A biomarker for predicting the efficacy and judging the prognosis of liver cancer immunotherapy and its application

Abstract

The present invention relates to the field of biotechnology and discloses a biomarker for predicting the efficacy and prognosis of liver cancer immunotherapy and its application, including the application of a circRNA biomarker in the preparation of a product for predicting the efficacy and prognosis of liver cancer immunotherapy. The circRNA biomarker is circPRDM4, and its nucleic acid sequence is as shown in SEQ ID NO.1; the circPRDM4 is located in exons 6 to 8 of the PRDM4 gene; the circPRDM4 can recruit HIF-1α to the CD274 promoter region and increase the transcriptional activation of CD274 mediated by HIF-1α. The present invention constructs a hypoxia-related circular RNA profile of liver cancer by high-throughput sequencing and detects the expression of circPRDM4 in the hypoxic microenvironment of liver cancer by RT-qPCR; the hypoxia-related circular RNA circPRDM4 can play a scaffolding function, promote the transcription of PD-L1 by HIF-1α, and thus promote the immune escape of liver cancer cells; circPRDM4 is expected to be used as a biomarker and treatment strategy for liver cancer immunotherapy, providing a molecular target for targeting and regulating the role of hypoxia in the immunosuppressive microenvironment of liver cancer.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a biomarker for predicting the efficacy and judging the prognosis of liver cancer immunotherapy and its application. Background Art

[0002] Hepatocellular carcinoma is the sixth most common cancer and the fourth leading cause of cancer-related death worldwide. More than half of liver cancer patients are in the advanced stage at the time of diagnosis and are not eligible for hepatectomy or liver transplantation. Immunotherapy can normalize the immune response in the tumor microenvironment and has greatly changed the pattern of cancer treatment. PD-L1 on tumor cells can bind to PD-1 on immune cells, promoting tumor immune escape. PD-1 / PD-L1 monoclonal antibodies can promote the immune killing effect mediated by CD8+ T cells and have broad application prospects in clinical practice. In the treatment of advanced liver cancer, PD-1 monoclonal antibodies showed significant survival benefits in previous clinical trials but did not reach the trial endpoints in phase III clinical trials. Therefore, understanding the underlying mechanisms of PD-1 / PD-L1 dysregulation is crucial for improving the efficacy of liver cancer immunotherapy.

[0003] Hypoxia is a common feature of tumors. The adaptive response of cells to hypoxia is involved in multiple aspects of tumor progression, especially anti-tumor immunity. Hypoxia plays an important role in regulating the efficacy of PD-1 / PD-L1 monoclonal antibodies. In hypoxic tumor cells, HIF-1α can transcriptionally activate the CD274 gene encoding PD-L1, leading to the avoidance of tumor cells being killed by CD8+ T cells. Hypoxia leads to an increase in HIF-1α-induced PD-L1 expression and inhibits T cell activation. Therefore, studying anti-tumor immunity under hypoxic conditions can assist in the development of new strategies for liver cancer immunotherapy.

[0004] Circular RNAs are a class of RNAs with a covalently closed circular structure. These RNAs lack 5' or 3' ends and can resist the action of RNA exonucleases, making them potential biomarker and therapeutic target candidate molecules. Circular RNAs play regulatory functions in a variety of biological processes. Studies have shown that circular RNA dysregulation plays an important role in PD-1 / PD-L1-mediated anti-cancer immunity. The circIGF2BP3 / PKP3 axis promotes lung cancer cell immune escape through PD-L1 deubiquitination. circBART2.2 promotes PD-L1 transcription by binding to RIG-I, leading to nasopharyngeal carcinoma immune escape. circDLG1 binds to miR-141-3p and upregulates CXCL12 expression, promoting gastric cancer resistance to PD-1 monoclonal antibody treatment. However, the role of circular RNAs in liver cancer immune escape remains unclear.

[0005] The present invention provides a hypoxia-related circular RNA, circPRDM4, which can enhance the immune escape of liver cancer cells under hypoxic conditions. Mechanistically, circPRDM4 can recruit HIF-1α to the CD274 promoter region, increasing HIF-1α-mediated transcriptional activation of CD274. circPRDM4 can increase the expression level of PD-L1 in tumor cells, inhibit the infiltration of CD8+ T cells, and promote the immune escape of liver cancer. Summary of the Invention

[0006] To solve the technical problem that the role of circular RNA in the immune escape of liver cancer remains unclear, the present invention provides a biomarker for predicting the efficacy and prognosis of liver cancer immunotherapy and its application.

[0007] The present invention is achieved by the following technical solutions: The application of a circRNA biomarker in the preparation of a product for predicting the efficacy and prognosis of liver cancer immunotherapy, wherein the circRNA biomarker is circPRDM4, and its nucleic acid sequence is as shown in SEQ ID NO.1.

[0008] Further, the circPRDM4 is located in exons 6 to 8 of the PRDM4 gene.

[0009] Further, the circPRDM4 can recruit HIF-1α to the CD274 promoter region, increasing HIF-1α-mediated transcriptional activation of CD274.

[0010] Further, the circPRDM4 can increase the expression level of PD-L1 in tumor cells, inhibit the infiltration of CD8+ T cells, and promote the immune escape of liver cancer.

