mM to 1mM;

[0039] (11) The concentration of each primer in the primer composition is 0.2 μM to 0.8 μM;

[0040] (12) The concentration of creatine kinase phosphate is 10 ng / μL to 100 ng / μL;

[0041] (13) The concentration of reverse transcriptase is 0.4U / μL to 4U / μL;

[0042] (14) The concentration of RNase inhibitor is 0.1U / μL to 1U / μL;

[0043] (15) The concentration of yeast Rad protein is 10 ng / μL to 300 ng / μL;

[0044] (16) The concentration of yeast Rad protein hybrid is 10 ng / μL to 150 ng / μL;

[0045] (17) The concentration of single-stranded DNA binding protein is 100 ng / μL to 1000 ng / μL;

[0046] (18) The concentration of yeast RecQ helicase is 10 ng / μL to 150 ng / μL;

[0047] (19) The concentration of Bsu DNA polymerase is 30 ng / μL to 300 ng / μL;

[0048] (20) The polyethylene glycol includes at least one of polyethylene glycol 10000, polyethylene glycol 20000, polyethylene glycol 35000, and polyethylene glycol 50000;

[0049] (21) the reverse transcriptase comprises at least one of AMV reverse transcriptase and M-MLV reverse transcriptase;

[0050] (22) Bsu DNA polymerase has no 5′-3′ and 3′-5′ exonuclease activity but has 5′-3′ polymerase activity and strong strand displacement activity;

[0051] (23) The fluorescent dye includes at least one of SYBR Green I, SYTO-9 and SYTO-13 fluorescent dyes;

[0052] (24) Fluorescent probes include exo fluorescent probes;

[0053] (25) The primer composition is used to specifically amplify the nucleic acid of at least one pathogen selected from the group consisting of SARS-CoV-2, influenza A virus H3N2, monkeypox virus, and parainfluenza virus type 1.

[0054] In one embodiment, the fluorescent probe satisfies at least one of the following characteristics (1) to (2):

[0055] (1) The fluorescent probe comprises an oligonucleotide backbone, wherein the oligonucleotide backbone comprises:

[0056] abasic nucleotide groups;

[0057] flanking dT-fluorophores; and

[0058] dT-quencher;

[0059] There are 1 to 3 nucleotides connected between the dT-fluorescent group and the dT-quenching group, and the abasic nucleotide group is located between the dT-fluorescent group and the dT-quenching group; the 3' end of the fluorescent probe contains a modification group to block the extension of the fluorescent probe;

[0060] (2) The fluorescent probe comprises 46-52 nucleotides, at least 30 nucleotides are located at the 5' end of the abasic nucleotide group, and at least 15 nucleotides are located at the 3' end of the abasic nucleotide group.

[0061] The third object of the present application is to provide a use of a yeast Rad protein hybrid and a yeast Rad protein in combination for preparing the above-mentioned nucleic acid amplification kit. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] In order to more clearly illustrate the specific implementation methods of the present application or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0063] Figure 1 The amplification results of different nucleic acids by the nucleic acid amplification kit in Example 2 of the present application;

[0064] Figure 2 The multiple amplification result of the nucleic acid amplification kit in Example 3 of the present application;

[0065] Figure 3 This is the sensitivity test result of the nucleic acid amplification kit in Example 4 of the present application. DETAILED DESCRIPTION

[0066] References to embodiments of the present application will now be provided in detail, one or more examples of which are described below. Each embodiment is provided as an explanation rather than a limitation of the present application. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present application without departing from the scope or spirit of the present application. For example, a feature described or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0067] Therefore, it is intended that the present application covers such modifications and variations that fall within the scope of the appended claims and their equivalents. Other objects, features and aspects of the present application are disclosed in or are apparent from the following detailed description. It will be appreciated by those of ordinary skill in the art that this discussion is merely a description of exemplary embodiments and is not intended to limit the broader aspects of the present application.

[0068] In order to solve the above technical problems, the first aspect of the present application provides a yeast Rad protein hybrid and a yeast Rad protein used in combination in nucleic acid amplification, wherein the yeast Rad protein has strand displacement activity, and the yeast Rad protein hybrid has an ATP binding domain and catalytic ATP hydrolysis activity.

[0069] The present application creatively discovered that the hybrid dimer formed by yeast protein homologs has a conserved ATP binding domain and catalyzes ATP hydrolysis, which can prompt the yeast Rad protein with strong chain displacement activity to displace the single-stranded DNA binding protein bound to single-stranded DNA, thereby stimulating or catalyzing the chain displacement activity of the yeast Rad protein by overcoming the inhibitory effect of the single-stranded DNA binding protein, thereby enhancing the yeast Rad protein's efficient primer / template-mediated chain displacement activity and enhancing the yeast Rad protein's affinity for low-abundance templates, thereby improving amplification efficiency and sensitivity.

