A specific probe for detecting HCMV and a kit for isothermal amplification of HCMV

By combining transcription-mediated amplification technology with CRISPR/Cas13 detection methods, and using specific probes and primer combinations for isothermal amplification, the problem of early HCMV diagnosis in existing technologies has been solved. This achieves highly sensitive and specific detection of active HCMV infection, reduces equipment costs, and avoids equipment contamination.

CN116042919BActive Publication Date: 2026-05-12HANGZHOU MATRIDX BIOTECH CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HANGZHOU MATRIDX BIOTECH CO LTD
Filing Date
2022-11-17
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing HCMV diagnostic methods are difficult to achieve early, accurate, and specific infection detection, especially in pre-transplant screening where there are many false positive and false negative results. Furthermore, quantitative real-time PCR technology requires a lot of equipment, which is expensive, complex to operate, and not easy to carry. Existing technologies are cumbersome and difficult to operate.

Method used

This method combines transcription-mediated amplification with CRISPR/Cas13 specific detection. Isothermal amplification is performed using specific probes and primer combinations. Early diagnosis is achieved by detecting the mRNA of the HCMV immediate early protein MIE gene. Specific cleavage is performed using the CRISPR/Cas13 system, and the infection status is determined by fluorescence signals.

Benefits of technology

This technology enables highly sensitive and specific qualitative detection of active HCMV infection without the need for sophisticated quantitative PCR instruments, avoiding equipment contamination, reducing equipment costs, and improving early diagnostic capabilities.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116042919B_ABST
    Figure CN116042919B_ABST
Patent Text Reader

Abstract

The present application relates to a specific probe for detecting HCMV and a kit for isothermal amplification of HCMV, and belongs to the technical field of human cytomegalovirus detection.A specific probe for detecting HCMV, the probe comprises a sequence comprising a T7 promoter SEQ ID NO.21 and a sequence capable of recognizing a Cas13 protein SEQ ID NO.22.The present application uses the genomic RNA of the sample to be tested as a template, uses a specific primer probe set, performs isothermal amplification and CRISPR / Cas13 specific detection, and determines the results according to the fluorescence signal, so as to realize the qualitative detection of the infection state of human cytomegalovirus.Using RNA as a template, the latent state and active state of HCMV can be distinguished.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a specific probe for detecting HCMV and a kit for isothermal amplification of HCMV, belonging to the field of human cytomegalovirus detection technology. Background Technology

[0002] Cytomegalovirus (CMV) is a DNA virus belonging to the herpesvirus group. Because infected cells swell and possess large intranuclear inclusion bodies, it is also called a cellular inclusion body virus. It is ubiquitous in nature and exhibits strict species specificity, including CMV in humans, horses, cattle, pigs, cats, and mice. The CMV that infects humans is called human cytomegalovirus (HCMV), or human herpesvirus 5 (HHV-5). CMV infection in children often presents as asymptomatic acute or latent infection; only a small percentage are symptomatic, and it most frequently occurs in children with congenital or perinatal infections. Infection can have serious effects on pregnant women and fetuses. In cases of severe immunodeficiency, systemic diseases such as pneumonia and hepatitis can occur. Therefore, timely and accurate diagnosis of CMV is crucial.

[0003] Currently, there are various methods for diagnosing CMV infection. Common methods include culture, enzyme-linked immunosorbent assay (ELISA), antigen detection, and quantitative PCR. Culture involves centrifuging samples such as saliva, urine, and cervical secretions, then staining the exfoliated cells with Giemsa stain for microscopic examination, looking for giant cells and eosinophilic inclusion bodies in the nucleus and cytoplasm, which can provide a preliminary diagnosis. Isolation culture involves inoculating samples into human embryonic lung fibroblasts. However, due to the long growth cycle of CMV and the slow appearance of cytopathic effects, diagnosis may be delayed, affecting treatment. HCMV-IgG and IgM are commonly used clinical indicators that can indirectly confirm the presence of HCMV in the body; however, neither should be used for pre-implantation screening because false-positive IgM tests can significantly reduce the specificity of screening, easily leading to false negatives and false positives, resulting in missed or misdiagnosed cases. Due to their speed, sensitivity, and specificity, ELISA has largely replaced other methods for detecting IgG and IgM alone. However, because antibodies appear relatively late, early diagnosis is not possible. Quantitative real-time PCR (qPCR) technology offers high sensitivity, specificity, and rapid detection. However, most qPCR assays detect CMV deoxyribonucleoside (DNA), and viral DNA from asymptomatic or latent infections can also show positive results. Therefore, there is an urgent need in this field for a method or reagent capable of early diagnosis of active HCMV infection. Summary of the Invention