[0011] A biological product for predicting the efficacy and prognosis of liver cancer immunotherapy prepared with a circRNA biomarker, comprising the circPRDM4.

[0012] Further, the biological product includes: reagents, kits, and chips.

[0013] A primer pair for detecting a circRNA biomarker, including: the hsa_circ_0007468 primer pair, wherein the upstream primer of the hsa_circ_0007468 primer pair is as shown in SEQ ID NO:2, and the downstream primer of the hsa_circ_0007468 primer pair is as shown in SEQ ID NO:3.

[0014] The application of the primer pair in predicting the efficacy and prognosis of liver cancer immunotherapy.

[0015] A method for predicting the efficacy and judging the prognosis of liver cancer immunotherapy, detecting the expression level of the circRNA biomarker.

[0016] Further, the detection is carried out using the primer pair.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0018] The present invention constructs a hypoxia-related circular RNA profile of liver cancer through high-throughput sequencing, and uses RT-qPCR to detect the expression of circPRDM4 in the hypoxia microenvironment of liver cancer; the hypoxia-related circular RNA circPRDM4 can play a scaffolding function, promote the transcription of PD-L1 by HIF-1α, thereby promoting the immune escape of liver cancer cells; circPRDM4 is expected to be used as a biomarker and treatment strategy for liver cancer immunotherapy, providing a molecular target for targeting and regulating the role of hypoxia in the immunosuppressive microenvironment of liver cancer. Description of the Drawings

[0019] Figure 1 It is a differentially expressed circular RNA profile of hepatocellular carcinoma tissue after hypoxia treatment with 1% oxygen, where:

[0020] Figure 1 A is a heat map of circular RNA sequencing of the liver cancer cell line HCCLM3 under normoxia and hypoxia treatment.

[0021] Figure 1 B is a PCR verification of the top 5 circular RNAs with the highest differential degree after hypoxia treatment.

[0022] Figure 1 C is the PCR detection result of the expression level of hsa_circ_0007468 in 7 liver cancer cell lines under hypoxia.

[0023] Figure 1 D is a schematic diagram of the reverse splicing site of circP, RDM4 (hsa_circ_0007468).

[0024] Figure 1 E is a result diagram of amplifying circPRDM4 and GAPDH from cDNA and gDNA using forward primers and reverse primers respectively.

[0025] Figure 1 F is a result diagram of detecting circPRDM4 and PRDM4 mRNA using random primers (a mixture of 6-mer deoxyribonucleic acids composed of random sequences) and oligo dT primers.

[0026] Figure 1Figure G shows the PCR detection results of the expression levels of circPRDM4 and PRDM4 mRNA after treatment with RNaseR.

[0027] Figure 1 Figure H shows the detection results of the expression levels of circPRDM4 and PRDM4 mRNA at different time points after treating the MHCC97H cell line with the transcriptional inhibitor actinomycin D.

[0028] Figure 1 Figure I shows the detection results of the expression levels of circPRDM4 and PRDM4 mRNA at different time points after treating the Hep3B cell line with the transcriptional inhibitor actinomycin D.

[0029] Figure 1 Figure J is the fluorescence in situ hybridization experimental figure of liver cancer cells to determine the localization of circPRDM4 in cells.

[0030] Figure 1 Figure K shows the results of detecting that circPRDM4 is mainly located in the nucleus after separating the cytoplasmic and nuclear fractions of liver cancer cells.

[0031] Figure 2 These are the result graphs showing the correlation between the expression level of circPRDM4 and the efficacy of PD-1 monoclonal antibody in liver cancer patients. Among them:

[0032] Figure 2 Figure A shows the imaging results before and after treatment of responders and non-responders among advanced liver cancer patients receiving PD-1 monoclonal antibody treatment.

[0033] Figure 2 Figure B shows the PCR detection graph of the expression level of circPRDM4 in tumor tissues of responders and non-responders.

[0034] Figure 2 Figure C shows the schematic diagram of the degree of change in tumor diameter of the patients included in the study.

[0035] Figure 2 Figure D shows the correlation graph between the expression level of circPRDM4 and the degree of increase in tumor diameter.

[0036] Figure 2 Figure E shows the immunofluorescence results of CD8+ cell infiltration in tumor tissues of patients in the high circPRDM4 expression group and the low circPRDM4 expression group.

[0037] Figure 2 Figure F shows the correlation graph between the expression level of circPRDM4 and the expression level of CD274.

[0038] Figure 2G is the survival curve of the progression-free survival time of advanced liver cancer patients in the high-circPRDM4 expression group and the low-circPRDM4 expression group who received anti-PD-1 monoclonal antibody therapy.

[0039] Figure 2 H is the survival curve of the overall survival time of advanced liver cancer patients in the high-circPRDM4 expression group and the low-circPRDM4 expression group who received anti-PD-1 monoclonal antibody therapy.

[0040] Figure 3 It is the result map of knocking down the circPRDM4 expression level to inhibit the PD-L1 expression of liver cancer cells under hypoxia and promote the anti-tumor immune response mediated by CD8+ T cells, where:

[0041] Figure 3 A is the PCR result map of detecting the circPRDM4 expression level after knocking down the circPRDM4 expression by shRNA technology in the MHCC97H liver cancer cell line.

