Application of OsNDB2 gene in negative regulation of rice seed size

Abstract

This invention relates to OsNDB2 The application of genes in the negative regulation of rice seed size belongs to the field of genetic engineering technology. This invention first cloned a gene in the japonica rice variety 'Kongyu 131' (KY131) using PCR. OsNDB2 The coding sequence (CDS) of the genome was obtained, with a full length of 1728 bp encoding 575 amino acids. Then, by constructing an overexpression and gene editing vector (using the CRISPR / Cas9 (CRI) system) and using 'Kongyu131' as the transformation recipient, transgenic experiments were conducted to explore the effects of [the gene]. OsNDB2 Biological functions in the negative regulation of rice seed size.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically involving OsNDB2 Application of genes in the negative regulation of rice seed size. Background Technology

[0002] Rice ( Oryza sativa L . Rice is the world's most important food crop, providing essential sustenance for more than half of the global population. It is also a crucial food crop in my country, accounting for 37% of global rice production, making my country the world's highest rice producer. It is projected that by 2050, the world's population will reach 9.1 billion, requiring 43 people to be fed per hectare of land. However, factors such as water scarcity, soil salinity, disease, climate change, and shrinking arable land will exacerbate food shortages over the next 50 years (Qi et al., 2012). Therefore, increasing rice production is key to solving the food shortage problem.

[0003] I. Research progress on rice grain shape.

[0004] Rice yield is a complex trait controlled by multiple genes, mainly determined by the number of effective panicles per unit area, the number of grains per panicle, and the grain weight. The number of effective panicles in rice is related to tillering ability; the number of grains per panicle is mainly determined by panicle length, number of branches, and seed setting rate; grain weight is the most important key factor determining rice yield, mainly determined by grain length, grain width, and grain thickness.

[0005] With the development of molecular biology, more and more genes that regulate rice grain shape have been cloned. These cloned genes are mainly divided into the following categories: (1) enzymes involved in protein ubiquitination degradation; (2) genes involved in G protein signaling pathways; (3) genes involved in plant hormone pathways; and (4) some transcription factors.

[0006] Protein ubiquitination pathway: Recent studies have shown that protein ubiquitination and degradation play an important role in rice grain shape regulation. Currently, genes that regulate rice grain shape via the protein ubiquitination degradation pathway have been cloned. GW2 , TUD1 , HGW wait.

[0007] G protein: G protein is short for guanosine nucleotide-binding protein, which refers to proteins that can bind to GTP or GDP and couple to membrane receptors to perform signal transduction. G proteins are composed of three different subunits: Gα, Gβ, and Gγ. In rice, the Gα subunit is encoded by RGA1; the Gβ subunit is encoded by the RGB1 gene; and the Gγ subunit is encoded by five genes. The G protein complex is located on the cell membrane and can work synergistically with G protein-coupled receptors to receive extracellular signals and transduce the signals to downstream response factors, regulating the growth and development of the organism.

[0008] Plant hormones: Plant hormones are active substances synthesized within plants that regulate plant growth and development. These include auxins, gibberellins (GA), cytokinins (CK), abscisic acid (ABA), ethylene, brassinosteroids (BR), strigolactone, and jasmonic acid. These hormones play crucial roles throughout the entire growth and development process of plants. It has been demonstrated that some endogenous plant hormones, such as auxins and brassinosteroids, play a vital role in seed development.

[0009] Transcription factors: GS2 ( GRAIN SIZE ON CHROMOSOME 2 GRF4 encodes a growth-regulating factor (GRF). Overexpression GS2 It can promote the proliferation and swelling of glume cells, thereby increasing the grain weight and yield of rice (Hu et al., 2015, Duan et al., 2015). GW8 / SPL16 It encodes a positive regulatory protein controlling cell proliferation and belongs to the SBP domain family of transcription factors. Overexpression GW8 It promotes cell division in rice husks, while simultaneously increasing grain filling rate, grain width, and yield; GW8 Gene knockout produces finer seeds, altering the seed's appearance (Wang et al., 2012). GLW7 ( GRAIN LENGTH AND WIEIGHT ON CHROMOSOME 7 ) / SPL13 OsSPL13 is a major-effect QTL that controls rice grain length and weight, encoding a plant-specific transcription factor. OsSPL13 positively regulates the cell size of the rice husk, thereby increasing the volume and weight of the rice grain.