[0070] In some specific embodiments, the yeast Rad protein includes the yeast Rad51 protein. Specifically, the yeast Rad51 protein is encoded by the yeast Rad51 gene, has a total length of 440 amino acids, is an ATPase that can form nucleoprotein filaments with single-stranded DNA, and is similar to the Escherichia coli RecA protein. It has recombinase activity and chain displacement activity and can invade homologous DNA sequences. The yeast Rad51 protein can catalyze the DNA chain exchange reaction by relying on ATP and single-stranded DNA binding proteins. In in vitro PCR amplification, the yeast Rad51 protein can bind to single-stranded oligonucleotide primers to form Rad51-ssDNA filaments, and search for homologous DNA sequences, and then invade homologous DNA sequences, and pair the broken DNA ends with ssDNA to produce a displacement loop (D-Loop) linker to achieve chain exchange between the primer sequence and the DNA double strand. The broken DNA ends are then extended by DNA polymerase to produce new DNA products. The average site of yeast Rad51 protein binding to DNA is only 3 nucleotides, and it can catalyze DNA chain transfer from 3'-5 and 5'-3' in both directions.

[0071] In some specific embodiments, the yeast Rad protein hybrid includes a dimer formed by the combination of yeast Rad55 protein and yeast Rad57 protein, which has a conserved ATP binding domain and the ability to catalyze ATP hydrolysis, and can promote Rad51 protein to replace single-stranded DNA binding protein bound to single-stranded DNA.

[0072] Yeast Rad55 and Rad57 proteins are homologs of yeast Rad51 protein. Their gene sequences are similar to the core domain sequences of Walker A and B in yeast Rad51 protein or RecA protein, and their amino acid sequences are 20-30% similar to the ATPase active center sequence of yeast Rad51 protein. Yeast Rad55 and Rad57 proteins interact to form highly stable heterodimers, which have a conserved ATP binding domain and the ability to catalyze ATP hydrolysis. They stimulate or catalyze the strand displacement activity of Rad51 by overcoming the inhibitory effect of single-stranded DNA binding proteins, enhance the efficient mediation of primer / template strand displacement by Rad51 protein and the affinity of Rad51 for low-abundance templates, thereby improving amplification efficiency and sensitivity.

[0073] The present application found that under the auxiliary action of Rad55 / Rad57 protein hybrid, the chain displacement catalytic activity of yeast Rad51 protein was greatly improved, which can promote Rad51 protein to mediate primer / template chain displacement more efficiently, and at the same time improve the affinity of Rad51 protein for low-abundance templates, and the chain displacement between homologous DNA chains mediated by Rad51 protein is highly specific, so that the amplification results are more accurate. Compared with traditional PCR amplification technology, the nucleic acid amplification method of the present application has higher amplification specificity, higher amplification efficiency and higher sensitivity, and can also meet the needs of multiple amplification. In addition, the nucleic acid amplification method of the present application does not require professional operators, is not limited by the site, and is simple, convenient, and has a short reaction time.

[0074] In some embodiments, the yeast Rad protein hybrid and the yeast Rad protein are further used in combination with at least one of a yeast RecQ helicase, a single-stranded DNA binding protein, a Bsu DNA polymerase, and a reverse transcriptase.

[0075] Yeast RecQ helicase is a type of enzyme that can unwind double-stranded nucleotides, and its amino acid sequence is composed of multiple homologous sequences. From the N-terminus to the C-terminus, there are the helicase core domain, the RecQ C-terminal domain, and the helicase RNase D conserved domain. The domains coordinate with each other to jointly execute the operating mechanism of the helicase. The helicase core domain is composed of a highly conserved amino acid sequence and contains 7 conserved regions, which are responsible for binding to NTP, NTP hydrolysis, and DNA binding. There is a zinc finger structure in the RecQ C-terminal domain that can specifically bind to zinc ions. This structure is mainly responsible for the binding of the enzyme to nucleic acids and the folding of the enzyme itself. The helicase RNase D domain is located at the C-terminus of the amino acid sequence, which can enhance the helicase's hydrolysis and unwinding activity on NTP.

