KASP molecular marker tightly linked to the sex of bitter melon and its application

Abstract

The present invention belongs to the field of biomolecular marker technology and provides a KASP molecular marker tightly linked to bitter melon sex and its application. The KASP molecular marker is located at bases 20075506, 20576810, and 20597564 on chromosome 1 of the bitter melon gene. The KASP molecular marker method described herein can be used to identify bitter melon sex and improve the breeding of bitter melon female lines. The three sets of KASP molecular marker primers have improved specificity, sensitivity, and reproducibility, resulting in a high detection rate and more accurate identification of bitter melon sex types. The KASP marker is also less susceptible to strong female and pseudo-female phenotypes, accelerating the breeding of bitter melon female lines.

Description

Technical Field

[0001] The present invention relates to the technical field of biomolecular markers, in particular to a KASP molecular marker closely linked to the sex of bitter melon and an application thereof. Background Art

[0002] Bitter melon is an important health-care vegetable of the Cucurbitaceae family. In recent years, as people's understanding of the medicinal and health-care value of bitter melon continues to deepen, the consumer group of bitter melon has gradually expanded from Southeast Asia and southern my country to the whole of Asia and other parts of the world.

[0003] Bitter melon flowers have three types: female, male, and bisexual. Under natural conditions, based on the different flower combinations on the same plant, bitter melon types are classified as follows: dioecious, with both female and male flowers on the same plant; fully female, with only female flowers; and, rarely, with a combination of female, male, and bisexual flowers on the same plant. Dioecious bitter melon is the most common, capable of self-pollination and seed preservation, and is the primary resource for bitter melon breeding and production. Based on the ratio of male and female flowers, bitter melon strains can be divided into strongly female, less strongly female, and less female. A female-to-male ratio of 90-100% is considered strongly female, a female-to-male ratio of 10-90% is less strongly female, and a female-to-male ratio of 0-10% is less strongly female. The inheritance of strong female strains is not only controlled by their own genetic factors, but also by climatic and environmental factors. Some strong female strains appear strong female or even fully female when planted in summer and autumn, but appear non-strong female when planted in winter and spring, or even fully female strains appear strong female. This pseudo-full-female phenomenon affects the efficiency of selecting female bitter melon strains. Male and female bitter melon flowers are distinct, with female flowers having ovaries and male flowers lacking them, so the sex of bitter melon can be distinguished based on their appearance. Traditional identification methods require at least two years of observation to determine the sex type of bitter melon. This is time-consuming and susceptible to strong female and pseudo-full-female patterns, hindering the selection of female bitter melon strains.

[0004] KASP (Kompetitive Allele-Specific PCR) achieves genotyping by specifically identifying gene loci with fluorescent probes and can be used to detect single nucleotide polymorphisms (SNPs) and indels (InDels). Compared to other molecular markers such as SSR, RFLP, and InDel, KASP markers offer rapid detection, low cost, and ease of scalability. KASP markers do not require typing based on DNA fragment size, eliminating the cumbersome, low-throughput, and expensive nature of traditional gel electrophoresis methods, making them more suitable for the rapidly developing high-throughput molecular detection platforms. Therefore, developing KASP markers for bitter melon sex typing suitable for high-throughput molecular detection platforms is crucial for improving the efficiency of breeding bitter melon female lines. Summary of the Invention

[0005] The present invention aims to provide a primer set, a kit and an application thereof for detecting a KASP molecular marker closely linked to the sex of bitter melon, which can accurately and stably identify the sex of bitter melon and is not easily affected by strong females and pseudo-full females, thereby improving the breeding efficiency of bitter melon female lines and facilitating the improvement and breeding of bitter melon female lines.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a primer set for detecting a KASP molecular marker that is closely linked to the sex of bitter melon, wherein the primer set is any one of the KASP primer sets for bases 20075506, 20576810, and 20597564 of chromosome 1 of the bitter melon gene;

[0008] The KASP primer set for base 20075506 includes forward primer F1 SEQ ID NO: 28, forward primer F2 SEQ ID NO: 29, and reverse primer R SEQ ID NO: 30;

[0009] The KASP primer set for base 20576810 includes forward primer F1 SEQ ID NO: 37, forward primer F2 SEQ ID NO: 38, and reverse primer R SEQ ID NO: 39;

[0010] The KASP primer set for base 20597564 includes a forward primer F1 SEQ ID NO: 40, a forward primer F2 SEQ ID NO: 41, and a reverse primer R SEQ ID NO: 42.