[0004] This invention presents a detection method based on transcription-mediated amplification technology combined with CRISPR / Cas13 specific detection. It provides primer and probe combinations for specific isothermal amplification, including an upstream primer, a downstream primer, and a specific probe. Compared to current quantitative real-time PCR (qPCR) methods, this kit does not require sophisticated qPCR instruments, the amplification and detection product is RNA, which is less prone to contamination, has high specificity, and enables qualitative detection of human cytomegalovirus (CMV) infection status.

[0005] The technical solution of the present invention to solve the above problems is as follows:

[0006] A specific probe for detecting HCMV, the probe comprising a sequence SEQ ID NO.21 containing the T7 promoter and a sequence SEQ ID NO.22 capable of recognizing the Cas13 protein;

[0007] SEQ ID NO.21: taatacgactcactataggg;

[0008] SEQ ID NO. 22: caaaatcaggggaagcaaaaccccatcagatttag.

[0009] The Immediate Early HCMV protein (MIE) is a non-structural protein with a molecular weight of 72,000. Its encoding gene is located in the long unique region of HCMV. This protein is synthesized before HCMV DNA synthesis and initiates HCMV gene expression, becoming detectable several hours after viral infection. Furthermore, the MIE gene coding sequence consists of three exons, and due to its crucial role in the CMV life cycle, it has long been considered highly conserved. Since mRNA is a product of viral gene transcription and a marker of active replication, its expression is closely related to active infection; therefore, detecting the MIE gene can achieve early diagnosis. To this end, we have established an isothermal amplification CRISPR assay for detecting the mRNA of the Immediate Early HCMV MIE gene transcript produced during the HCMV replication phase, which can assist in the early diagnosis of active HCMV infection.

[0010] This invention selects the published HCMV-MIE sequence as the target. The MIE gene, an immediate early gene of human cytomegalovirus (HCMV), is the first gene expressed after primary or recurrent CMV infection, appearing within one hour of infection. It not only activates its own promoter but also participates in regulating cellular gene transcription and expression. The MIE protein plays a leading role in the subsequent regulation of CMV gene expression. Therefore, targeting the MIE gene has high clinical application value.

[0011] In this study, the MIE gene (SEQ ID NO.19) was used as the target gene, and its RNA (SEQ ID NO.20) was amplified and detected to qualitatively determine the patient's infection status.

[0012] As a preferred embodiment of the above technical solution, the specific probe is one of the sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10;