[0076] Single-stranded DNA-binding protein (SSB), also known as DNA-binding protein, is essential for DNA replication. Single-stranded binding protein is not an enzyme. The single-stranded binding protein in Escherichia coli cells is composed of 4 identical subunits with a relative molecular mass of 74,000. The span of binding to single-stranded DNA is about 32 nucleotide units. After DNA is unwound, as long as the DNA molecules are base-paired, they tend to bind to double strands. SSB binds to the single-stranded region produced by the helicase moving forward along the replication fork, preventing the newly formed single-stranded DNA from re-pairing to form double-stranded DNA or proteins degraded by nucleases. SSB exhibits a synergistic effect when acting, ensuring that SSB continues to bind to the downstream segment. Unlike polymerase, single-stranded binding protein does not move forward along the replication direction, but constantly binds to and detaches from single-stranded DNA.

[0077] Bsu DNA polymerase is a large fragment of Escherichia coli DNA polymerase I lacking the 5'-3' exonuclease domain and the 3'-5' exonuclease domain. It has 5'-3' polymerase activity and strand displacement activity, but lacks 5'-3' exonuclease activity and 3'-5' exonuclease activity.

[0078] Since yeast Rad55 / Rad57 dimers mediate the strand displacement reaction of DNA by Rad51 in an ATP-dependent manner, the process is susceptible to strong inhibition by the secondary structure of the single-stranded DNA template. Although single-stranded DNA binding proteins can relieve this inhibition, they will also competitively bind to the binding sites on the single-stranded DNA template to inhibit the strand displacement activity of Rad51. The present application utilizes the principle that the hybrid of Rad51 protein and yeast Rad protein homologues itself has single-stranded DNA binding activity and single-stranded DNA stimulating ATPase activity. When using Rad55 and Rad57 homologues, yeast RecQ helicase is additionally used, and zinc ions are added to the system to effectively enhance the activity of yeast RecQ helicase and promote the unwinding of the secondary structure of the DNA template to further promote the strand displacement activity of Rad51 protein, thereby improving the efficiency of isothermal amplification of nucleic acids.

[0079] Furthermore, in addition to using Rad51 protein and its homologues to achieve high-efficiency amplification of DNA, in some embodiments, the present application adds reverse transcriptase to the PCR amplification system, and the addition of reverse transcriptase does not affect the activity of yeast Rad protein and yeast Rad protein homologues, thereby increasing the amplification ability of RNA. Therefore, the method of the present application can be used for both DNA amplification and RNA amplification.

[0080] Accordingly, the present application provides a method for nucleic acid amplification, comprising: obtaining a nucleic acid sample, and realizing isothermal amplification of the nucleic acid sample by using a yeast Rad protein hybrid and a yeast Rad protein in combination, wherein the yeast Rad protein has a strand displacement activity, and the yeast Rad protein hybrid has an ATP binding domain and catalytic ATP hydrolysis activity. The nucleic acid sample obtained may be an extracted nucleic acid sample or a nucleic acid sample extracted according to conventional technical means.

[0081] In some specific embodiments, the nucleic acid sample includes at least one of a DNA sample and an RNA sample. The nucleic acid amplification method of the present application utilizes yeast Rad protein and its homologues to achieve isothermal and high-efficiency amplification of DNA samples. In addition, the present application can also increase the amplification capacity of RNA samples by adding reverse transcriptase to the PCR amplification system.

[0082] In some embodiments, when the nucleic acid sample is a DNA sample, the amplification temperature is 20°C to 45°C, and the amplification time is 10 to 40 minutes; when the nucleic acid sample is an RNA sample, the amplification temperature is 37°C to 45°C, and the amplification time is 10 to 40 minutes. The amplification method of the present application can be used for both isothermal rapid amplification of DNA and isothermal rapid amplification of RNA, and improves the amplification efficiency.

[0083] Accordingly, the second aspect of the present application provides a nucleic acid amplification kit, comprising yeast Rad protein and yeast Rad protein hybrid.

[0084] In some specific embodiments, the yeast Rad protein hybrid comprises a dimer formed by a combination of a yeast Rad55 protein and a yeast Rad57 protein.

[0085] In some specific embodiments, the yeast Rad protein comprises a yeast Rad51 protein.

[0086] In some specific embodiments, the nucleic acid amplification kit includes at least one of yeast RecQ helicase, single-stranded DNA binding protein, Bsu DNA polymerase and reverse transcriptase.

[0087] In some specific embodiments, the nucleic acid amplification kit includes at least one of Tris buffer, potassium chloride, magnesium chloride, zinc chloride, polyethylene glycol, DTT, ATP, creatine phosphate, dNTPs, a primer composition, a fluorescent probe or a fluorescent dye, creatine phosphate kinase, and an RNase inhibitor.