[0010] II. Research progress on the mitochondrial electron transport chain in plants.

[0011] In plants, the mitochondrial electron transport chain (mtETC) is located in the inner mitochondrial membrane and comprises a complex with four multi-subunits: complex I (NADH dehydrogenase), complex II (succinate dehydrogenase), complex III (cytochrome C reductase), and complex IV (cytochrome C oxidase). In addition, plants possess an alternative respiratory pathway that bypasses the classical electron transport chain, allowing direct transport from complex I or II to complex IV. This alternative respiratory pathway includes rotenone-insensitive type II NAD(P)H dehydrogenases, ubiquinone, and alternative oxidases. In plants, rotenone-insensitive type II NAD(P)H dehydrogenases (ND) include three subfamilies (NDA, NDB, and NDC).

[0012] In Arabidopsis thaliana, the ND family has a total of 7 members. (Inhibition) AtNDB1 The expression of this substance affects cell metabolism and plant growth and development (Wallström et al., 2014), but enhances the plant's tolerance to ammonia toxicity (Podgórska et al., 2018). AtNDB2 It plays an important role in Arabidopsis thaliana's response to abiotic stress. Overexpression AtNDB2 Enhanced tolerance to drought stress, while mutants ndb2 They are sensitive to drought stress (Sweetman et al., 2019). AtNDB4 Regulating salt tolerance in Arabidopsis thaliana (Smith et al., 2011). AtNDC1 Regulates the synthesis of vitamin K1 (Fatihi et al., 2015).

[0013] In rice, the ND family includes six members, namely... OsNDA1 , OsNDA2 , OsNDB1 , OsNDB2 , OsNDB3 , OsNDC1 . Summary of the Invention

[0014] To address the aforementioned problems, this invention first cloned a strain of rice from the japonica rice variety 'Kongyu 131' (KY131) using a PCR method. OsNDB2The coding sequence (CDS) was obtained; the full-length CDS is 1728 bp, encoding 575 amino acids. Then, by constructing an overexpression and gene editing vector (using the CRISPR / Cas9 (CRI) system) and using 'Kongyu131' as the transformation recipient, transgenic experiments were conducted to explore its effects. OsNDB2 Biological functions in the negative regulation of rice seed size.

[0015] In a first aspect, the present invention provides an OsNDB2 protein for regulating rice seed size, which has any one of the following characteristics:

[0016] a. It has the amino acid sequence shown in SEQ ID NO: 02;

[0017] b. Rice seed size analogues obtained by substituting, deleting or inserting one or more amino acids, as shown in SEQ ID NO: 02;

[0018] c. Functional analogs having at least 75% homology with the amino acid sequence shown in SEQ ID NO: 02.

[0019] In an embodiment of the present invention, the protein has the amino acid sequence shown in SEQ ID NO: 02.

[0020] In a second aspect, the present invention provides a gene encoding the protein described in the first aspect, the gene having any one of the following characteristics: a) having a nucleotide sequence as shown in SEQ ID NO: 01; b) a mutant allele or derivative produced by substituting, inserting or deleting one or more nucleotides of the nucleotide sequence as shown in SEQ ID NO: 01, which has the same function as the gene sequence shown in SEQ ID NO: 01 and can achieve the purpose of the present invention.

[0021] In an embodiment of the present invention, the gene has the nucleotide sequence shown in SEQ ID NO: 01.

[0022] Thirdly, the present invention provides a recombinant expression vector comprising the above-mentioned... OsNDB2 The nucleotide sequence of the gene. The recombinant expression vector is an overexpression vector or a gene expression vector.

[0023] Fourthly, the present invention provides a transformant obtained by transferring the above-mentioned recombinant expression vector into a host cell. Further, the host cell is Agrobacterium.

[0024] Fifthly, the present invention provides the aforementioned OsNDB2 protein, [[ID=3()]]OsNDB2Application of genes, recombinant expression vectors or transformants in regulating rice seed size or in breeding new transgenic rice varieties.