[0011] The present invention provides a sequencing primer set for detecting a KASP molecular marker that is closely linked to the sex of bitter melon, wherein the sequencing primer set is any one of the KASP sequencing primer sets for bases 20075506, 20576810, and 20597564 of chromosome 1 of the bitter melon gene;

[0012] The KASP sequencing primer set for base 20075506 is obtained by connecting a first sequencing adapter and a second sequencing adapter to the forward primer F1 and the forward primer F2 of the KASP primer set for base 20075506, respectively;

[0013] The KASP sequencing primer set for base 20576810 is obtained by connecting a first sequencing adapter and a second sequencing adapter to the forward primer F1 and the forward primer F2 of the KASP primer set for base 20576810, respectively;

[0014] The KASP sequencing primer set at base 20597564 is formed by connecting a first sequencing adapter and a second sequencing adapter to the forward primer F1 and the forward primer F2 of the KASP primer set at base 20597564, respectively;

[0015] The 5' ends of the first sequencing adapter and the second sequencing adapter are respectively connected to different fluorescent groups; the sequence of the first sequencing adapter is shown in SEQ ID NO: 49, and the sequence of the second sequencing adapter is shown in SEQ ID NO: 50.

[0016] The present invention also provides a kit for identifying the sex of bitter melon, comprising the primer set of the KASP molecular marker or the sequencing primer set.

[0017] Preferably, the kit further comprises a detection reagent.

[0018] The present invention also provides the use of the KASP molecular marker primer set, the sequencing primer set or the kit in gender identification of bitter melon.

[0019] The present invention also provides the use of the KASP molecular marker primer set, the sequencing primer set or the kit in the improvement and breeding of bitter melon female lines.

[0020] The present invention also provides a method for identifying the sex of bitter melon using KASP molecular markers, comprising the following steps:

[0021] (1) using the momordica charantia genomic DNA as a template and performing a PCR amplification reaction using the sequencing primer set to obtain an amplified product;

[0022] (2) Detecting the amplified products: When the genotypes of the 20075506th, 20576810th, and 20597564th positions of the KASP molecular markers detected are TT, GG, and AA, respectively, the variety is determined to be an all-female bitter melon variety;

[0023] When the genotypes of the 20075506th, 20576810th and 20597564th positions of the KASP molecular markers detected are TG, GT and CA respectively, the bitter melon variety is determined to be gynoecium or non-gynoecium;

[0024] When the genotypes of the 20075506th, 20576810th and 20597564th positions of the KASP molecular marker detected are GG, TT and CC respectively, it is determined to be a weak-female bitter melon variety.

[0025] By adopting the above technical solution, the present invention has the following beneficial effects:

[0026] 1. The KASP primer set and KASP sequencing primer set obtained in the technical solution of the present invention have good specificity, high sensitivity, good repeatability, better marker typing effect, and higher detection rate.

[0027] 2. The present invention utilizes KASP molecular markers for identification of the sex of bitter melon. The method does not require typing based on DNA fragment size, and can get rid of the relatively cumbersome, low-throughput, and expensive detection method of traditional gel electrophoresis. The method has the characteristics of simple operation, low cost, strong specificity, and high stability.