[0088] In some embodiments, the polyethylene glycol includes at least one of polyethylene glycol 10000, polyethylene glycol 20000, polyethylene glycol 35000, and polyethylene glycol 50000. Wherein, polyethylene glycol 10000 refers to polyethylene glycol with an average molecular weight of 10000, and the same applies to other polyethylene glycols.

[0089] In some embodiments, the reverse transcriptase comprises at least one of AMV reverse transcriptase and M-MLV reverse transcriptase.

[0090] In some embodiments, the Bsu DNA polymerase has no 5'-3' and 3'-5' exonuclease activities and has 5'-3' polymerase activity and strong strand displacement activity for extending the strand-displaced nucleic acid.

[0091] In some embodiments, the fluorescent dye comprises at least one of SYBR Green I, SYTO-9, and SYTO-13 fluorescent dyes.

[0092] In some embodiments, the nucleic acid amplification kit of the present application contains a primer composition and a fluorescent probe for specifically amplifying the nucleic acid of at least one pathogen among the new coronavirus, influenza A virus H3N2, monkeypox virus, and parainfluenza virus type 1, so as to achieve the detection of the above pathogens.

[0093] In some embodiments, the nucleic acid amplification kit of the present application can achieve multiple amplification of different pathogens with good specificity. Specifically, it can be multiple specific amplification of the ORF1ab gene of the new coronavirus, the MP gene of influenza A virus H3N2, and the F3L gene of the monkeypox virus.

[0094] In some embodiments, the fluorescent probe comprises an exo fluorescent probe, specifically, the fluorescent probe comprises an oligonucleotide backbone, and the oligonucleotide backbone comprises:

[0095] an abasic nucleotide group; a flanking dT-fluorescent group; and

[0096] dT-quencher;

[0097] Among them, 1 to 3 nucleotides are connected between the dT-fluorescent group and the dT-quencher group, and the abasic nucleotide group is connected between the dT-fluorescent group and the dT-quencher group. Specifically, the abasic nucleotide group refers to a group formed after the nucleotide is freed from the base or an analog of a group formed after the nucleotide is freed from the base.

[0098] In some embodiments, the 3' end of the fluorescent probe contains a modification group to block the extension of the fluorescent probe.

[0099] In some embodiments, the fluorescent probe comprises 46-52 nucleotides, at least 30 nucleotides are located at the 5' end of the abasic nucleotide group, and at least 15 are located at the 3' end of the abasic nucleotide group. In some embodiments, the pH value of the Tris buffer is 8.2 to maintain the stability of the pH value of the amplification reaction system.

[0100] In some embodiments, the working concentration of the Tris buffer is 10 mM to 100 mM, further 30 mM to 100 mM, further 50 mM to 100 mM, further 70 mM to 100 mM.

[0101] In some embodiments, the concentration of potassium chloride is 10 mM to 200 mM, further 50 mM to 200 mM, further 50 mM to 150 mM, further 80 mM to 100 mM.

[0102] In some embodiments, the concentration of magnesium chloride is 2.5 mM to 20 mM, further 5 mM to 20 mM, further 10 mM to 20 mM, further 15 mM to 20 mM.

[0103] In some embodiments, the concentration of zinc chloride is 0.1 mM to 2 mM, further 0.2 mM to 1.8 mM, further 0.5 mM to 1.5 mM, further 0.8 mM to 1.2 mM.

[0104] In some embodiments, the mass volume fraction of polyethylene glycol is 1% to 10%, further 2% to 10%, further 5% to 10%, further 8% to 10%.

[0105] In some embodiments, the concentration of DTT is 1 mM to 5 mM, further 2 mM to 5 mM, further 3 mM to 5 mM, further 4 mM to 5 mM.

[0106] In some embodiments, the concentration of ATP is 1 mM to 5 mM, further 2 mM to 5 mM, further 3 mM to 5 mM, further 4 mM to 5 mM.

[0107] In some embodiments, the concentration of creatine phosphate is 10 mM to 100 mM, further 30 mM to 100 mM, further 50 mM to 100 mM, further 70 mM to 100 mM.

[0108] In some embodiments, the concentration of dNTPs is 0.1 mM to 1 mM, further 0.3 mM to 1 mM, further 0.5 mM to 1 mM, further 0.8 mM to 1 mM.

[0109] In some embodiments, the concentration of each primer in the primer composition is 0.2 μM to 0.8 μM. Further, 0.4 μM to 0.8 μM. Further, 0.6 μM to 0.8 μM.

[0110] In some embodiments, the concentration of creatine phosphokinase is 10 ng / μL to 100 ng / μL, further 30 ng / μL to 100 ng / μL, further 50 ng / μL to 100 ng / μL, further 80 ng / μL to 100 ng / μL.