[0042] Figure 3 B is the PCR result map of detecting the circPRDM4 expression level after knocking down the circPRDM4 expression by shRNA technology in the HCCLM3 liver cancer cell line.

[0043] Figure 3 C is the result map of the effect on the PRDM4 mRNA expression level after knocking down circPRDM4 in the MHCC97H and HCCLM3 liver cancer cell lines.

[0044] Figure 3 D is the PCR detection result map of the CD274 mRNA expression level after knocking down circPRDM4 in the MHCC97H and HCCLM3 liver cancer cell lines.

[0045] Figure 3 E is the western blotting detection result map of the total PD-L1 protein expression level of MHCC97H and HCCLM3 cells in the circPRDM4 knockdown group after hypoxia treatment.

[0046] Figure 3 F is the flow cytometry detection result map of the PD-L1 protein level on the surface of liver cancer cells of MHCC97H and HCCLM3 cells in the circPRDM4 knockdown group after hypoxia treatment.

[0047] Figure 3 G is the result map that tumor cells are more easily killed by T cells after knocking down circPRDM4 in the T cell-mediated tumor cell killing experiment.

[0048] Figure 3Figure H shows the results of detecting the level of lactate dehydrogenase release, indicating that the cytotoxicity of hepatocellular carcinoma cells in the circPRDM4 knockdown group is higher.

[0049] Figure 3 Figure I shows the results of detecting the levels of TNF-α and IFN-γ in the supernatant of cells in the circPRDM4 knockdown group after co-culture with T cells.

[0050] Figure 4 The figure shows the results of overexpressing the circPRDM4 expression level to promote the expression of PD-L1 in hepatocellular carcinoma cells under hypoxia and inhibit the anti-tumor immune response mediated by CD8+ T cells, where:

[0051] Figure 4 Figure A shows the PCR results of detecting the circPRDM4 expression level after overexpressing circPRDM4 in the Hep3B hepatocellular carcinoma cell line.

[0052] Figure 4 Figure B shows the PCR results of detecting the circPRDM4 expression level after overexpressing circPRDM4 in the HepG2 hepatocellular carcinoma cell line.

[0053] Figure 4 Figure C shows the results of the effect of overexpressing circPRDM4 on the PRDM4 mRNA expression level in the Hep3B and HepG2 hepatocellular carcinoma cell lines.

[0054] Figure 4 Figure D shows the PCR detection results of the CD274 mRNA expression level after overexpressing circPRDM4 in the Hep3B and HepG2 hepatocellular carcinoma cell lines.

[0055] Figure 4 Figure E shows the western blotting detection results of the total PD-L1 protein expression level in Hep3B and HepG2 cells in the circPRDM4 overexpression group after hypoxia treatment.

[0056] Figure 4 Figure F shows the flow cytometry detection results of the PD-L1 protein level on the surface of hepatocellular carcinoma cells in the circPRDM4 overexpression group of Hep3B and HepG2 cells after hypoxia treatment.

[0057] Figure 4 Figure G shows the results that tumor cells are not easily killed by T cells after overexpressing circPRDM4 in the T cell-mediated tumor cell killing experiment.

[0058] Figure 4 Figure H shows the results of detecting the level of lactate dehydrogenase release, indicating that the cytotoxicity of hepatocellular carcinoma cells in the circPRDM4 overexpression group is lower.

[0059] Figure 4 Figure I shows the detection results of TNF-α and IFN-γ levels in the supernatant of cells in the circPRDM4 overexpression group after co-culture with T cells.

[0060] Figure 5 The following is the result atlas showing that circPRDM4 can promote the proliferation and immune escape of liver cancer in the in vivo model:

[0061] Figure 5 A shows a schematic diagram of the construction of a human-derived patient-derived xenograft (PDX) mouse model.

[0062] Figure 5 B shows the gross specimens of xenografts in the circPRDM4 overexpression group, knockdown group, and corresponding control groups.

[0063] Figure 5 C shows the weights of xenografts in the circPRDM4 overexpression group and the control group.

[0064] Figure 5 D shows the weights of xenografts in the circPRDM4 knockdown group and the control group.

[0065] Figure 5 E shows the volume curve graphs of xenografts in the circPRDM4 overexpression group and the control group.

[0066] Figure 5 F shows the volume curve graphs of xenografts in the circPRDM4 knockdown group and the control group.

[0067] Figure 5 G shows the PCR detection results of the expression level of circPRDM4 in xenografts in the circPRDM4 overexpression group and the control group.

[0068] Figure 5 H shows the PCR detection results of the expression level of circPRDM4 in xenografts in the circPRDM4 knockdown group and the control group.

[0069] Figure 5 I shows the PCR detection results of the expression level of CD274 in xenografts in the circPRDM4 overexpression group and the control group.

[0070] Figure 5 J shows the PCR detection results of the expression level of CD274 in xenografts in the circPRDM4 knockdown group and the control group.

[0071] Figure 5K is the CD8 immunofluorescence staining map of transplanted tumors in the circPRDM4 overexpression group, knockdown group and corresponding control groups.

[0072] Figure 6 It is the result map of circPRDM4 binding and recruiting HIF-1α to the CD274 promoter region to promote PD-L1 transcription, where:

[0073] Figure 6 A is the mass spectrometry map of HIF-1α.

[0074] Figure 6 B is the western blotting result map of circRNA pull-down.