[0028] 3. The scheme of the present invention is not easily affected by strong female and pseudo-full female, can improve the breeding efficiency of bitter melon female lines, accelerate the breeding process of bitter melon female lines, and is conducive to the improvement and breeding of bitter melon female lines. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Partial genotyping diagram of F2 detected by KASP molecular markers MS20075506, MS20576810 and MS20597564 (A in the figure is the F2 genotyping diagram of MS20075506, B in the figure is the F2 genotyping diagram of MS20576810, and C in the figure is the F2 genotyping diagram of MS20597564; among them, ○ indicates that the genotype is all-female plants, □ indicates that the genotype is weakly female plants, △ indicates that the genotype is strong female and non-strong female plants, # indicates no template NTC, and x indicates not detected). DETAILED DESCRIPTION

[0030] The invention provides a primer set for detecting a KASP molecular marker closely linked to the sex of bitter melon. The primer set is any one of the KASP primer sets for bases 20075506, 20576810 and 20597564 on chromosome 1 of the bitter melon gene. In the present invention, the KASP primer set for base 20075506 includes forward primer F1 SEQ ID NO: 28, forward primer F2 SEQ ID NO: 29, and reverse primer R SEQ ID NO: 30; the KASP primer set for base 20576810 includes forward primer F1 SEQ ID NO: 37, forward primer F2 SEQ ID NO: 38, and reverse primer R SEQ ID NO: 39; and the KASP primer set for base 20597564 includes forward primer F1 SEQ ID NO: 40, forward primer F2 SEQ ID NO: 41, and reverse primer R SEQ ID NO: 42.

[0031] In the present invention, the bitter melon gene is the complete genome sequence of the bitter melon (M. charantia) inbred line "Dali-11," CNGB Assembly ID CNA0000004. The KASP molecular markers described in the present invention are the G / T variant at base 20,075,506 on chromosome 1, the G / T variant at base 20,576,810 on chromosome 1, and the A / C variant at base 20,597,564 on chromosome 1.

[0032] The invention provides a sequencing primer set for detecting a KASP molecular marker closely linked to the sex of bitter melon. The sequencing primer set is any one of the KASP sequencing primer sets for bases 20075506, 20576810 and 20597564 on chromosome 1 of the bitter melon gene. In the present invention, the KASP sequencing primer set for base 20,075,506 is obtained by connecting a first sequencing adapter and a second sequencing adapter to forward primer F1 and forward primer F2 of the KASP primer set for base 20,075,506, respectively. The KASP sequencing primer set for base 20,075,506 is obtained by connecting a first sequencing adapter and a second sequencing adapter to forward primer F1 and forward primer F2 of the KASP primer set for base 20,075,506, respectively. The KASP sequencing primer set for base 20,576,810 is obtained by connecting a first sequencing adapter and a second sequencing adapter to forward primer F1 and forward primer F2 of the KASP primer set for base 20,576,810, respectively. The sequence of the first sequencing adapter in the present invention is shown in SEQ ID NO:49, and the sequence of the second sequencing adapter is shown in SEQ ID NO:50. In the present invention, the 5' ends of the first sequencing adapter and the second sequencing adapter are connected to different fluorescent groups respectively. The 5' end of the first sequencing adapter is connected to a FAM fluorescent group, and the 5' end of the second sequencing adapter is connected to a HEX fluorescent group.

[0033] The invention provides a kit for identifying the sex of bitter melon, comprising the primer set of the KASP molecular marker or the sequencing primer set.

[0034] In the present invention, the kit further comprises a detection reagent, which includes 2×KASP Mastermix, Primer assay mix, and ddH2O.

[0035] The present invention also provides the use of the KASP molecular marker primer set, the sequencing primer set or the kit in gender identification of bitter melon.

[0036] The present invention also provides the use of the KASP molecular marker primer set, the sequencing primer set or the kit in the improvement and breeding of bitter melon female lines.