[0111] In some embodiments, the concentration of the reverse transcriptase is 0.4 U / μL to 4 U / μL, further 1 U / μL to 4 U / μL, further 2 U / μL to 4 U / μL, further 3 U / μL to 4 U / μL.

[0112] In some embodiments, the concentration of the RNase inhibitor is 0.1U / μL to 1U / μL, further 0.3U / μL to 1U / μL, further 0.5U / μL to 1U / μL, further 0.8U / μL to 1U / μL.

[0113] In some embodiments, the concentration of yeast Rad protein is 10 ng / μL to 300 ng / μL, further 50 ng / μL to 300 ng / μL, further 100 ng / μL to 300 ng / μL, further 150 ng / μL to 300 ng / μL.

[0114] In some embodiments, the concentration of the yeast Rad protein hybrid is 10 ng / μL to 150 ng / μL. Further, 30 ng / μL to 150 ng / μL. Further, 80 ng / μL to 150 ng / μL. Further, 100 ng / μL to 150 ng / μL. Further, 120 ng / μL to 150 ng / μL.

[0115] In some embodiments, the concentration of the single-stranded DNA binding protein is 100 ng / μL to 1000 ng / μL, further 300 ng / μL to 1000 ng / μL, further 500 ng / μL to 1000 ng / μL, further 800 ng / μL to 1000 ng / μL.

[0116] In some embodiments, the concentration of yeast RecQ helicase is 10 ng / μL to 150 ng / μL. Further, 30 ng / μL to 150 ng / μL. Further, 80 ng / μL to 150 ng / μL. Further, 100 ng / μL to 150 ng / μL. Further, 120 ng / μL to 150 ng / μL.

[0117] In some embodiments, the concentration of Bsu DNA polymerase is 30 ng / μL to 300 ng / μL, further 50 ng / μL to 300 ng / μL, further 100 ng / μL to 300 ng / μL, further 100 ng / μL to 300 ng / μL.

[0118] In order to obtain the above-mentioned nucleic acid amplification kit, the third aspect of the present application provides a use of a yeast Rad protein hybrid and a yeast Rad protein in combination in the preparation of the above-mentioned nucleic acid amplification kit to improve the specificity and amplification efficiency of nucleic acid isothermal amplification.

[0119] Specifically, the amplification object of the nucleic acid amplification kit includes at least one of DNA and RNA. The amplification reaction conditions of the nucleic acid amplification kit include: an amplification temperature of 20°C to 45°C, and an amplification time of 10 to 40 minutes. The nucleic acid amplification kit of the present application can be used for both isothermal rapid amplification of DNA and isothermal rapid amplification of RNA, and improves its amplification efficiency.

[0120] The embodiments of the present application will be described in detail below in conjunction with examples, but the present application is not limited to these examples. The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0121] Example 1

[0122] The present embodiment provides a nucleic acid amplification kit, comprising 10mM-100mM Tris-HCl buffer, 10mM-200mM potassium chloride, 2.5mM-20mM magnesium chloride, 0.1mM-2mM zinc chloride, 1%-10% polyethylene glycol, 1mM-5mM DTT, 1mM-5mM ATP, 10mM-100mM creatine phosphate, 0.1mM-1mM dNTPs, 0.2μM-0.8μM primer, 10ng / μL-100ng / μL creatine phosphate kinase, 0.4U / μL-4U / μL reverse transcriptase, 0.1U / μL-1U / μL RNase inhibitor, 10ng / μL-300ng / μL yeast Rad51 protein, 10ng / μL-150ng / μL yeast Rad55 protein, 10ng / μL-150ng / μL yeast Rad57 protein, 100ng / μL-1000ng / μL single-stranded DNA binding protein, 10ng / μL-150ng / μL yeast RecQ helicase, 30ng / μL-300ng / μL Bsu DNA polymerase, where primer refers to the concentration of each primer. The purchase channels of each component are shown in Table 1:

[0123]

[0124]

[0125] Example 2

[0126] This example uses the new coronavirus SARS-CoV-2 as an example to specifically illustrate the difference in the amplification ability of RNA and DNA between commercial isothermal amplification reagents and the nucleic acid amplification kit of this application. This application can be used for, but is not limited to, amplification detection of the new coronavirus SARS-CoV-2. Other viral pathogens can also be amplified and detected using similar methods. For different pathogens, it is only necessary to design specific primers based on the nucleic acid sequence of the corresponding pathogen. The primers in this example were all designed by the applicant and commissioned to be synthesized by Shanghai Shenggong Bioengineering Co., Ltd.

