Preparation method and use of a disposable electrochemical sensor for detecting african swine fever virus based on in-situ amplification

Abstract

The application belongs to the field of pig infectious virus detection, and discloses a preparation method and application of a disposable electrochemical sensor for African swine fever virus (ASFV) based on in-situ loop-mediated isothermal amplification (LAMP). The current signal is collected by an electrochemical workstation, and a simple, economical and efficient method is provided for the diagnosis of ASFV. The steps are as follows: step 1, constructing a micro pool; step 2, preparing a modified electrode; step 3, constructing an electrochemical biosensor for detecting ASFV based on loop-mediated isothermal amplification technology; and step 4, electrochemically detecting ASFV. The electrochemical biosensor based on the LAMP strategy is combined with electrochemical detection to replace the traditional fluorescent sensing detection scheme, so that the entire detection system is miniaturized and simplified. In addition, the electrochemical detection method takes the current value as the signal output, has stable performance, realizes sensitive detection of ASFV, and further improves the sensitive detection by electrodepositing gold nanoparticles on the screen-printed electrode.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of pig infectious virus detection, and mainly relates to a disposable electrochemical biosensing detection method for African swine fever virus (ASFV) based on loop-mediated isothermal amplification (LAMP). BACKGROUND

[0002] African swine fever is an acute and highly fatal pig infectious disease caused by ASFV. ASFV cannot be transmitted to humans, but it is very fatal to domestic pigs and various wild pigs. The disease first appeared in Kenya, Africa, in 1921, and since 2007, African swine fever has occurred, spread and spread in many countries and regions of the world. In 2018, China had the first case of African swine fever, and the virus quickly spread to most parts of China. Since there is no effective ASFV vaccine and drug treatment so far, ASFV has caused huge economic losses to the country and the livestock industry, and the situation is very serious. ASFV is a large double-stranded DNA virus with a genome length of about 170-190 kbp, encoding about 150-200 proteins. Studies have found that p54 encoded by E183L gene is an important structural protein of ASFV, which plays an important role in rapid invasion and adsorption of susceptible cells, so detecting p54 has important significance. The most commonly used method to detect p54 at present is enzyme-linked immunosorbent assay, but this method is cumbersome, and has low specificity and sensitivity. Therefore, it is of great value to establish a rapid and sensitive p54 protein ASFV detection method to realize early detection and isolation of ASFV and reduce the loss of the pig industry.

[0003] In recent years, LAMP has attracted widespread attention as a powerful tool for nucleic acid amplification. As a method to replace PCR, LAMP overcomes the shortcomings of traditional PCR. LAMP does not require a thermal cycler device to adjust the temperature for complex temperature change process, and because it uses 4 primers, which can recognize 6-8 independent regions, all of which are specific to the target region, it has high specificity. In addition, under the action of DNA polymerase, LAMP is fast and has high amplification efficiency. Therefore, by combining the advantages of LAMP, simple, rapid and accurate gene detection can be achieved.

[0004] Electrochemical sensing is widely used in clinical laboratories due to its simple operation and excellent analytical performance. Due to these advantages, LAMP technology can be combined with electrochemical technology to construct a further sensitive biological sensing tool. Under the promotion of existing electrochemical sensing technology and LAMP technology research, we are committed to developing a portable disposable electrochemical biosensor based on LAMP and electrochemical technology for detecting ASFV. LAMP is introduced into the electrochemical sensor to realize in-situ amplification on the surface of the screen-printed carbon electrode (SPCE), and a redox probe is introduced for signal output. In addition, gold nanoparticles (AuNPs) are electrodeposited on the electrode, which can amplify the current signal and significantly improve the sensitivity of the sensor.

[0005] Therefore, a portable disposable electrochemical biosensor based on LAMP in-situ amplification with AuNPs electrodeposited on the SPCE electrode is constructed in this paper, which can be used for the ultra-sensitive detection of ASFV p54 genomic DNA, and has high specificity and high accuracy. There is no related report in the related art. SUMMARY

[0006] The present application aims to provide a LAMP strategy-based electrochemical biosensor for sensitive detection of ASFV, which has the advantages of rapidity, simplicity and low cost. LAMP is combined with electrochemical technology, and AuNPs are deposited on SPCE to construct a further applied biological sensing tool.