[0037] The present invention also provides a method for identifying the sex of bitter melon using KASP molecular markers, comprising the following steps:

[0038] (1) using the momordica charantia genomic DNA as a template and performing a PCR amplification reaction using the sequencing primer set to obtain an amplified product;

[0039] (2) Detection of the amplified products: When the genotypes of the 20075506th, 20576810th and 20597564th positions of the KASP molecular markers detected are TT, GG and AA respectively, the bitter melon variety is determined to be fully female; when the genotypes of the 20075506th, 20576810th and 20597564th positions of the KASP molecular markers detected are TG, GT and CA respectively, the bitter melon variety is determined to be strong female and non-strong female; when the genotypes of the 20075506th, 20576810th and 20597564th positions of the KASP molecular markers detected are GG, TT and CC respectively, the bitter melon variety is determined to be weak female. In the present invention, the PCR amplification reaction system is 10 μl, including 5 μl 2×KASP Master mix, 0.5 μl Primer assay mix and 2.5 μl bitter melon genomic DNA at a concentration of 10 ng / μl, supplemented with ddH2O. The Primer assay mix contains two synthesized forward primers F1 and F2 and one reverse primer R, with a preparation ratio of F1:F2:R=1:1:3, and the concentration of each primer is 50 μM. The PCR reaction program is: 95°C for 10 min; 95°C for 20 s, 61°C for 60 s, and then reducing 0.6°C each cycle until 55°C, for a total of 10 cycles; denaturation at 95°C for 20 s, 55°C for 60 s, for a total of 28 cycles; 25°C for 1 min.

[0040] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0041] Example 1

[0042] (1) Construction of the group

[0043] The all-female bitter melon material MC52 is a high-generation inbred line of bitter melon provided by the Vegetable Research Institute of the Guangxi Academy of Agricultural Sciences. The weak-female bitter melon material MC52-1 is a high-generation inbred line of bitter melon bred through radiation mutagenesis, also provided by the Vegetable Research Institute of the Guangxi Academy of Agricultural Sciences. The weak-female bitter melon material MC52-1 was derived from the all-female bitter melon material MC52 by irradiating it with 60Co-γ rays (a dose of 600Gy). F1 plants were obtained by crossing MC52 as the female parent and MC52-1 as the male parent, and the F2 segregating population was obtained by selfing the F1 plants.

[0044] (2) Identification of bitter melon sex

[0045] The F2 population was planted in a greenhouse, and the sexual characteristics of bitter melons were investigated during peak flowering. The criteria for the investigation were: plants with exclusively female flowers on all branches during peak flowering were considered fully female; plants with fewer than three female flowers within 50 nodes starting from the node where the first female flower appeared were considered weakly female; and plants with a range between fully female and weakly female were considered strongly female or weakly female.

[0046] (3) Location of the all-female gene in bitter melon

[0047] High-throughput resequencing (50×) combined with bioassay analysis was performed using F2 segregating populations constructed from the all-female inbred line MC52 and the sub-female inbred line MC52-1. A total of 172,695 single-nucleotide polymorphisms (SNPs) and 55,086 indels were identified through resequencing. Preliminary mapping was performed using four analytical methods, including SNP-index, G-value, ED, and Fisher's test. Ultimately, a candidate interval associated with all-female fertility, chr 1, was identified: 18600001-21148382 bp.

[0048] To further narrow the candidate interval, sites within the initial mapping interval that were homozygous and differential between the parents were screened. From these homozygous and differential sites, variant sites located in genomic regions (upstream, intronic, exonic, and UTR regions) were selected to develop KASP molecular markers. Individual plants in the F2 segregating population were genotyped using the developed KASP molecular markers to identify the exchange plants. Based on the data from the bitter melon sex phenotyping survey and the confirmed genotypes of the exchange plants, the gene was mapped to the 2005506-20712179 bp interval on chromosome 1.