[0127] The amplification detection of this embodiment is specifically implemented through the following steps:

[0128] Specific primers were designed based on the novel coronavirus N gene. The primer sequences are as follows:

[0129] nCoVd-2019-N-F1: GCAGTCAAGCCTCTTCTCGTTCCTCATCACGTA

[0130] nCoVd-2019-N-R1: CTGTCAAGCAGCAGCAAAGCAAGAGCAGCATCA

[0131] The TaKaRa MiniBEST Viral RNA / DNA Extraction Kit Ver.5.0 (Takara:9766) nucleic acid extraction kit was used in a biological safety cabinet to extract the RNA of a pseudovirus containing the full sequence of the new coronavirus gene (purchased from Shanghai Yisheng, catalog number 11900ES03). At the same time, a chain displacement rapid amplification reaction was performed using a plasmid containing the new coronavirus N gene as a template.

[0132] RNA and DNA were amplified using the RT-based nucleic acid amplification reagent (RAA method) purchased from Hangzhou Zhongce Biology. The reagent includes A buffer and B buffer. A buffer and B buffer are used to prepare a reconstitution solution. The reconstitution solution system includes the components shown in Table 2:

[0133] Table 2

[0134]

[0135]

[0136] After the system is prepared, 48 μL of the reconstitution solution is added to each freeze-dried reaction tube, and after reconstitution, 2 μL of the nucleic acid template is added to form a reconstitution solution reaction system.

[0137] The reaction system formed by mixing the nucleic acid amplification kit and the nucleic acid template of this embodiment has the components and concentrations shown in Table 3:

[0138] Table 3

[0139]

[0140]

[0141] Two reaction systems with templates added were reacted simultaneously on a fluorescence quantitative PCR instrument, the reaction temperature was 39° C., the reaction time was 30 min, and fluorescence was collected every 30 sec.

[0142] The amplification results are as follows Figure 1 As shown, the commercial RT-based nucleic acid amplification reagent (RAA method) and the nucleic acid amplification kit of the present application have amplification signals for both plasmid and RNA templates. Figure 1 The amplification curves 1, 2, 3 and 4 shown in the figure are the amplification curves of the nucleic acid amplification kit of the present application for plasmid amplification ( Figure 1 The peak time of amplification curve No. 1 in the figure is earlier than the peak time of plasmid amplification by commercial RT-based nucleic acid amplification reagent (RAA method) ( Figure 1 2 amplification curve), the nucleic acid amplification kit of the present application amplifies RNA ( Figure 1 The peak time of the amplification curve (No. 3) is earlier than the peak time of RNA amplification by the commercial RT-based nucleic acid amplification reagent (RAA method) ( Figure 1 The above experimental results show that the nucleic acid amplification kit of the present application has higher amplification efficiency than the RAA reagent, whether for plasmid or RNA.

[0143] Example 3

[0144] This embodiment takes the detection of the new coronavirus, influenza A virus H3N2, and monkeypox virus as examples to specifically describe the process of rapid amplification of nucleic acids at room temperature by multiple strand displacement. This application can be implemented but not limited to the detection of these three pathogens, and other pathogens can also be detected in a similar manner. In this embodiment, both RNA viruses, new coronaviruses and influenza A virus H1N1-2009, as well as DNA viruses, monkeypox virus are included. For different microbial pathogens, it is only necessary to design specific primers and probes for the gene sequence of the pathogen. The primers of this embodiment are designed by the applicant and commissioned to be synthesized by Shanghai Bioengineering.

[0145] The nucleic acid detection in this embodiment is specifically achieved through the following steps:

[0146] The 2019-nCoV ORF1ab gene, the influenza A virus H3N2 MP gene, and the monkeypox virus F3L gene were selected for BLAST analysis and specific strand displacement primers were designed respectively. The designed primers only perform effective strand displacement amplification on the corresponding genes.

[0147] The primer sequences are as follows:

[0148] Detection of novel coronavirus ORF1ab primer sequence:

[0149] nCovd-ORF1ab-F:GTACAAATACCTACAACTTGTGCTAATGACCCT

[0150] nCovd-ORF1ab-R:ACGATTGTGCATCAGCTGACTGAAGCATGGGTT

[0151] nCovd-ORF1ab-Probe:CCGTCTGCGGTATGTGGAAAGGTTATGGCTG[[FA M-dT]]A[THF]T[BHQ1-dT]GTGATCAACTCCGCG[C3 Spacer]

[0152] Primer sequences for detecting influenza A virus H3N2:

[0153] H3N2-F:TCAGGCCCCCTCAAAGCCGAGATCGCGCAGAGA

[0154] H3N2-R:ACCCTAAAATCCCCTTAGTCAGAGGTGACAGA

[0155] H3N2-Probe:TCTTTGCTGGGAAAAACACAGATCTTGAGGC[VIC-dT][TH F][BHQ1-dT]CATGGAATGGCTAAAG[C3 spacer]

[0156] Primer sequences for detecting monkeypox virus:

[0157] MPXV-F:CTAATGATGACATAACTAAGAAGTTTATCTACA

[0158] MPXV-R:TAACTCTCCTACATTTTATGCCTGTGTAGACAT

[0159] MPXV-Probe:CCAATTTAGCTGCATTATTTTTAGCATCTCG[CY5-dT][THF][BHQ2-dT]AGATTTTCCATCTGCC[C3 spacer]

[0160] In a biological safety cabinet, the TaKaRa MiniBEST Viral RNA / DNA Extraction Kit Ver. 5.0 (Takara: 9766) nucleic acid extraction kit was used to extract the pseudovirus containing the complete gene sequence of the new coronavirus (Shanghai Yishen: 11900ES03), influenza A (H3N2 RNA) liquid indoor quality control product (Guangzhou Bondesheng: BDS-IQC-342) RNA, and monkeypox virus deoxyribonucleic acid liquid indoor quality control product (Guangzhou Bondesheng: BDS-IQC-373) DNA.

[0161] The reaction system formed by mixing the nucleic acid amplification kit of this embodiment and the nucleic acid template to be tested has the following components and concentrations as shown in Table 4:

[0162] Table 4

[0163]

[0164]

[0165] After the reaction system is prepared, cover the PCR tube with a cap and place it in a fluorescent quantitative PCR instrument for amplification reaction. The reaction temperature is 42°C, the reaction time is 30 minutes, and the fluorescence is collected every 30 seconds.

[0166] The results of multiplex amplification are as follows Figure 2 As shown, except for NTC, which has no peak, the new coronavirus, influenza A virus H3N2, and monkeypox virus all have amplification signals, which shows that the reagents of the present application can perform multiple strand displacement amplification reactions.

[0167] Example 4

[0168] This example uses the detection of parainfluenza virus type 1 plasmid as an example to specifically illustrate the difference in analytical sensitivity between the strand displacement room temperature nucleic acid rapid amplification and the comparison reagent. This application can be used to detect, but is not limited to, parainfluenza virus type 1 pathogens. Other pathogens can also be analyzed using similar methods. In this example, the plasmid of the parainfluenza virus type 1 target gene was diluted from 1 ng / μL to 10 in a 10-fold concentration gradient. -1 ng / μL, 10 -2 ng / μL, 10 -3 ng / μL, 10 -4 ng / μL, 10 -5 ng / μL, 10 -6 ng / μL, 10 -7 ng / μL was used as the sample for amplification reaction for comparative analysis.

[0169] The detection process of parainfluenza virus type 1 plasmid in this embodiment is specifically achieved through the following steps:

[0170] The genes of parainfluenza virus type 1 were selected for BLAST comparison analysis and then specific primers and exo probes were designed. The primers of this embodiment were designed by the applicant and commissioned to Shanghai Bioengineering for synthesis.

[0171] The primer and probe sequences are as follows:

[0172] HPIV1-F: CAATATATGGCGTATTCATCAAACTTAATCACTC

[0173] HPIV1-R:CATGATTTCCTGTTGTCGTTGATGTCATAGGT

[0174] HPIV1-exoProbe:TTACAATTAGGTTACATTCCTAAATTCAGA[FAM-dT][THF][BHQ1-dT]GTATCCTGATTTAAAC[C3 spacer]

[0175] The RT-based nucleic acid amplification reagent (RAA method) purchased from Hangzhou Zhongce Biological was used to add exo III exonuclease plasmid DNA amplification. The reagent includes A buffer and B buffer. The complex solution system is prepared using A buffer and B buffer as follows:

[0176] Table 5

[0177] A buffer 29.4μL B buffer 2.5μL 10 μM upstream primer 2μL 10 μM downstream primer 2μL NF-Water 11.1μL Exo III 1μL volume 48μL

[0178] After the system is prepared, add 48 μL of reconstitution solution to each freeze-dried reaction tube, and then add 2 μL of nucleic acid template after reconstitution.

[0179] The reaction system formed by mixing the nucleic acid amplification kit and the template of this embodiment has the following components and concentrations as shown in Table 6:

[0180] Table 6

[0181]

[0182]

[0183] After the two reaction systems were prepared, the PCR tubes were capped and placed in a fluorescent quantitative PCR instrument for amplification reaction. The reaction temperature was 42°C, the reaction time was 30 minutes, and fluorescence was collected every 30 seconds.