[0075] Figure 6 C is the fluorescence result map indicating the co-localization of circPRDM4 and HIF-1α.

[0076] Figure 6 D is the statistical chart of the RNA immunoprecipitation experiment results verifying that circPRDM4 can bind to HIF-1α.

[0077] Figure 6 E is the schematic diagram of the secondary structure of circPRDM4 constructed using the RNAfold algorithm.

[0078] Figure 6 F is the result map of the RNA pull-down experiment showing that P1 of circPRDM4 can bind to HIF-1α.

[0079] Figure 6 G is the schematic diagram of constructing the Flag-tagged bHLH, Flag-tagged PAS and Flag-tagged TAD domains of HIF-1α.

[0080] Figure 6 H is the RNA immunoprecipitation result map showing that circPRDM4 can bind to the bHLH domain of HIF-1α.

[0081] Figure 6 I is the western blotting detection map of the HIF-1α protein expression levels in the circPRDM4 knockdown group and the control group.

[0082] Figure 6 J is the western blotting detection map of the HIF-1α protein expression levels in the circPRDM4 overexpression group and the control group.

[0083] Figure 6Figure K is a statistical chart of the ChIP experiment results showing the different segments of the CD274 promoter region that HIF-1α can bind to.

[0084] Figure 6 Figure L is a statistical chart of the ChIP experiment results showing the binding degree of HIF-1α to the -21bp to -12bp segment of the wild-type and mutant CD274 promoter regions.

[0085] Figure 6 Figure M is a statistical chart of the ChIP experiment results showing the binding degree of HIF-1α to the CD274 promoter after knocking down circPRDM4.

[0086] Figure 6 Figure N is the result diagram of the luciferase reporter gene experiment. Detailed implementation manners

[0087] Next, in combination with the accompanying drawings and specific implementation manners, the present invention will be further described. It should be noted that, on the premise of no conflict, any combination can be formed among the following-described embodiments or technical features to form new embodiments.

[0088] Example 1:

[0089] Please refer to Figure 1 , after the hepatocellular carcinoma cell line HCCLM3 is treated with normoxia and hypoxia, circular RNA sequencing is performed to identify hypoxia-related circular RNAs in hepatocellular carcinoma. Compared with the normoxia control group, a total of 103 circular RNAs showed more than 2-fold expression differences after hypoxia treatment, as shown in Figure 1 A.

[0090] By performing PCR verification on the top 5 circular RNAs with the highest expression differences, we found that hsa_circ_0007468 had the most obvious expression differences in HCCLM3 cell lines under hypoxia and normoxia, as shown in Figure 1 B.

[0091] By detecting the expression level of hsa_circ_0007468 in hepatocellular carcinoma cell lines under hypoxia, hsa_circ_0007468 had a higher expression in MHCC97H and HCCLM3 cell lines and a lower expression in Hep3B and HepG2 cell lines, as shown in Figure 1 C.

[0092] hsa_circ_0007468 is derived from exons 6 to 8 of the PRDM4 gene and is named circPRDM4. The sequence of circPRDM4 is as follows:

[0093] GGTGTACTCTGTGTGACCGCGCCTATCCCTCGGACTGTCCCGAACATGGACCAGTGACTTTTGT

[0094] TCCTGACACTCCAATAGAGAGCAGAGCAAGGCTTTCTCTCCCAAAGCAGCTTGTTCTCCGTCAGTCAA

[0095] TTGTGGGAGCAGAAGTTGGTGTATGGACTGGAGAAACCATTCCTGTGCGGACTTGCTTTGGACCTCTA

[0096] ATTGGCCAGCAGAGTCACTCCATGGAAGTAGCAGAATGGACAGACAAGGCAGTTAACCATATCTGGAA

[0097] GATATACCACAATGGTGTCCTAGAATTCTGCATCATTACAACTGATGAAAATGAATGTAATTGGATGA

[0098] TGTTTGTGCGCAAAGCCAG。

[0099] The back-splicing site of circPRDM4 is as Figure 1 shown in D.

[0100] circPRDM4 can be amplified from cDNA by reverse primers, but not from gDNA, as Figure 1 shown in E.

[0101] Performing PCR with oligodT primers showed that circPRDM4 could not be amplified by oligodT primers, while linear PRDM4 mRNA with a polyA tail could be amplified by oligodT primers, indicating that circPRDM4 lacks a polyA tail, as Figure 1 shown in F.

[0102] Compared with the linear mRNA of PRDM4, circPRDM4 is insensitive to RNaseR-induced degradation, as Figure 1 shown in G.

[0103] In the MHCC97H cell line, after treatment with the transcription inhibitor actinomycin D, circPRDM4 is more stable than linear PRDM4 mRNA, as Figure 1 shown in H.

[0104] After treating the Hep3B cell line with the transcriptional inhibitor actinomycin D, circPRDM4 was more stable than linear PRDM4 mRNA, as Figure 1 shown in

[0105] Figure I. Figure 1 The results of fluorescence in situ hybridization experiments showed that circPRDM4 was mainly located in the nucleus, as

[0106] shown in Figure 1 Figure J.