[0013] SEQ ID NO.1

[0014] taatacgactcactatagggcaaaatcaggggaagcaaaaaccccatcagatttag

[0015] GGCGCCCTTGCTCACATCATGCAGCTCCT

[0016] SEQ ID NO.2

[0017] taatacgactcactatagggcaaaatcaggggaagcaaaaaccccatcagatttag

[0018] GCCCTTGCTCACATCATGCAGCTCCTTAA

[0019] SEQ ID NO.3

[0020] taatacgactcactatagggcaaaatcaggggaagcaaaaaccccatcagatttag

[0021] CTTGCTCACATCATGCAGCTCCTTAATAC

[0022] SEQ ID NO.4

[0023] taatacgactcactatagggcaaaatcaggggaagcaaaaaccccatcagatttag

[0024] CTCACATCATGCAGCTCCTTAATACAAGC

[0025] SEQ ID NO.5

[0026] taatacgactcactatagggcaaaatcaggggaagcaaaaaccccatcagatttag

[0027] ACATCATGCAGCTCCTTAATACAAGCCAT

[0028] SEQ ID NO.6

[0029] taatacgactcactatagggcaaaatcaggggaagcaaaaaccccatcagatttag

[0030] TCATGCAGCTCCTTAATACAAGCCATCCA

[0031] SEQ ID NO.7

[0032] taatacgactcactatagggcaaaatcaggggaagcaaaaaccccatcagatttag

[0033] TGCAGCTCCTTAATACAAGCCATCCACAT

[0034] SEQ ID NO.8

[0035] taatacgactcactatagggcaaaatcaggggaagcaaaaaccccatcagatttag

[0036] AGCTCCTTAATACAAGCCATCCACATCTC

[0037] SEQ ID NO.9

[0038] taatacgactcactataggggcaaaatcaggggaagcaaaaaccccatcagatttag

[0039] CCTTAATACAAGCCATCCACATCTCCCGC

[0040] SEQ ID NO.10

[0041] taatacgactcactatagggcaaaatcaggggaagcaaaaaccccatcagatttag

[0042] TAATACAAGCCATCCACATCTCCCGCTTA

[0043] The above crDNA can be transcribed into crRNA under the action of T7 RNA polymerase. It can form a complex with Cas13 protein and specifically recognize the target sequence. When the target sequence is recognized, the structure of Cas13 protein changes and it gains non-specific RNase activity, which can cleave the single-stranded RNA reporter in the system.

[0044] As a preferred embodiment of the above technical solution, the specific probe is one of the sequences shown in SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4; more preferably, the specific probe is the sequence shown in SEQ ID NO.3.

[0045] Secondly, the present invention provides a kit for isothermal amplification of HCMV.

[0046] A kit for isothermal amplification of HCMV, the kit comprising an upstream primer and a downstream primer; the upstream and downstream primers are selected from one of the following primer groups;

[0047] Primer set 1: Upstream and downstream primers shown in SEQ ID NO.11 and SEQ ID NO.15;

[0048] Primer set 2: Upstream and downstream primers shown in SEQ ID NO.11 and SEQ ID NO.16;

[0049] Primer set 3: Upstream and downstream primers shown in SEQ ID NO.11 and SEQ ID NO.17;

[0050] Primer set 4: Upstream and downstream primers shown in SEQ ID NO.11 and SEQ ID NO.18;

[0051] Primer set 5: Upstream and downstream primers shown in SEQ ID NO.12 and SEQ ID NO.15;

[0052] Primer set 6: Upstream and downstream primers shown in SEQ ID NO.12 and SEQ ID NO.16;

[0053] Primer set 7: Upstream and downstream primers shown in SEQ ID NO.12 and SEQ ID NO.17;

[0054] Primer set 8: Upstream and downstream primers shown in SEQ ID NO.12 and SEQ ID NO.18;

[0055] Primer set 9: Upstream and downstream primers shown in SEQ ID NO.13 and SEQ ID NO.15;

[0056] Primer set 10: Upstream and downstream primers shown in SEQ ID NO.13 and SEQ ID NO.16;

[0057] Primer set 11: Upstream and downstream primers shown in SEQ ID NO.13 and SEQ ID NO.17;

[0058] Primer set 12: Upstream and downstream primers shown in SEQ ID NO.13 and SEQ ID NO.18;

[0059] Primer set 13: Upstream and downstream primers shown in SEQ ID NO.14 and SEQ ID NO.15;

[0060] Primer set 14: Upstream and downstream primers shown in SEQ ID NO.14 and SEQ ID NO.16;

[0061] Primer set 15: Upstream and downstream primers shown in SEQ ID NO.14 and SEQ ID NO.17;

[0062] Primer set 16: Upstream and downstream primers shown in SEQ ID NO.14 and SEQ ID NO.18;