[0184] The sensitivity analysis results of this example are as follows Figure 3 As shown in the figure, the commercial RT-based nucleic acid amplification reagent (RAA method) can only amplify plasmid DNA by adding exo III exonuclease to 10 -6 ng / μL plasmid concentration, as Figure 3 As shown in A, the nucleic acid amplification kit of the present application can achieve 10 -7 ng / μL concentration of plasmid, as Figure 3 As shown in B, this indicates that the nucleic acid amplification kit of the present application is superior to the RT-based nucleic acid amplification reagent (RAA method) of a certain manufacturer.

[0185] The technical features of the above embodiments may be combined arbitrarily. To make the description concise, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0186] The above embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims.

Claims

1. A nucleic acid amplification kit, characterized in that: It includes yeast Rad protein and yeast Rad protein hybrid, wherein the yeast Rad protein has strand displacement activity, and the yeast Rad protein hybrid has an ATP binding domain and catalytic ATP hydrolysis activity; The nucleic acid amplification kit meets the following characteristics: (1) The yeast Rad protein hybrid is a dimer formed by the combination of yeast Rad55 protein and yeast Rad57 protein; (2) The yeast Rad protein is yeast Rad51 protein; (3) The nucleic acid amplification kit further comprises yeast RecQ helicase, single-stranded DNA binding protein, Bsu DNA polymerase and reverse transcriptase; (4) The nucleic acid amplification kit further comprises Tris buffer, potassium chloride, magnesium chloride, zinc chloride, polyethylene glycol, DTT, ATP, creatine phosphate, dNTPs, a primer combination, a fluorescent probe, a fluorescent dye, creatine phosphate kinase and an RNase inhibitor; The components in the nucleic acid amplification kit meet the following characteristics: (1) The pH value of Tris buffer is 8.2; (2) The working concentration of Tris buffer is 50 mM; (3) The concentration of potassium chloride is 100 mM; (4) Magnesium chloride 14 mM; (5) Zinc chloride 1 mM; (6) The mass volume fraction of polyethylene glycol is 5.5%; (7) The concentration of DTT is 2 mM; (8) The concentration of ATP is 3 mM; (9) The concentration of creatine phosphate is 20 mM; (10) The concentration of dNTPs is 0.2 mM; (11) The concentration of each primer in the primer composition is 0.48 μM; (12) creatine kinase phosphate concentration 100 ng / μL; (13) The concentration of reverse transcriptase was 2 U / μL; (14) The concentration of RNase inhibitor was 0.1 U / μL; (15) The concentration of yeast Rad protein was 120 ng / μL; (16) The concentration of yeast Rad protein hybrid was 50 ng / μL; (17) ssDNA binding protein concentration 240 ng / μL; (18) Yeast RecQ helicase concentration 100 ng / μL; (19) Bsu DNA polymerase concentration 60 ng / μL; (20) The polyethylene glycol includes at least one of polyethylene glycol 10000, polyethylene glycol 20000, polyethylene glycol 35000, and polyethylene glycol 50000; (21) the reverse transcriptase comprises at least one of AMV reverse transcriptase and M-MLV reverse transcriptase; (22) Bsu DNA polymerase has no 5′-3′ and 3′-5′ exonuclease activity but has 5′-3′ polymerase activity and strong strand displacement activity; (23) The fluorescent dye includes at least one of SYBR Green I, SYTO-9 and SYTO-13 fluorescent dyes; (24) Fluorescent probes include exo fluorescent probes; (25) The primer composition is used to specifically amplify the nucleic acid of at least one pathogen selected from the group consisting of SARS-CoV-2, influenza A virus H3N2, monkeypox virus, and parainfluenza virus type 1.

2. The nucleic acid amplification kit according to claim 1, characterized in that The fluorescent probe satisfies at least one of the following characteristics (1) to (2): (1) The fluorescent probe comprises an oligonucleotide backbone, wherein the oligonucleotide backbone comprises: abasic nucleotide groups; flanking dT-fluorophores; and dT-quencher; There are 1 to 3 nucleotides connected between the dT-fluorescent group and the dT-quenching group, and the abasic nucleotide group is located between the dT-fluorescent group and the dT-quenching group; the 3' end of the fluorescent probe contains a modification group to block the extension of the fluorescent probe; (2) The fluorescent probe comprises 46-52 nucleotides, at least 30 nucleotides are located at the 5' end of the abasic nucleotide group, and at least 15 nucleotides are located at the 3' end of the abasic nucleotide group.

Images