[0107] Example 2:

[0108] Please combine Figure 2 and analyze the clinical data of advanced liver cancer patients receiving anti-PD-1 monoclonal antibody treatment. Compared with the pre-treatment imaging results, the tumor lesions of responders significantly decreased, while those of non-responders significantly increased compared with before. The pre-treatment and post-treatment imaging results of responders and non-responders are shown in Figure 2 Figure A.

[0109] The expression level of circPRDM4 in the tumor tissue of responders was significantly higher than that of non-responders, as Figure 2 shown in

[0110] Among the 20 included patients, the tumor lesions of 10 patients increased in diameter compared with before, and those of 10 patients decreased. Among them, 30% of the patients in the high circPRDM4 expression group had an increase in tumor diameter compared with before, and 70% of the patients in the low circPRDM4 expression group had an increase in tumor diameter. The degree of change in tumor diameter of the included patients is shown in Figure 2 Figure C.

[0111] There was a negative correlation between the expression level of circPRDM4 and the degree of increase in tumor diameter, as Figure 2 shown in

[0112] Compared with patients with low circPRDM4 expression levels, the infiltration degree of CD8+ cells in the tumor tissue of patients with high circPRDM4 expression levels decreased, as Figure 2 shown in

[0113] There was a positive correlation between the expression level of circPRDM4 and the expression level of CD274, as Figure 2 shown in

[0114] In advanced liver cancer patients receiving anti-PD-1 monoclonal antibody treatment, high circPRDM4 expression levels indicated longer progression-free survival time, as Figure 2 shown in

[0115] In advanced liver cancer patients receiving PD-1 monoclonal antibody treatment, high circPRDM4 expression levels indicate longer overall survival, as Figure 2 shown in H.

[0116] Example 3:

[0117] Please combine Figure 3 , and through shRNA technology, knockdown of circPRDM4 expression was performed in the MHCC97H liver cancer cell line. Compared with the control group of MHCC97H cells, the circPRDM4 expression level in the circPRDM4 knockdown group of MHCC97H cells was significantly reduced, as Figure 3 shown in A.

[0118] Through shRNA technology, knockdown of circPRDM4 expression was performed in the HCCLM3 liver cancer cell line. Compared with the control group of HCCLM3 cells, the circPRDM4 expression level in the circPRDM4 knockdown group of HCCLM3 cells was significantly reduced, as Figure 3 shown in B.

[0119] In the circPRDM4 knockdown group and the control group of cells, there was no obvious difference in the PRDM4mRNA expression level, as Figure 3 shown in C.

[0120] After hypoxia treatment, the CD274mRNA expression level in the circPRDM4 knockdown group of cells was significantly reduced, as Figure 3 shown in D.

[0121] The total PD-L1 protein expression level in the circPRDM4 knockdown group of cells was significantly downregulated after hypoxia treatment, as Figure 3 shown in E.

[0122] Using flow cytometry analysis, knockdown of circPRDM4 can reduce the PD-L1 protein level on the surface of liver cancer cells, as Figure 3 shown in F.

[0123] In the T cell-mediated tumor cell killing experiment, knockdown of circPRDM4 can make tumor cells more easily killed by T cells, as Figure 3 shown in G.

[0124] By detecting the lactate dehydrogenase release level, the cytotoxicity of the liver cancer cells in the circPRDM4 knockdown group was higher, as Figure 3 shown in H.

[0125] After co - culturing with T cells, the levels of TNF - α and IFN - γ in the supernatant of cells in the circPRDM4 knockdown group were up - regulated, as Figure 3 shown in

[0126] Example 4:

[0127] Please combine Figure 4 to over - express circPRDM4 in the Hep3B hepatocellular carcinoma cell line, and verify its over - expression efficiency by PCR. The PCR results showed that compared with the control group of Hep3B cells, the expression level of circPRDM4 in Hep3B cells of the circPRDM4 expression group was significantly increased, as Figure 4 shown in

[0128] Detect the over - expression efficiency of circPRDM4 in the HepG2 cell line by PCR. The PCR results showed that compared with the control group of HepG2 cells, the expression level of circPRDM4 in HepG2 cells of the circPRDM4 expression group was significantly increased, as Figure 4 shown in

[0129] In the circPRDM4 over - expression group and the control group of cells, there was no obvious difference in the expression level of PRDM4 mRNA, as Figure 4 shown in

[0130] After hypoxia treatment, the expression level of CD274 mRNA in cells of the circPRDM4 over - expression group was significantly increased, as Figure 4 shown in

[0131] After hypoxia treatment, the total PD - L1 protein expression level in hepatocellular carcinoma cells of the circPRDM4 over - expression group was significantly up - regulated, as Figure 4 shown in

[0132] Using flow cytometry analysis, over - expression of circPRDM4 could increase the level of PD - L1 protein on the surface of hepatocellular carcinoma cells, as Figure 4 shown in

[0133] In the T - cell - mediated tumor cell killing experiment, over - expression of circPRDM4 could make tumor cells less likely to be killed by T cells, as Figure 4 shown in

[0134] By detecting the release level of lactate dehydrogenase, the cytotoxicity of hepatocellular carcinoma cells with over - expression of circPRDM4 was lower, as Figure 4 shown in

[0135] After co - culturing with T cells, the levels of TNF - α and IFN - γ in the supernatant of cells in the circPRDM4 over - expression group were decreased, asFigure 4 as shown in I.