[0007] The present application combines the signal amplification of LAMP with electrochemical sensing to construct a portable disposable electrochemical biosensor for detecting ASFV based on LAMP in-situ amplification. The present application modifies the electrode with thiol-containing primers for subsequent in-situ LAMP, uses dsDNA / AuNPs / SPCE as the electrode interface, realizes low cost, simple process and rapid detection of ASFV, provides a simple, economical and efficient method for ASFV diagnosis, and also provides a new idea for constructing a new type of biological sensing detection by combining LAMP with electrochemistry.

[0008] A preparation method of a disposable electrochemical sensor for African swine fever virus based on in-situ amplification, comprising the following steps:

[0009] Step 1, electrode pretreatment:

[0010] The screen-printed carbon electrode (SPCE) is cleaned in a 5mL solution containing 0.5M H2SO4 and 0.1M KCl, cyclic voltammetry scanning (CV) is performed, the scanning range is set to -0.2-1.5V, and the scanning rate is 100mV / s. After obtaining a stable cyclic voltammogram, the electrode is washed with double distilled water and dried with nitrogen, and is ready for use;

[0011] The surface of the screen-printed carbon electrode (SPCE) is provided with a central electrode area and a peripheral non-electrode area; the electrode area comprises a carbon working electrode (3 mm in diameter), a carbon auxiliary electrode and an Ag / AgCl reference electrode;

[0012] Step 2, construction of a micro-pool:

[0013] A layer of polydimethylsiloxane (PDMS) film (3-5 mm in thickness) is coated on the non-electrode area of the SPCE pretreated in Step 1 to form a micro-pool;

[0014] Step 3, preparation of a modified electrode:

[0015] Gold nanoparticles (Au NPs) are electrodeposited on the carbon working electrode in the electrode area of the SPCE in Step 2 to prepare an Au NPs modified SPCE working electrode, denoted as Au NPs / SPCE;

[0016] Step 4, construction of an electrochemical biosensor:

[0017] The primer mixed solution is dropped on the surface of the Au NPs / SPCE electrode, and after a period of reaction, the excess unbound primers are removed by washing with PBS to finally obtain an electrode with primers, denoted as Primer / Au NPs / SPCE;

[0018] Step 5, in-situ LAMP of ASFV:

[0019] The nucleic acid amplification reaction solution and the ASFV standard sample are mixed uniformly and then dropped on the surface of the Primer / Au NPs / SPCE electrode prepared in Step 4, and then the electrode is incubated in a heater for a period of time to obtain a thiol-linked amplification product dsDNA / Au NPs / SPCE, which constitutes a disposable electrochemical sensor for African swine fever virus based on in-situ amplification.

[0020] In Step 3, the specific operation of electrodeposition of Au NPs is as follows:

[0021] In a freshly prepared 2 mM HAuCl4 solution, a low potential and a high potential of -0.2 V and 1.2 V are adopted, the scanning rate is 100 mV / s, -0.2 V is the starting potential and the termination potential, and 40 cycles of electrodeposition are performed to obtain Au NPs / SPCE, which is washed with ultrapure water, dried with nitrogen and ready for use.

[0022] In Step 4,

[0023] The four primers of the ASFV p54 gene (Genbank: MN207060.1) are designed by using the primer V5 online software: a thiol-modified forward inner primer SH-FIP, a reverse inner primer BIP, a forward outer primer F3 and a reverse outer primer B3, which are synthesized by Shenguo Bioengineering (Shanghai) Co., Ltd.

[0024] The sequences of the four primers are as follows:

[0025] SH-FIP: SH-TGCTGGTCTGTTTGTTGCCGGGGAGCGACTACAGCAAGTG;

[0026] BIP: AGACTAGTCATGGCAACTGGCGCGGATGAGCAGGAGCACT;

[0027] F3: TCCACAACCAGGTACCTCTA;

[0028] B3: AGTGACTGTCGTGTAAGGCT;

[0029] In step 4, the preparation steps of the primer mixed solution are as follows:

[0030] The SH-FIP, BIP, F3 and B3 solutions with a concentration of 100 μM are mixed into a primer solution in a volume ratio of 8:8:1:1, and then the primer solution is mixed with a trehalose solution and double-distilled water in a volume ratio of 1:1:4 to form a primer mixed solution;

[0031] The dropwise addition amount of the primer mixed solution is 6 μL, the reaction time is 2 h, and the reaction temperature is 37℃.