[0025] Sixthly, the present invention provides a method for increasing the size of rice seeds, which involves transforming rice with a gene-editing vector and knocking out certain gene editing features in the rice. OsNDB2 Gene.

[0026] In a seventh aspect, the present invention provides a method for reducing the size of rice seeds, the method being to transform rice with an overexpression vector, thereby reducing the seed size. OsNDB2 The gene is overexpressed in rice.

[0027] The specific solution adopted in this invention is as follows:

[0028] Beneficial effects: This invention clones the rice variety 'Kongyu 131' (KY131) into... OsNDB2 The biological function of this gene was studied by constructing overexpression and gene editing vectors. The results showed that overexpression... OsNDB2 Reduce the size of rice seeds by knocking out OsNDB2 This increases the size of rice seeds. Therefore, OsNDB2 Genes are involved in regulating rice seed size, which is of great significance for breeding new transgenic rice varieties. Attached Figure Description

[0029] Figure 1 It is hyperexpression OsNDB2 Results of reducing rice seed size;

[0030] In the diagram, (A) OsNDB2 Tissue-specific expression analysis. R: root; S: stem; LB: leaf; LS: leaf sheath; YP: young spikelet. (B) OsNDB2 Expression level analysis of the three overexpression lines. (C) Phenotypic analysis of the wild type and the three overexpression lines at the three-leaf stage. (D) Statistical analysis of plant height of the wild type and the three overexpression lines at the three-leaf stage. (E, F) Grain type analysis of the wild type and the three overexpression lines. Bars = 1 cm. (G) Statistical analysis of grain length, grain width, and thousand-grain weight of the wild type and the three overexpression lines.

[0031] Figure 2 It is knockout OsNDB2 Results of increasing rice seed size;

[0032] In the diagram, (A) OsNDB2 (A) Gene structure analysis and mutation site analysis of gene-edited lines. (B) Domain analysis of wild-type NDB2 and mutant proteins. (C, D) Grain shape analysis of wild-type and three gene-edited lines. Bars = 1 cm. (E) Statistical analysis of grain length, grain width and thousand-grain weight of wild-type and three gene-edited lines. Detailed Implementation

[0033] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention.

[0034] In the following examples, unless specific conditions or methods are specified, conventional conditions or methods were followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0035] I. Experimental Methods.

[0036] Carrier construction.

[0037] 1.1 Construction of overexpression vectors.

[0038] RNA was extracted from KY131 seedlings grown hydroponically to the two-leaf-one-heart stage and reverse transcribed into cDNA. A pair of primers was designed, with the primer sequences as follows:

[0039] OsNDB2 Xba-F,TCTAGAATGTCGGCGTCGGGGGGATTG;

[0040] OsNDB2 BamH-R, GGATCCTTATAGGCTGCTTGAGTCCCTTCCATAGA.

[0041] Amplifying a 1728 bp length from cDNA OsNDB2 The coding region sequence was obtained through coding sequencing and then cloned into the pEASY-Blunt Simple vector. The plasmid, confirmed by sequencing, was then... Xba I / Bam The inserted 1728 bp fragment was digested with HI enzyme, recovered, and further subcloned into the pZH2Bi vector to complete the construction of the overexpression vector.

[0042] 1.2 Construction of CRISPR / Cas9 vectors.

[0043] The guide RNA (TGGAACCCGTCCCCTCATAATGG) was designed and constructed into a CRISPR / Cas9 vector.

[0044] 2. Transformation of rice.

[0045] 2.1 Select plump, mature seeds, remove the husks, and place them in a 50 mL centrifuge tube (preferably less than 200 seeds to prevent incomplete seed sterilization). Add 10 mL of 70% ethanol, invert to mix, and let stand for 1 min. Discard the ethanol, add 30 mL of sterile deionized water and wash twice. Discard the washing solution, add 30 mL of sodium hypochlorite with an effective chlorine concentration of 2%, and place the tube on a shaker and shake at 80 rpm for 20 min.

[0046] 2.2 The following procedures are performed in a clean bench. Discard the cleaning solution, rinse three times with sterile water, then add 30 mL of sterile water, place the mixture flat on a shaker and shake at 80 rpm for 10 min; discard the cleaning solution, rinse once more with 30 mL of sterile water; filter the seeds dry, sow them with the embryo side up on N6 medium to induce callus formation.