[0049] (IV) KASP marker development and verification of bitter melon gender correlation

[0050] (1) According to the positioning of the bitter melon all-female gene in the interval of 2005506-20712179bp on chromosome 1, molecular markers at base 18236964 (MS18236964), base 18331468 (MS18331468), base 18335759 (MS18335759), base 18597745 (MS18597745), base 19475701 (MS19475701), base 19518423 (MS19518423), base 19527366 (MS19527366), and base 1 There are 16 SNP sites in total, including base 9897585 (MS19897585), base 20069172 (MS20069172), base 20075506 (MS20075506), base 20529197 (MS20529197), base 20555227 (MS20555227), base 20576810 (MS20576810), base 20597564 (MS20597564), base 20712179 (MS20712179) and base 21046129 (MS21046129).

[0051] (2) Primer design

[0052] Based on the screened SNP variant sites, primer design was performed using the Leal-Bertioli method. A set of primers was designed for each SNP site, including two specific forward primers and one reverse primer. The primer sequences were synthesized by Nanjing Jisi Huiyuan Biotechnology Co., Ltd.

[0053] The forward primer F1 SEQ ID NO: 1 of the MS18236964 is 5'-ttcgagagacaatttgtattcctgcG-3', the forward primer F2 SEQ ID NO: 2 is 5'-ttcgagagacaatttgtattcctgcC-3', and the reverse primer R SEQ ID NO: 3 is 5'-aaataagtgggcatctcaagaaacgac-3';

[0054] The forward primer F1 SEQ ID NO: 4 of the MS18331468 is 5'-tgtttctagcaaggaacaagtttccC-3', the forward primer F2 SEQ ID NO: 5 is 5'-tgtttctagcaaggaacaagtttccT-3', and the reverse primer R SEQ ID NO: 6 is 5'-gagaagcagagaaggaaattcaacaactg-3';

[0055] The forward primer F1 SEQ ID NO:7 of MS18335759 is 5'-cacaaatctcgaccaataccaatgcA-3', the forward primer F2 SEQ ID NO:8 is 5'-cacaaatctcgaccaataccaatgcG-3', and the reverse primer R SEQ ID NO:9 is 5'-catctactttttcttgccggaaactaagg-3';

[0056] The forward primer F1 SEQ ID NO: 10 of MS18597745 is 5'-ttgggaaagatttaggaacatggccA-3', the forward primer F2 SEQ ID NO: 11 is 5'-ttgggaaagatttaggaacatggccG-3', and the reverse primer R SEQ ID NO: 12 is 5'-gaacttaatagtaagctcagggggcag-3';

[0057] The forward primer F1 SEQ ID NO: 13 of the MS19475701 is 5'-aaggaatgcagggaataaggatgaaC-3', the forward primer F2 SEQ ID NO: 14 is 5'-aaggaatgcagggaataaggatgaaT-3', and the reverse primer R SEQ ID NO: 15 is 5'-atgattgttgagtccaatgacaagctc-3';

[0058] The forward primer F1 SEQ ID NO: 16 of the MS19518423 is 5'-ccttatgggggttgtatcttccaacC-3', the forward primer F2 SEQ ID NO: 17 is 5'-ccttatgggggttgtatcttccaacA-3', and the reverse primer R SEQ ID NO: 18 is 5'-ctacaagcaagagccaaaaccttcat-3';

[0059] The forward primer F1 SEQ ID NO: 19 of the MS19527366 is 5'-tagttcaacatgtgggattcggaatA-3', the forward primer F2 SEQ ID NO: 20 is 5'-tagttcaacatgtgggattcggaatC-3', and the reverse primer R SEQ ID NO: 21 is 5'-caacttgaggatagctcaactagttatagc-3';

[0060] The forward primer F1 SEQ ID NO: 22 of the MS19897585 is 5'-aatctcgccaagtgtaggtttgtcaC-3', the forward primer F2 SEQ ID NO: 23 is 5'-aatctcgccaagtgtaggtttgtcaT-3', and the reverse primer R SEQ ID NO: 24 is 5'-ctactgaagtgtggagttaggtgatctc-3';