[0032] In step 5,

[0033] The volume ratio of the ASFV standard sample to the nucleic acid amplification reaction solution is 1:4, wherein the concentration of the ASFV standard sample is 10 -12 -10 -6 g / L, and the dropwise addition amount of the mixture of the nucleic acid amplification reaction solution and the ASFV is 5 μL.

[0034] The heating incubation temperature is 63℃, and the time is 45 min; and the nucleic acid amplification reaction solution is purchased from Shanghai Suge Diagnostics Product Co., Ltd.

[0035] The use of the disposable electrochemical biosensor for African swine fever virus based on loop-mediated isothermal amplification prepared by the application for detecting ASFV has the following specific steps:

[0036] (S1) In the micro-pool constructed in the non-electrode area of the obtained sensor, 5.0 mM [Fe(CN)6] 3- / 4-The CV signal is collected by an electrochemical workstation in a PBS buffer solution of 0.1M KCl; and the current value is used to draw a standard curve of the logarithmic value of the concentration of the ASFV standard sample.

[0037] (S2) The ASFV positive sample solution with unknown concentration is mixed with the nucleic acid amplification reaction liquid, and then dropped on the surface of the Primer / Au NPs / SPCE electrode; then the electrode is placed in a heater for incubation for a period of time, to obtain the dsDNA / Au NPs / SPCE connected by mercapto; the current signal is collected by the S1 method, and is substituted into the standard curve, to obtain the concentration of the ASFV positive sample.

[0038] In step (S1), the CV measurement is performed at a test range of -0.2-0.6V and a scanning rate of 100mV / s; the PBS buffer solution used has a concentration of 100mM and a pH of 7.4.

[0039] In step (S2), the volume ratio of the ASFV positive sample solution to the nucleic acid amplification reaction liquid is 1:4; the dropping amount of the mixture of the nucleic acid amplification reaction liquid and the ASFV is 5ul; the heating incubation temperature is 63 DEG C, and the time is 45min.

[0040] The present application has the following beneficial effects:

[0041] The present application uses SPCE as a substrate, and deposits Au NPs in the region as a working electrode, and successfully establishes an electrochemical biosensing method for detecting ASFV based on in-situ LAMP, which has the following characteristics and advantages:

[0042] (1) The present application uses SPCE as a working electrode, which contains a carbon working electrode (3mm), a carbon auxiliary electrode and an Ag / AgCl reference electrode. The electrochemical workstation is used to detect the current signal, and the output performance is stable.

[0043] (2) The present application deposits Au NPs on the working electrode of SPCE, which further improves the sensitivity of the prepared biosensor.

[0044] (3) The electrochemical biosensing method proposed in the present application realizes the sensitive detection of ASFV, and the linear range of the logarithmic value of the concentration of ASFV (lg C -12 -10 -6 ) and the current signal output value of the electrochemical workstation is 10 p54 g / L.

[0045] (4) The present application constructs a new type of electrochemical biosensor based on LAMP, which is an alternative to fluorescence-based optical sensing detection, making the detection system miniaturized and simple. In particular, the combination of LAMP and electrochemical detection provides a simple, economical and rapid method for nucleic acid-based molecular diagnosis. BRIEF DESCRIPTION OF DRAWINGS

[0046] Figure 1 Mechanism diagram of the constructed electrochemical biosensor;

[0047] Figure 2 CV spectra of AuNPs modified electrode in impedance solution (A) and CV spectra of modified electrode in 0.5M H2SO4 (B) before (a) and after (b) modification of AuNPs;

[0048] Figure 3 (A) XPS spectra of Au 4f corresponding to bare SPCE (a) and AuNPs modified SPCE (b), (B) XPS spectra of Au 4f of the electrode before (a) and after (b) primer modification;

[0049] Figure 4 (A) CV response of the biosensor after LAMP reaction under different concentrations of ASFV p54 (a-h: 10 -13 , 10 -12 , 10 -11 , 10 -10 , 10 -9 , 10 -8 , 10 -7 , 10 -6 g / L); (B) Linear relationship diagram of the logarithmic value of the concentration of the standard sample of ASFV and the current signal. DETAILED DESCRIPTION

[0050] The present application will be described in detail below in conjunction with examples, but the present application is not limited to these examples.

[0051] Figure 1 Mechanism diagram of the constructed electrochemical biosensor.