[0047] 2.3 After the seeds sown on N6 medium have grown for 10-13 days, the young shoots are removed and the callus is sown on a new N6 medium. After culturing for another 10-13 days, the differentiated small callus is transferred to a new N6 medium and cultured for another 10-13 days.

[0048] 2.4 Use a sterile toothpick to pick up a small amount of Agrobacterium strain and dissolve it in 100 μL of sterile water. After mixing, spread it on AB medium and incubate in the dark at 25°C for 2 days. Take an appropriate amount of activated Agrobacterium and dissolve it in AAM (containing 40 μg / mL of water). -1 The callus tissue was soaked in the acetylsyl syringone (acetyl syringone) infusion solution for 2-5 minutes. After soaking the callus tissue in the infusion solution, the moisture was blotted on sterile filter paper, and then it was spread evenly on 2N6 / AS medium and incubated in the dark at 25°C for 3 days.

[0049] 2.5 The callus tissue was transferred to the selective medium N6 / HC2 and screened for two rounds (10 days each) in a light incubator. Then the callus tissue was transferred to the differentiation medium R / HC and differentiated for three rounds (10 days each). The differentiated seedlings were transferred to HF / H medium and grown for 15 days, then cultured in nutrient solution for 15 days. They were then transplanted into the greenhouse and cultivated and managed using conventional methods.

[0050] RNA extraction and cDNA synthesis.

[0051] RNA was extracted from rice using the TaKaRa MiniBEST RNA Extraction Kit (Cat.# 9769). cDNA was synthesized using the TaKaRa PrimeScript™ II 1st Strand cDNA Synthesis Kit (Cat.# 6210A). The specific steps are as follows:

[0052] A. Add 1 μg of the extracted total RNA to a sterile centrifuge tube to establish the following reaction system:

[0053] Oligo(dT)15 primer 1.0 μL

[0054] 10 mM dNTP 1.0 μL

[0055] Total RNA X μL (1 μg)

[0056] Add RNase-free H2O to a final volume of 10 μL

[0057] The above system was heated in a water bath at 65°C for 5 minutes, and then immediately cooled on ice.

[0058] B. Configure the reaction system as shown below:

[0059] 10 μL of the above system

[0060] 5× Reverse Transcription Buffer 4.0 μL

[0061] AMV reverse transcriptase 1 μL

[0062] RNasin® ribonuclease inhibitor 0.5 μL

[0063] Add RNase-free H2O to a final volume of 20 μL.

[0064] C. Place the above reaction system at 42°C for 1 hour.

[0065] D. Heat the above sample at 70℃ for 15 min, then place it at 0-5℃ for 5 min. Store the synthesized cDNA at -20℃ for later use.

[0066] Real-time quantitative PCR detection.

[0067] 4.1 Synthesize cDNA according to the method described in section 3; dilute with 40 μL of sterile water and use as a template for qPCR.

[0068] 4.2 Utilizing the Bio-Rad CFX96 device and SYBR Green PCR amplification was performed using the dye. The reaction program was as follows: 94℃ for 300 s; 94℃ for 5 s; 60℃ for 15 s; 72℃ for 10 s; 40 cycles, 3 technical replicates. OsActin As an internal reference.

[0069] OsNDB2 The primers are:

[0070] OsNDB2 (RT)-F: GGCAAGAAGAGGTGGTTAT;

[0071] OsNDB2 (RT)-R: GCGAGGTGATACGACATGAA.

[0072] OsActin The primers are:

[0073] OsActin -F: TGACGGAGCGTGGTTACTCATTCA;

[0074] OsActin -R: TCTTGGCAGTCTCCATTTCCTGGT.

[0075] II. Experimental Results.