[0063] SEQ ID NO.11:ATGAAGTGTATTGGGCTAACTATGC

[0064] SEQ ID NO.12: TTGGGCTAACTATGCAGAGCA

[0065] SEQ ID NO.13: TATGCAGAGCATGTATGAGAACTAC

[0066] SEQ ID NO.14: TGTATGAGAACTACATTGTACCTGAGG

[0067] SEQ ID NO.15: taatacgactcactatagggg TGCACCCCCCAACTTGTTAG

[0068] SEQ ID NO.16: taatacgactcactataggggTTTTTAGCACGGGCCTTAGC

[0069] SEQ ID NO.17: taatacgactcactatagggg TCATCCTTTTTAGCACGGGC

[0070] SEQ ID NO.18: taatacgactcactatagggg CATCATCTTTCTCCTAAGTTCATCC

[0071] Of the 16 primer pairs mentioned above, 6 pairs showed obvious fluorescence detection signals. Primer pairs 11, 12, and 16 showed the strongest fluorescence detection signals and the best stability. Primer pair 16 was further selected for the detection of HCMV in subsequent experiments.

[0072] This invention uses genomic RNA from the sample as a template, employs a specific primer and probe set for isothermal amplification and CRISPR / Cas13-specific detection, and determines the qualitative detection of human cytomegalovirus (HCMV) infection status based on the fluorescence signal. Using RNA as a template, it is possible to distinguish between latent and active HCMV states.

[0073] In summary, the present invention has the following beneficial effects:

[0074] (1) No expensive and sophisticated real-time PCR instrument is required;

[0075] (2) Pollution is not easily generated throughout the entire reaction process;

[0076] (3) High sensitivity;

[0077] (4) High specificity;

[0078] (5) The diagnosis of "active infection" of HCMV has been achieved. Attached Figure Description

[0079] Figure 1 The results of fluorescence signal reactions for 10 different crDNAs;

[0080] Figure 2 Performance test results for 10 different crDNA samples;

[0081] Figure 3 The results of fluorescence signal detection for 16 pairs of TMA amplification primers;

[0082] Figure 4 Results of human cytomegalovirus sensitivity testing;

[0083] Figure 5 The results are specific to human cytomegalovirus. Detailed Implementation

[0084] The technical methods provided by the present invention will be described and illustrated in detail below with reference to specific embodiments and accompanying drawings. These embodiments are merely some examples of the present invention and are not limited to all embodiments. Unless otherwise specified, the reagent components used in the following embodiments are components of the reagent kit of the present invention. Modifications or alterations made by those skilled in the art based on the present invention are also within the scope of the claims described in the claims.

[0085] Example 1

[0086] The templates used for RNA in each embodiment are prepared as follows:

[0087] (1) Experimental materials

[0088] The PCR amplification kit was PrimeSTAR® Max DNA Polymerase, the in vitro transcription kit was HiScribeT7 Quick High Yield RNA Synthesis kit (New England Biolabs), the DNase was from Hangzhou Kaisheng Biotechnology Co., Ltd., and the RNA purification kit was RNA Clean & Concentrator-5 kit (Zymo Research).

[0089] (2) Template preparation

[0090] A synthetically produced plasmid containing the T7 promoter sequence and the target fragment of the human cytomegalovirus (CMV) MIE gene was amplified using SEQ ID NO.23 and primer SEQ ID NO.24 to obtain a large amount of the target fragment. The RNA product of the MIE gene was then obtained using an in vitro transcription kit. The remaining DNA fragment was digested with DNase using the following digestion system:

[0091] Components Dosage Nucleic acid samples 30 μL DNase 4 μL DNase Buffer 4 μL 38 μL

[0092] Nucleic acid sample processing reaction system and conditions: Place in a 37℃ incubator and incubate for 30 min.

[0093] RNA was purified using an RNA purification kit to obtain RNA nucleic acid containing the MIE gene detection fragment. Human cellular nucleic acid was then serially diluted 1–10 ng / µL to 10 ag / µL (approximately 1.22 × 10⁻⁶) using 1–10 ng / µL of the diluted RNA. 4 (copies / mL), which serves as a template for probe screening.