[0052] Example 1:

[0053] (1) Preparation of modified electrode

[0054] SPCE was cleaned in 5 mL of a solution containing 0.5 M H₂SO₄ and 0.1 M KCl. Cyclic voltammetry (CV) scans were performed until overlapping cyclic voltammetry curves were obtained. The scan range was set to -0.2–1.5 V at a scan rate of 100 mV / s. The SPCE was rinsed with secondary water and dried with nitrogen gas for later use. A 3 mm thick polydimethylsiloxane (PDMS) film was deposited on the non-electrode region of the pretreated SPCE surface to form a microcell. Au NPs were electrodeposited on the working electrode region of the SPCE to prepare an Au NPs-modified SPCE working electrode (Au NPs / SPCE). Characterization was performed as follows: Figure 2 and Figure 3 As shown in A.

[0055] Depend on Figure 2 As shown in curve A, the bare SPCE electrode (curve a) does not exhibit a significant redox peak, while the electrode modified with AuNPs (curve b) shows a clear redox peak current. This is mainly attributed to the excellent conductivity of AuNPs. Furthermore, cyclic voltammetry scans were performed on the electrodes before and after AuNPs modification in 0.5 M H₂SO₄. Figure 2 As can be seen from B, compared with the bare electrode, two clear peaks were observed in the CV plot of AuNPs-SPCE: the one appearing near 1.2V is the gold oxidation peak, and the other appearing at 0.6V is the gold reduction peak.

[0056] Figure 3 In Figure A, the Au 4f XPS spectra of bare SPCE and Au NPs-SPCE directly prove the successful deposition of Au NPs on the SPCE surface. The curve of bare SPCE does not show the characteristic peaks of Au. Figure 3 Curve A(a), while the XPS spectrum of Au NPs-SPCE shows a pair of peaks at 84.0 and 87.7 eV ( Figure 3 Curve A(b) corresponds to Au atom 4f 7 / 2 and 4f 5 / 2 The energy level indicates that Au is electrodeposited on the SPCE surface.

[0057] (2) Construction of electrochemical biosensors

[0058] SH-FIP, BIP, F3, and B3 solutions, each with a concentration of 100 μM, were mixed in a volume ratio of 8:8:1:1 to form a primer solution. Then, the primer solution was mixed with trehalose solution and double-steamed water in a volume ratio of 1:1:4 to form a primer mixture solution.

[0059] 6μL primer mixture solution was dropped on the surface of Au NPs / SPCE electrode, and after 2h reaction at 37℃, the excess unbound primer was removed by PBS washing, and finally the primer-carrying electrode (Primer / Au NPs / SPCE) was obtained, and the characterization was as follows Figure 3 The primer mixture solution was added to the surface of Au NPs-SPCE electrode, and was fixed by Au-S covalent bond and adsorption, and P 2p XPS spectrum proved that the primer had been fixed on the surface of Au NPs-SPCE electrode, and the characteristic peak of P appeared (curve b), while SPCE had no characteristic peak of P (curve a).(3) In-situ LAMP of ASFV:

[0060] The nucleic acid amplification reaction solution and ASFV standard sample were mixed uniformly, and 5μL thereof was dropped on the surface of Primer / Au NPs / SPCE electrode prepared in step 4, and then the electrode was incubated in a heater at 63℃ for 45min, and finally the dsDNA / Au NPs / SPCE connected by mercapto was obtained, and constituted a disposable electrochemical sensor for African swine fever virus based on in-situ amplification.

[0061] Electrochemical biosensor for detecting ASFV based on in-situ loop-mediated isothermal amplification

[0062] Different concentrations of ASFV standard sample were mixed with nucleic acid amplification reaction solution at a ratio of 1:4, and then 5μL of the mixture containing ASFV standard sample at a concentration of 10 -13 , 10 -12 , 10 -11 , 10 -10 , 10 -9 , 10 -8 , 10 -7 , 10 -6 g / L was dropped on the surface of Primer / Au NPs / SPCE electrode, and in-situ LAMP reaction was carried out. 3- / 4- Finally, the dsDNA / Au NPs / SPCE was placed in PBS buffer solution containing 5.0mM [Fe(CN)6]

[0063] Under the optimized conditions, the performance of the prepared electrochemical biosensor was analyzed, and the detection results were as follows Figure 4

[0064] Figure 4 A in the figure is the CV signal of the electrochemical biosensor for detecting different concentrations of ASFV p54 (a-h: 10 -13 , 10 -12 , 10 -11 , 10 -10 , 10 -910 -8 10 -7 10 -6 The CV response of the biosensor after LAMP reaction at (g / L) showed that, as expected, the current signal decreased with increasing p54 concentration. Figure 4 Figure B shows the linear relationship between the logarithm of the ASFV standard sample concentration and the current signal. The results show a linear relationship between the current signal and the logarithm of the p54 concentration, with the linear equation being: current signal = 15.64 - 5.68 × (lgC(g / L)(R)). 2 =0.996). The linear concentration range is 10. -12 -10 -6 g / L (approximately 1.6 × 10⁻⁶ g / L) 0 -1.6×10 6 (copies / μL).