[0061] The forward primer F1 SEQ ID NO: 25 of the MS20069172 is 5'-ggtgcctttgttttgtcaatcttacA-3', the forward primer F2 SEQ ID NO: 26 is 5'-ggtgcctttgttttgtcaatcttacG-3', and the reverse primer R SEQ ID NO: 27 is 5'-gtgtcttgaggtggagcttatatggtata-3';

[0062] The forward primer F1 SEQ ID NO: 28 of the MS20075506 is 5'-ccatacccaacagatcaaacaattgG-3', the forward primer F2 SEQ ID NO: 29 is 5'-ccatacccaacagatcaaacaattgT-3', and the reverse primer R SEQ ID NO: 30 is 5'-ccaatgacagtggcaatggtagaattac-3';

[0063] The forward primer F1 SEQ ID NO: 31 of the MS20529197 is 5'-aaaaagtagcttcaaacagccatggA-3', the forward primer F2 SEQ ID NO: 32 is 5'-aaaaagtagcttcaaacagccatggC-3', and the reverse primer R SEQ ID NO: 33 is 5'-tacaaaataaaggggacactctttgcc-3';

[0064] The forward primer F1 SEQ ID NO: 34 of the MS20555227 is 5'-cctagagctacattacttcgggtcaT-3', the forward primer F2 SEQ ID NO: 35 is 5'-cctagagctacattacttcgggtcaA-3', and the reverse primer R SEQ ID NO: 36 is 5'-cgctcgaaccataattcataaataagggc-3';

[0065] The forward primer F1 SEQ ID NO: 37 of the MS20576810 is 5'-actgaaaattggtcgtctctccattG-3', the forward primer F2 SEQ ID NO: 38 is 5'-actgaaaattggtcgtctctccattT-3', and the reverse primer R SEQ ID NO: 39 is 5'-gtgggatggtcgtctcttgatgtattatt-3';

[0066] The forward primer F1 SEQ ID NO:40 of MS20597564 is 5'-gaggatacgaaatggattccagaagA-3', the forward primer F2 SEQ ID NO:41 is 5'-gaggatacgaaatggattccagaagC-3', and the reverse primer R SEQ ID NO:42 is 5'-aaaatcgtatcccagacgtgtcctg-3';

[0067] The forward primer F1 SEQ ID NO:43 of the MS20712179 is 5'-gaaataagcacaacatcgcgtatgcA-3', the forward primer F2 SEQ ID NO:44 is 5'-gaaataagcacaacatcgcgtatgcT-3', and the reverse primer R SEQ ID NO:45 is 5'-caatctaatctccttccagcctcatcatt-3';

[0068] The forward primer F1 SEQ ID NO: 46 of the MS21046129 is 5'-gtgtattctcgcacgtttgttctatT-3', the forward primer F2 SEQ ID NO: 47 is 5'-gtgtattctcgcacgtttgttctatC-3', and the reverse primer R SEQ ID NO: 48 is 5'-ctagtttttcctccaggtacgtcaatt-3'.

[0069] (3) PCR amplification

[0070] Different sequencing adapters were added to the 5' end of the two forward primers in each of the 16 primer sets developed and designed by KASP. Among them, the first sequencing adapter SEQ ID NO: 49 with the sequence of GAAGGTGACCAAGTTCATGCT was added to the 5' end of the forward primer F1 in each group; the second sequencing adapter SEQ ID NO: 50 with the sequence of GAAGGTCGGAGTCAACGGATT was added to the 5' end of the forward primer F2 in each group.

[0071] Amplification was performed using a PCR instrument. The PCR reaction system consisted of 10 μl, including 5 μl of 2×KASP Master mix, 0.5 μl of Primer assay mix (containing two synthesized forward primers F1 and F2, and one reverse primer R, with a ratio of F1:F2:R = 1:1:3, and primer concentrations of 50 μM each), and 2.5 μl of bitter melon genomic DNA at a concentration of 10 ng / μl, supplemented with ddH2O. The reaction procedure was as follows: 95°C for 10 min; 95°C for 20 s, 61°C for 60 s, with the temperature decreasing by 0.6°C each cycle until it reached 55°C, for a total of 10 cycles; denaturation at 95°C for 20 s, 55°C for 60 s, for a total of 28 cycles; and 25°C for 1 min.