[0094] Example 2: Screening of Specific Probes

[0095] (1) Referring to the RNA antisense strand sequence of the conserved region of the HCMV-MIE gene, an RNA targeting sequence was designed using the CRISPR-RT website (http: / / bioinfolab.miamioh.edu / CRISPR-RT / ). In order to reduce costs and facilitate preparation, the RNA sequence was converted into a DNA sequence, and a sequence containing the T7 promoter was added to the 5' end. The crDNA was converted into crRNA under the action of T7 RNA polymerase. The transcription system and purification system were the same as in Example 1.

[0096] (2) Using the template-free reaction as a background control for crDNA screening, all crDNAs showed specific activation after being mixed with the template.

[0097] (3) Detection reaction: Refer to the amount of each component in the table below to prepare the detection reaction solution in a centrifuge tube without nuclease; respectively, take 45 μL of detection buffer, 2 μL of detection enzyme, and 1 μL of crDNA (15 ng / μL) (the detection buffer and enzyme are from Hangzhou Kaisi Biotechnology Co., Ltd.), mix them evenly, centrifuge briefly, and then place the reaction tube in a nucleic acid amplification analyzer for real-time detection.

[0098] solution components Volume / Reaction Detect buffer 45 μL Detection enzyme 2 μL crDNA 1 μL template 3 μL

[0099] (4) The program settings for the nucleic acid amplification analyzer are as follows:

[0100] Temperature: 37℃; Interval: 15s; Duration: 30min (The fluorescence reading instrument used in this invention is the Gene-8c nucleic acid amplification analysis instrument from Hangzhou Aosheng Instrument Co., Ltd.)

[0101] (5) Results Analysis

[0102] like Figure 1 As shown, all 10 crDNA fluorescence detection curves showed an upward trend within 30 minutes, while no fluorescence signal was detected in the negative control.

[0103] like Figure 2 As shown, the slope range of crDNA#1:SEQ ID NO.1-crDNA#10:crDNA#10 is 885~1029. The better crDNAs are crDNA#2:SEQ ID NO.2, crDNA#3:SEQ ID NO.3 and crDNA#4:SEQ ID NO.4. Among them, crDNA#3:SEQ ID NO.3 has the largest slope and the best performance.

[0104] Example 3: Screening of primer combinations

[0105] (1) TMA primer design: Based on the conserved sequence of the positive strand of the target gene HCMV-MIE, four upstream primers and four downstream primers were designed according to the TMA primer design principle, and the T7 promoter sequence was added to the 5' end of the downstream primer.

[0106] (2) Using the template-free reaction as a background control for crDNA screening, all crDNAs showed specific activation after being mixed with the template.

[0107] (3) Amplification detection

[0108] a. Prepare the amplification system according to the table below:

[0109] Amplify buffer 2.8µL amplification enzyme 0.5µL Primer F (10 µM) 0.1µL Primer R (10 µM) 0.1µL template 1.5µL mineral oil 8µL

[0110] b. Two replicates were set up for each sample to detect CMV-MIE target points;

[0111] c. Place in a PCR instrument and react at 50°C for 30 min.

[0112] e. Prepare the test mixture according to the following system:

[0113] Detect Buffer 47µL Detection enzyme 2µL crDNA (15 ng / µL) 1µL

[0114] f. Take 50 µL of the above detection mixture and add it to the reaction tube after amplification is completed;

[0115] g. After instantaneous centrifugation, place the sample in a fluorescence detector for detection; the parameters of the isothermal fluorescence detector are set as follows:

[0116] Temperature: 37℃; Interval: 15 s; Duration: 30 min.

[0117] (4) Results Analysis

[0118] like Figure 3 As shown, among the 16 primer pairs, 6 pairs exhibited significant fluorescence detection signals. Primer set 11 (SEQ ID NO.13 and lower primer SEQ ID NO.17), primer set 12 (SEQ ID NO.13 and lower primer SEQ ID NO.18), and primer set 16 (SEQ ID NO.14 and lower primer SEQ ID NO.18) showed the strongest fluorescence detection signals and the best stability.

[0119] The upper primer SEQ ID NO.14 and the lower primer SEQ ID NO.18 showed a faster reaction rate and stronger fluorescence signal.