[0076] In this study, we focused on analyzing OsNDB2 The function was first cloned in the japonica rice variety 'Kongyu 131' (KY131) using PCR. OsNDB2 The coding sequence (CDS) was obtained, showing that the full-length CDS is 1728 bp (nucleotide sequence as shown in SEQ ID NO: 01), encoding 575 amino acids (amino acid sequence as shown in SEQ ID NO: 02). For further research... OsNDB2 To understand the biological functions of gene editing, we constructed an overexpression and gene editing vector (using the CRISPR / Cas9 (CRI) system) and used 'Kongyu131' as the transformation recipient to conduct transgenic experiments.

[0077] Overexpression OsNDB2 Reduce the size and weight of rice seeds.

[0078] In order to study OsNDB2 We used real-time quantitative PCR to detect the tissue expression patterns. OsNDB2 The tissue expression of the virus was investigated, and the results showed that it was expressed in all tissues of rice, with the highest expression in leaves and young panicles. Figure 1 A). We selected three overexpression lines from numerous strains for phenotypic analysis ( Figure 1 B). At the seedling stage, the plant height of the three overexpression lines (OE-1, OE-2, and OE-3) was slightly lower than that of the wild type. Figure 1 (C and D). When examining seed size, we found overexpression. OsNDB2 Significantly reduces rice seed size, including grain length and grain width. Figure 1EG). Compared with the wild type, the grain length of the three overexpression lines decreased by 10.1%, 10.8%, and 11.8%, respectively; the grain width decreased by 8.6%, 10.9%, and 10.9%, respectively; and the thousand-grain weight decreased by 10.7%, 18.7%, and 29.0%, respectively. Figure 1 EG).

[0079] Knockout OsNDB2 Increase the size and weight of rice seeds.

[0080] For further research OsNDB2 To investigate the function of rice grain shape regulation, we used gene editing (CRISPR / Cas9 (CRI) system) to knock out the gene. OsNDB2 We selected three gene-edited lines (CRI-1, CRI-2, and CRI-3) for subsequent functional analysis to analyze the genes and their phenotypes. In the CRI-1 mutant line, OsNDB2 The gene has a 15 bp deletion in exon 5; in CRI-2 and CRI-3, OsNDB2 The gene has an insertion of one A and one T base in its fifth exon. Figure 2 A). Analysis of protein domains showed that the wild-type NDB2 protein contains two domains: FAD / NAD-binding and EF-Hand. Compared with the wild-type, the mutant ndb2-1 protein, while still containing the above two domains, has a missing 5 amino acids (Ile331-Met335) in the FAD / NAD-binding domain. ' B); For the ndb2-2 and ndb2-3 mutant proteins, the insertion of one base results in a frameshift mutation, and the mutant protein contains only 348 amino acids, thus lacking the EF-Hand domain. Figure 2 B).

[0081] In the CRI-1 mutant line, the grain length of rice did not change significantly, while the grain width increased by 10.9%; in the CRI-2 and CRI-3 lines, the grain length of rice increased by 10.6% and 11.0% respectively, while the grain width did not change significantly. Figure 2 CE). The thousand-grain weight of the three CRI mutant lines increased by 9.6%, 7.8%, and 8.8%, respectively. Figure 2 Figure 2 E).

[0082] It should be noted that the above-described embodiments should be understood as illustrative, not as limiting the scope of protection of this invention. The scope of protection of this invention is defined by the claims. For those skilled in the art, some non-essential improvements and adjustments made to this invention without departing from the essence and scope of this invention still fall within the scope of protection of this invention.

Claims

1. OsNDB2 The use of a gene in regulating rice seed size, characterized in that: By knocking out OsNDB2 The nucleotide sequence of the gene is shown as SEQ ID NO:

01. OsNDB2 The nucleotide sequence of the gene is shown as SEQ ID NO:

01.

2. A method of increasing the size of rice seeds, characterized by: Rice is transformed with a gene editing vector to knock out a gene in the rice OsNDB2 Specifically including the following steps: Step one, amplification OsNDB 2 gene, the nucleotide sequence of the OsNDB 2 gene is shown in SEQ ID NO: 01; Step two, design guide RNA, construct CRISPR / Cas9 vector; the sequence of the guide RNA is: TGGAACCCGTCCCCTCATAATGG; Step three, the CRISPR / Cas9 vector is transformed into Agrobacterium, and after verification, it is transformed into rice to obtain OsNDB2 positive rice plants with gene knockout.

Images