[0072] (4) Fluorescence data reading and analysis

[0073] After the PCR reaction is completed, a high-throughput SNP typing instrument is used to read the fluorescence data. If the fluorescence signal corresponding to the data is low and the clusters are scattered, the fluorescence reading can be repeated after additional cycles. The program is as follows: 95°C for 20 seconds, 55°C for 60 seconds, and 3 cycles.

[0074] (5) Screening of polymorphic SNPs and genotyping of F2 population

[0075] After the KASP reaction was completed, KASP primers with clear typing and few mismatches were selected as primers for validation. The allele frequency of each marker was calculated, and the polymorphism information content of each marker was calculated using the formula PIC = 1-∑fi2. KASP primers with good specificity, high sensitivity, and good reproducibility for polymorphisms between the parents were screened. The F2 population was genotyped, and the fluorescence typing results of the primers in the population were counted. The correlation between the genotype and phenotype of the markers in the candidate interval was analyzed by combining field phenotypic data and marker typing data. Three sets of sequencing primers for tightly linked KASP markers were developed, as follows:

[0076] Specific primers for the MS20075506 molecular marker: forward primer F1 SEQ ID NO: 51 is GAAGGTGACCAAGTTCATGCTccatacccaacagatcaaacaattgG, forward primer F2 SEQ ID NO: 52 is GAAGGTCGGAGTCAACGGATTccatacccaacagatcaaacaattgT, reverse primer R SEQ ID NO: 53 is ccaatgacagtggcaatggtagaattac;

[0077] Specific primers for the MS20576810 molecular marker: forward primer F1 SEQ ID NO: 54 is GAAGGTGACCAAGTTCATGCTactgaaaattggtcgtctctccattG, forward primer F2 SEQ ID NO: 55 is GAAGGTCGGAGTCAACGGATTactgaaaattggtcgtctctccattT, reverse primer R SEQ ID NO: 56 is gtgggatggtcgtctcttgatgtattatt;

[0078] Specific primers for the MS20597564 molecular marker: forward primer F1 SEQ ID NO: 57 is GAAGGTGACCAAGTTCATGCTgaggatacgaaatggattccagaagA, forward primer F2 SEQ ID NO: 58 is GAAGGTCGGAGTCAACGGATTgaggatacgaaatggattccagaagC, and reverse primer R SEQ ID NO: 59 is aaaatcgtatcccagacgtgtcctg.

[0079] If the genotypes detected by KASP molecular markers MS20075506, MS20576810 and MS20597564 are TT, GG and AA respectively, it is determined to be a fully female bitter melon variety; if they are TG, GT and CA respectively, it is determined to be a strong female and non-strong female bitter melon variety; if they are GG, TT and CC respectively, it is determined to be a weak female bitter melon variety. The typing results of the above three groups of KASP markers are clear and consistent with the SNP detection results ( Figure 1 ).

[0080] (6) Verification of correlation with bitter melon type

[0081] Three KASP markers (MS20075506, MS20576810, and MS20597564) were developed and tested in 235 F2 families. PCR product sequencing revealed that 229, 225, and 220 families, respectively, shared the same genotypes with the parents. Field phenotypic analysis revealed that genotype and phenotype were consistent in 224, 222, and 218 families, respectively. Therefore, the accuracy rates of the KASP markers (MS20075506, MS20576810, and MS20597564) were 97.8%, 98.7%, and 99.1%, respectively. This demonstrates that the three KASP markers have high detection rates and are capable of accurately identifying bitter melon sex types and are suitable for bitter melon sex type breeding.