[0120] Example 4: Detection of human cytomegalovirus sensitivity

[0121] (1) The RNA nucleic acid containing the MIE gene detection fragment was diluted sequentially with 1 ng / µL of human cell nucleic acid to obtain RNA nucleic acid solutions of 183, 137.3, 91.5, 36.6, 27.5, 18.3 and 0 copies / µL respectively.

[0122] (2) Using the same amplification and detection system and conditions as in Example 3, two replicates were set up for each nucleic acid sample for amplification and detection.

[0123] Results analysis: such as Figure 4 As shown, the negative control test result was negative, and the positive control test result was positive. The fluorescence value was not significantly different from the NC at a template concentration of 18.3 copies / reaction, and the highest fluorescence value was observed at a template concentration of 27.5 copies / reaction. Therefore, 18.3 copies / reaction is the limit of detection. The sensitivity is as high as 1.83 × 10⁻⁶. 4 copies / mL, meaning the limit of detection is 4 copies / reaction.

[0124] Example 5: Detection of human cytomegalovirus specificity

[0125] Template-free reaction was used as a negative control, and 27.5 copies / µL RNA nucleic acid solution was used as a positive control. Nucleic acid samples from common respiratory or pulmonary pathogens were used as specific interference samples for testing. These pathogens included Bacillus cereus, Staphylococcus haemolyticus, Pseudomonas aeruginosa, Acinetobacter baumannii, Mycobacterium tuberculosis, Haemophilus influenzae, Chlamydia psittaci, Neisseria mucilaginis, Corynebacterium striatum, Stenotrophomonas maltophilia, Veillonella parvula, Human herpesvirus 1, and Rosella. * *Mucilaginosa*, *Prevotella melanogenes*, *Aspergillus fumigatus*, *Staphylococcus aureus*, *Burkholderia cepacia*, *Streptococcus pneumoniae*, *Candida albicans*, *Klebsiella pneumoniae*.

[0126] The amplification and detection system and conditions are the same as in Example 3. Two replicates are set up for each of the above nucleic acid samples for simultaneous amplification and detection.

[0127] Results analysis: such as Figure 5 As shown, except for the positive control which tested positive, all other samples tested negative; this demonstrates high specificity, as the primer probe does not produce cross signals in other common respiratory or lung pathogens.

[0128] Example 6: Detection of HCMV in simulated latent and active states

[0129] The target DNA fragment and transcribed RNA fragment of the human cytomegalovirus (CMV) MIE gene obtained in Case 1 were diluted to different concentration gradients of 1.83 × 10⁻⁶ with human cell DNA (hDNA) and human cell RNA (hRNA), respectively. 6 copies, 1.83×10 4 copies, 1.83×10 2 DNA and RNA of the same concentration gradient (18.3 copies, 0 copies, and 18.3 copies) were mixed at a 1:1 volume ratio. Different concentrations of DNA and RNA, as well as the mixed DNA-RNA, were used as detection templates, while hDNA and hRNA served as negative controls.

[0130] The system and conditions for isothermal amplification and detection are the same as in Example 3, with two replicates for each sample.

[0131] Experimental results: No signal was detected with DNA template, while signals were detected with both RNA and mixed templates. These results indicate that the specific primer probes designed based on a detection method combining isothermal amplification technology and CRISPR / Cas13 specific detection can detect the latent and active states of HCMV.

[0132] <![CDATA[1.83×10 6 copies]]> <![CDATA[1.83×10 4 copies]]> <![CDATA[1.83×10 2 copies]]> 18.3 copies 0 copies hDNA hRNA CMV-DNA - - - - - - / CMV-RNA + + + + + / - CMV-RNA-DNA + + + + + - -

Claims

1. A kit for isothermal amplification of HCMV, the kit comprising a specific probe, an upstream primer, and a downstream primer; characterized in that: The specific probe is shown in SEQ ID NO.3; the upstream primer is shown in SEQ ID NO.14; and the downstream primer is shown in SEQ ID NO.18.