[0136] Example 5:

[0137] Please refer to Figure 5 , to detect the role of circPRDM4 in the proliferation and immune escape of liver cancer in the in vivo environment, adoptive transfer of tumor-infiltrating CD8+ T cells was performed into an immunodeficient liver cancer PDX mouse model to construct a humanized mouse model as shown in Figure 5 A.

[0138] Gross specimens of transplanted tumors in the circPRDM4 overexpression group, knockdown group and corresponding control group are as shown in Figure 5 B. The tumors in the circPRDM4 overexpression group were larger than those in the control group, and the tumor volume in the circPRDM4 knockdown group was smaller than that in the control group.

[0139] The weights of transplanted tumors in the circPRDM4 overexpression group and the control group are as shown in Figure 5 C. The weight of the transplanted tumor in the circPRDM4 overexpression group was greater than that in the control group.

[0140] The weights of transplanted tumors in the circPRDM4 knockdown group and the control group are as shown in Figure 5 D. The weight of the transplanted tumor in the circPRDM4 knockdown group was smaller than that in the control group.

[0141] The tumor volume curves of transplanted tumors in the circPRDM4 overexpression group and the control group are as shown in Figure 5 E. The tumor volume of the transplanted tumor in the circPRDM4 overexpression group was greater than that in the control group.

[0142] The tumor volume curves of transplanted tumors in the circPRDM4 knockdown group and the control group are as shown in Figure 5 F. The tumor volume of the transplanted tumor in the circPRDM4 knockdown group was smaller than that in the control group.

[0143] The expression levels of circPRDM4 in transplanted tumors of the circPRDM4 overexpression group and the control group are as shown in Figure 5 G. The expression level of circPRDM4 in the transplanted tumors of the circPRDM4 overexpression group was higher than that in the control group.

[0144] The expression levels of circPRDM4 in transplanted tumors of the circPRDM4 knockdown group and the control group are as shown in Figure 5 H. The expression level of circPRDM4 in the transplanted tumors of the circPRDM4 knockdown group was lower than that in the control group.

[0145] The expression levels of CD274 in transplanted tumors of the circPRDM4 overexpression group and the control group are as shown in Figure 5As shown in Figure I, the expression level of CD274 in the transplanted tumors of the circPRDM4 overexpression group was higher than that in the control group.

[0146] As shown in Figure J, the expression level of CD274 in the transplanted tumors of the circPRDM4 knockdown group and the control group was as follows. Figure 5 The expression level of CD274 in the transplanted tumors of the circPRDM4 knockdown group was lower than that in the control group.

[0147] As shown in Figure K, the CD8 immunofluorescence staining of the transplanted tumors in the circPRDM4 overexpression group, knockdown group and the corresponding control groups was as follows. Figure 5 The infiltration degree of CD8+ cells in the circPRDM4 overexpression group was lower than that in the control group, and the infiltration degree of CD8+ cells in the circPRDM4 knockdown group was higher than that in the control group.

[0148] Example 6:

[0149] Please combine with Figure 6 Using the circRNA pull-down combined with mass spectrometry technology, circPRDM4 can bind to HIF-1α. The mass spectrometry results of HIF-1α are shown in Figure A. Figure 6

[0150] The Western blotting results verified that circPRDM4 can bind to HIF-1α, as shown in Figure B. Figure 6

[0151] The fluorescence results indicated that circPRDM4 and HIF-1α were co-localized, as shown in Figure C. Figure 6

[0152] The RNA immunoprecipitation experiment further verified that circPRDM4 can bind to HIF-1α, as shown in Figure D. Figure 6

[0153] Using the RNAfold algorithm to construct the secondary structure of circPRDM4, it was suggested that circPRDM4 has three stem-loop structures P1, P2 and P3, as shown in Figure E. Figure 6

[0154] The RNA pull-down experiment showed that P1 of circPRDM4 can bind to HIF-1α, as shown in Figure F. Figure 6

[0155] By constructing the Flag-tagged bHLH, Flag-tagged PAS and Flag-tagged TAD domains of HIF-1α, as shown in Figure G. Figure 6

[0156] ​​​​​​​Using RNA immunoprecipitation, it was found that circPRDM4 could bind to the bHLH domain of HIF-1α, as Figure 6 shown in H.

[0157] Through western blotting experiments, knockdown of circPRDM4 had no obvious effect on the protein expression level of HIF-1α, as Figure 6 shown in I.

[0158] The results of western blotting experiments showed that overexpression of circPRDM4 had no obvious effect on the protein expression level of HIF-1α, as Figure 6 shown in J.

[0159] Through ChIP experiments, HIF-1α could bind to the -500bp to 0bp segment of the CD274 promoter region, as Figure 6 shown in K.

[0160] ChIP experiments further verified that HIF-1α could bind to the -21bp to -12bp segment of the CD274 promoter region, as Figure 6 shown in L.

[0161] After knockdown of circPRDM4, the degree of binding of HIF-1α to the CD274 promoter was downregulated, suggesting that knockdown of circPRDM4 could reduce the binding strength of HIF-1α to the CD274 promoter, as Figure 6 shown in M.