[0082] From the above examples, it can be seen that the KASP molecular markers MS20075506, MS20576810 and MS20597564, which are tightly linked to the sex of bitter melon, provided by the present invention, can all be used to identify the sex of bitter melon with a high detection rate. At the same time, the KASP molecular marker identification method described in the present invention has the characteristics of simple operation, low cost, strong specificity and high stability.

[0083] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A primer set for detecting a KASP molecular marker tightly linked to the sex of bitter melon, characterized in that: The primer set is any one of the KASP primer sets for detecting bases 20075506, 20576810, and 20597564 of the bitter melon gene on chromosome 1; The KASP primer set for base 20075506 includes a forward primer F1 having a sequence as shown in SEQ ID NO: 28, a forward primer F2 having a sequence as shown in SEQ ID NO: 29, and a reverse primer R having a sequence as shown in SEQ ID NO: 30; The KASP primer set for base 20576810 includes a forward primer F1 having a sequence as shown in SEQ ID NO: 37, a forward primer F2 having a sequence as shown in SEQ ID NO: 38, and a reverse primer R having a sequence as shown in SEQ ID NO: 39; The KASP primer set for base 20597564 includes a forward primer F1 having a sequence as shown in SEQ ID NO:40, a forward primer F2 having a sequence as shown in SEQ ID NO:41, and a reverse primer R having a sequence as shown in SEQ ID NO:

42.

2. A sequencing primer set for detecting KASP molecular markers closely linked to the sex of bitter melon, characterized in that: The sequencing primer set is any one of the KASP sequencing primer sets for bases 20075506, 20576810, and 20597564 of the bitter melon gene on chromosome 1; The KASP sequencing primer set for base 20075506 is obtained by connecting a first sequencing adapter and a second sequencing adapter to the forward primer F1 and the forward primer F2 of the KASP primer set for base 20075506 of claim 1, respectively; The KASP sequencing primer set for base 20576810 is obtained by connecting a first sequencing adapter and a second sequencing adapter to the forward primer F1 and the forward primer F2 of the KASP primer set for base 20576810 of claim 1, respectively; The KASP sequencing primer set at base 20597564 is prepared by connecting a first sequencing adapter and a second sequencing adapter to the forward primer F1 and the forward primer F2 of the KASP primer set at base 20597564 of claim 1, respectively; The 5' ends of the first sequencing adapter and the second sequencing adapter are respectively connected to different fluorescent groups; the sequence of the first sequencing adapter is shown in SEQ ID NO: 49, and the sequence of the second sequencing adapter is shown in SEQ ID NO:

50.

3. A kit for identifying the sex of bitter melon, characterized in that The method comprises the KASP molecular marker primer set according to claim 1 or the sequencing primer set according to claim 2.

4. The kit according to claim 3, wherein The kit also includes a detection reagent.

5. Use of the KASP molecular marker primer set according to claim 1, the sequencing primer set according to claim 2, or the kit according to claim 3 in sex identification of bitter melon.

6. Use of the KASP molecular marker primer set according to claim 1, the sequencing primer set according to claim 2, or the kit according to claim 3 in improving and breeding female lines of bitter melon.

7. A method for identifying the sex of bitter melon using KASP molecular markers, characterized in that: The steps include: (1) using momordica charantia genomic DNA as a template and performing a PCR amplification reaction using the sequencing primer set described in claim 2 to obtain an amplified product; (2) Detecting the amplified products: When the genotypes of the 20075506th, 20576810th, and 20597564th positions of the KASP molecular markers detected are TT, GG, and AA, respectively, the variety is determined to be an all-female bitter melon variety; When the genotypes of the 20075506th, 20576810th and 20597564th positions of the KASP molecular markers detected are TG, GT and CA respectively, the bitter melon variety is determined to be gynoecium or non-gynoecium; When the genotypes of the 20075506th, 20576810th and 20597564th positions of the KASP molecular marker detected are GG, TT and CC respectively, it is determined to be a weak-female bitter melon variety.

Images