Claims

1. A method for preparing a disposable electrochemical sensor for the detection of African swine fever virus based on in situ amplification, characterized by, Comprising the following steps: Step 1, electrode pretreatment: The screen-printed carbon electrode SPCE is cleaned in a solution containing H2SO4 and KCl, cyclic voltammetry scanning is performed, and after a stable cyclic voltammetry curve is obtained, it is washed with double distilled water and dried with nitrogen, and is ready for use; The screen-printed carbon electrode SPCE is provided with a central electrode area and a peripheral non-electrode area; the electrode area comprises a carbon working electrode, a carbon auxiliary electrode and an Ag / AgCl reference electrode; The concentration of H2SO4 in the solution containing H2SO4 and KCl is 0.5M, and the concentration of KCl is 0.1M; the amount of the solution containing H2SO4 and KCl is 5mL; the range of cyclic voltammetry scanning is set to-0.2-1.5V, and the scanning rate is 100mV / s; the diameter of the carbon working electrode is 3mm; Step 2, construction of a micro-pool: A layer of polydimethylsiloxane PDMS film is covered on the non-electrode area of the SPCE pretreated in step 1 to form a micro-pool; wherein the thickness of the polydimethylsiloxane PDMS film is 3-5mm; Step 3, preparation of a modified electrode: Gold nanoparticles Au NPs are electrodeposited on the carbon working electrode in the electrode area of the SPCE in step 2 to prepare an Au NPs modified SPCE working electrode, denoted as Au NPs / SPCE; Step 4, construction of an electrochemical biosensor: The primer mixed solution is dropped on the surface of the AuNPs / SPCE electrode, and after a period of reaction, the excess unbound primers are removed by washing with PBS, and finally the electrode with primers is obtained, denoted as Primer / AuNPs / SPCE; Wherein, four primers of the ASFV p54 gene are designed by using the primer V5 online software: a thiol-modified forward inner primer SH-FIP, a reverse inner primer BIP, a forward outer primer F3 and a reverse outer primer B3; the sequences of the four primers are respectively: SH-FIP: SH-TGCTGGTCTGTTTGTTGCCGGGGAGCGACTACAGCAAGTG; BIP: AGACTAGTCATGGCAACTGGCGCGGATGAGCAGGAGCACT; F3: TCCACAACCAGGTACCTCTA; B3: AGTGACTGTCGTGTAAGGCT; Step 5, in-situ LAMP of ASFV: The nucleic acid amplification reaction solution and the ASFV standard sample are mixed uniformly and then dropped on the surface of the Primer / Au NPs / SPCE electrode prepared in step 4, and then the electrode is incubated in a heater for a period of time to obtain a thiol-linked amplification product dsDNA / Au NPs / SPCE, which constitutes a disposable electrochemical sensor for African swine fever virus based on in-situ amplification.

2. The preparation method of claim 1, wherein The specific operation of the electrodeposition of Au NPs in step 3 is as follows: Au NPs / SPCE is obtained by electrodeposition 40 times in a newly prepared 2mM HAuCl4 solution at a low potential of-0.2V and a high potential of 1.2V, a scanning rate of 100mV / s, and a starting potential and a terminal potential of-0.2V, and then rinsed with ultrapure water and dried with nitrogen for standby.

3. The preparation method of claim 1, wherein the step of preparing the virus is performed by inoculating the cell culture medium into a cell culture flask. In step 5, the volume ratio of the ASFV standard sample to the nucleic acid amplification reaction solution is 1:4, wherein the concentration of the ASFV standard sample is 10 -12 -10 -6 g / L.

4. The preparation method of claim 1, wherein the step of preparing the virus is performed by inoculating the cell culture medium into a cell culture flask. In step 5, the dropwise addition amount of the nucleic acid amplification reaction solution and the ASFV mixed solution is 5μL; the heating incubation temperature is 63℃, and the time is 45min.

Images