[0162] Luciferase reporter gene experiments showed that compared with the control group, overexpression of HIF-1α could increase the transcriptional activity of the CD274 promoter, while overexpression of circPRDM4 alone could not have an obvious effect on the transcriptional activity of the CD274 promoter, suggesting that circPRDM4 promoted CD274 transcription by promoting the binding of HIF-1α to the CD274 promoter, as Figure 6 shown in N.

[0163] Example 7:

[0164] Definition of normoxia and hypoxia

[0165] Normoxia conditions were defined as culturing cells under conditions of 21% O2, 5% CO2, and 74% N2, and hypoxia conditions were defined as culturing cells under conditions of 1% O2, 5% CO2, and 94% N2.

[0166] Example 8:

[0167] Circular RNA sequencing

[0168] RNA was extracted using TRIzol (Invitrogen) reagent. After detecting the purity and integrity of RNA, rRNA was removed by Epicentre Ribo-Zero rRNA Removal Kit (Illumina), and linear RNA was removed using RNase R (Epicentre Technologies). After enriching circular RNA and adding adapters, the samples were used for cDNA synthesis and sequencing. Circular RNAs were identified by CIRCexplorer2 and CIRI2 algorithms, and significantly differential circular RNAs were determined by DESeq2.

[0169] Example 9:

[0170] Quantitative real-time PCR (RT-qPCR)

[0171] Total RNA extraction was completed using TRIzol (Invitrogen) reagent. For RNase R treatment, total RNA was incubated with RNase R at 37 °C for 20 minutes. The reverse transcription process was completed using PrimeScript RT Master Mix (TaKaRa) kit, and qPCR was completed using TB Green Premix Ex Taq (TaKaRa) kit.

[0172] The primer design sequences are as follows:

[0173] hsa_circ_0000615_F: CAGCGCTCAATCCTTTGGGA

[0174] hsa_circ_0000615_R: GACCTGCCACATTGGTCAGTA

[0175] hsa_circ_0007468_F: GGACAGACAAGGCAGTTAACCATAT hsa_circ_0007468_R: GGTCACACAGAGTACACCCTGG hsa_circ_0138414_F: GGGGCAGCAGTATTGTGAAA

[0176] hsa_circ_0138414_R: AAGACTGTGTGCTCCCCATT

[0177] hsa_circ_0032138_F: AGGACAGTACAGGATGCTTGCC hsa_circ_0032138_R: ATATCCCATCAATTCGGTAATTCTC hsa_circ_0008450_F: TGATGCATCCCATCCACCCT hsa_circ_0008450_R: AGCCCTGCCACTTGTCATTC

[0178] PRDM4_F: CCGGTCGACGAAAACATGCATCACAGGATG

[0179] PRDM4_R: CGCGGATCCGTTATTTATGTGCAGAAAGA

[0180] CD274_F: GCTGCACTAATTGTCTATTGGGA

[0181] CD274_R: AATTCGCTTGTAGTCGGCACC

[0182] HIF1A_F: TCCTTCGGACACATAAGCTCC

[0183] HIF1A_R: GACAGAAAGATCATGTCACCGT

[0184] GAPDH_F: GCATTGCCCTCAACGACCAC

[0185] GAPDH_R: CCACCACCCTGTTGCTGTAG

[0186] U6_F: CTCGCTTCGGCAGCACA

[0187] U6_R: AACGCTTCACGAATTTGCGT

[0188] β-actin_F: TCACCAACTGGGACGACATG

[0189] β-actin_R: GTCACCGGAGTCCATCACGAT

[0190] Example 10:

[0191] Immunofluorescence and fluorescence in situ hybridization

[0192] The cell or tissue sections were fixed, permeabilized, blocked, and then incubated with the primary antibody overnight at 4°C. Subsequently, they were washed three times with PBS at room temperature and incubated with the fluorescent secondary antibody for 30 minutes. After mounting, the samples were observed under a fluorescence microscope. Fluorescence in situ hybridization was performed using a fluorescence in situ hybridization kit according to the instructions. After fixation, permeabilization, and blocking, the samples were incubated with the fluorescent probe overnight, and the cell nuclei were stained with DAPI. Observation and photography were carried out using a fluorescence microscope.

[0193] Example 11:

[0194] Nucleocytoplasmic fractionation experiment

[0195] The separation of nuclear and cytoplasmic components was completed using the PARIS kit (Invitrogen). After washing the cells with PBS, cold lysis buffer was added, and the cells were incubated on ice for 10 minutes. After centrifugation at 4°C for 5 minutes, the nuclear and cytoplasmic fractions were separately extracted for subsequent experiments.

[0196] Example 12:

[0197] Flow cytometry

[0198] The cells were centrifuged at 1000 × g for 5 minutes, incubated with the flow cytometry antibodies in the dark at 4°C for 30 minutes, resuspended with flow cytometry buffer on ice, and then analyzed or sorted using a flow cytometer.

[0199] Example 13:

[0200] T cell-mediated tumor killing experiment

[0201] After activating T cells with CD3 antibody, CD28 antibody, and interleukin-2, they were co-cultured with the liver cancer cell line with knockdown or overexpression of circPRDM4 for 48 hours. After removing the cell culture medium, the adherent liver cancer cells on the bottom of the cell culture dish were stained with crystal violet.

[0202] Example 14:

[0203] Lactate dehydrogenase release assay

[0204] The lactate dehydrogenase release assay was performed using the LDHCytotoxicityAssayKit from Beyotime. The liver cancer cells were seeded into 24-well plates at a density of 4 × 104 cells / well and co-cultured with activated T cells. After centrifuging the cell culture medium, the supernatant was transferred to a new 96-well plate, 60 μL / well of the lactate dehydrogenase detection reagent was added, and the mixture was incubated in the dark for 30 minutes. The absorbance at 490 nm was measured.

[0205] Example 15:

[0206] Enzyme-linked immunosorbent assay

[0207] The levels of TNF-α and IFN-γ produced by cells were detected using the Human TNF-α ELISA Kit and Human IFN-γ ELISA Kit from Linkage Biotechnology, and the absorbance at 450 nm was measured.

[0208] Example 16:

[0209] Animal experiment

[0210] For the PDX mouse model, patient-derived liver cancer cells were inoculated into immunodeficient mice, and tumor-infiltrating lymphocytes were extracted from the patient's liver cancer tissue. CD8+ T cells were obtained by flow sorting, activated, and then infused into the mice. After treating each group of mouse models with overexpressed circPRDM4 plasmid, si-circPRDM4, and corresponding controls for 3 weeks, the mice were sacrificed. The tumor volume and weight were recorded, and the transplanted tumors were collected for subsequent experiments.

[0211] Example 17:

[0212] RNA pull-down and RNA immunoprecipitation

[0213] The RNA pull-down experiment was completed using the Magnetic RNA-protein Pull-down Kit (Thermo Fisher Scientific). After incubating the cell lysate with the probe and beads, the samples were sent for mass spectrometry analysis or western blotting detection. The RNA immunoprecipitation experiment was completed according to the instructions of the Magna RIP RNA-Binding Protein Immunoprecipitation Kit (EMD Millipore).

[0214] Example 18:

[0215] Chromatin immunoprecipitation (ChIP) experiment

[0216] The ChIP experiment was performed according to the instructions of the Pierce Magnetic ChIP Kit (Thermo Fisher Scientific). After cross-linking, lysis, and chromatin fragmentation, the protein-DNA complex was captured and separated by immunoprecipitation. The binding degree between different regions of the CD274 promoter and HIF-1α was detected by RT-qPCR.

[0217] Example 19:

[0218] Luciferase reporter gene assay

[0219] Construct the HIF-1α plasmid, circPRDM4 plasmid, and plasmids containing wild-type or mutant CD274 promoter sequences, and complete the luciferase reporter gene assay according to the instructions of the Dual-Luciferase Reporter Assay System (Promega). The measured values were normalized according to the activity of Renilla luciferase.

[0220] Example 20:

[0221] Statistical analysis

[0222] Differences between groups were compared by Student's t-test. Correlation analysis was tested using Pearson correlation coefficient or Spearman correlation coefficient. Survival analysis was completed by the log-rank test of the Kaplan-Merier survival curve. The statistical analysis process was completed using SPSS software and GraphPad software. A P value < 0.05 was considered statistically significant.

[0223] In summary, the applicant constructed a hypoxia-related circular RNA profile of liver cancer by high-throughput sequencing and detected the expression of circPRDM4 in the hypoxic microenvironment of liver cancer using RT-qPCR; the hypoxia-related circular RNA circPRDM4 can play a scaffolding function to promote the transcription of PD-L1 by HIF-1α, thereby promoting the immune escape of liver cancer cells; circPRDM4 is expected to be used as a biomarker and treatment strategy for liver cancer immunotherapy, providing a molecular target for targeting the regulation of the role of hypoxia in the immunosuppressive microenvironment of liver cancer.

[0224] The above embodiments are only the preferred embodiments of the present invention and cannot be used to limit the scope of protection of the present invention. Any non-substantial changes and substitutions made by those skilled in the art based on the present invention fall within the scope of protection required by the present invention.

Claims

1. Use of a primer pair for detecting circRNA biomarkers in the preparation of a product for predicting the efficacy of liver cancer immunotherapy and judging prognosis, characterized in that, The circRNA biomarker is circPRDM4, and its nucleic acid sequence is as shown in SEQ ID NO.

1.

2. Use of a primer pair for detecting circRNA biomarkers as described in claim 1 in the preparation of a product for predicting the efficacy and judging the prognosis of liver cancer immunotherapy, characterized in that, The circPRDM4 is located in exons 6 to 8 of the PRDM4 gene.

3. Use of a primer pair for detecting circRNA biomarkers according to claim 1 in the preparation of a product for predicting the efficacy and judging the prognosis of liver cancer immunotherapy, characterized in that, The circPRDM4 can recruit HIF-1α to the CD274 promoter region, increasing HIF-1α-mediated transcriptional activation of CD274.

4. Use of a primer pair for detecting circRNA biomarker as described in claim 1 in the preparation of a product for predicting the efficacy of liver cancer immunotherapy and judging prognosis, characterized in that, The circPRDM4 can increase the expression level of PD-L1 in tumor cells, inhibit the infiltration of CD8+ T cells, and promote the immune escape of liver cancer.

5. Use of a primer pair for detecting circRNA biomarker as claimed in claim 1 in the preparation of a product for predicting the efficacy and judging the prognosis of liver cancer immunotherapy, characterized in that The products include: reagents, kits, and chips.

Images