Yeast strain ZB436 and its application

By using yeast ZB436 to ferment soy sauce, the problem of low HEMF content in soy sauce was solved, the concentration of soy sauce aroma and the softness of the taste of soy sauce were increased, and the overall flavor of soy sauce was improved.

CN116064255BActive Publication Date: 2025-09-12FOSHAN HAITIAN GAOMING FLAVORING & FOOD +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211523239.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-28
Publication Date
2025-09-12
Estimated Expiration
2042-11-28

AI Technical Summary

Technical Problem

The low HEMF content in the existing soy sauce brewing process results in a weak soy sauce aroma and low soy sauce flavor concentration, which cannot meet people's demand for soy sauce flavor.

Method used

Fermentation with a highly salt-tolerant yeast strain, ZB436, significantly increased the HEMF content in soy sauce, enhanced the soy sauce aroma, and reduced the acetic acid content to improve the taste.

Benefits of technology

Significantly increase the HEMF content in soy sauce, increase the richness and aroma of soy sauce, improve the taste and flavor of soy sauce, reduce acidity and make the taste softer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116064255B_ABST
    Figure CN116064255B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of microbial fermentation technology, and specifically to a yeast strain ZB436 and its application. Inoculating the yeast ZB436 during the fermentation process of soy mash for fermentation can significantly increase the content of HEMF in soy sauce, enhance the richness of the soy sauce aroma, and improve the taste and flavor of the soy sauce; in addition, the strain of the present invention can significantly increase the ethanol content in soy sauce, increase the richness of the soy sauce, and can also significantly reduce the acetic acid content in soy sauce, reduce the acidity of crude oil, and make the soy sauce taste softer. The HEMF content in the soy sauce with the addition of yeast ZB436 is increased by about 7 times compared with the group without yeast, and the soy sauce has a rich sauce aroma, a mellow aroma, a soft taste, and a greatly improved flavor. Therefore, the strain obtained by screening the present invention can be used as a fermentation functional bacterium in the soy sauce fermentation industry and the food industry, so that the soy sauce product has a prominent sauce flavor and significantly improves the soy sauce flavor.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of microbial fermentation, in particular to a yeast strain ZB436 and applications thereof, and in particular to a yeast strain ZB436 capable of high-yielding 4-hydroxy-2(5)-ethyl-5(2)-methyl-3(2H)furanone (HEMF) and applications thereof in soy sauce production. Background Art

[0002] Soy sauce is a common and indispensable condiment in our daily lives. While soy sauce comes in many varieties, its flavor quality is determined, to a certain extent, by the intensity of its aroma. Soy sauce's aroma is generated through a complex fermentation process, generally believed to be the result of a synergistic interaction of subtle physiological processes, including metabolites from Aspergillus, yeast, and bacteria, as well as non-enzymatic reactions. Among Japanese soy sauce aroma components, 3-methylthiopropionaldehyde (potato, meaty notes), HEMF (caramel), HDMF (caramel), and sotolon (caramel) are most commonly identified as key aroma components. In literature analyzing key aroma components of Chinese soy sauce, 3-methylthiopropionaldehyde, HEMF, HDMF, phenylacetaldehyde (floral), and guaiacol (smoky aroma) are commonly identified as key aroma components. It is not difficult to find that furanones are key aroma components in both Japanese and Chinese soy sauces. In the late 1960s, Japan conducted in-depth research on the main components of soy sauce aroma. From the more than 200 aroma components of soy sauce, 4-hydroxy-2(5)-ethyl-5(2)-methyl-3(2H)furanone (HEMF) was isolated and confirmed to be the fundamental component of soy sauce aroma. After years of systematic research, Nunamura et al. concluded in 1979 that HEMF is the most important characteristic component of soy sauce aroma.

[0003] HEMF is a highly important and widely used flavoring agent among the furan derivatives of the heterocyclic aromatic organic compound family. HEMF has a high boiling point and contributes to the aftertaste, exhibiting a caramel aroma. HEMF possesses a strong aromatic property, and even a trace amount (0.01 ppm) added to food is detectable by human sensory organs. Due to its high activity, HEMF exhibits excellent compatibility with other substances. With its high viscosity, high boiling point, and low volatility, HEMF not only enhances the flavor of food but also acts as a flavor fixative. Soy sauce contains many volatile components, which can easily lose their inherent natural aroma over time or during cooking. HEMF, however, is a nonvolatile substance that suppresses the release of these volatile components, acting as both a primary flavor and a flavor fixative. Soy sauce containing HEMF maintains its aroma even after prolonged storage or heating. More importantly, soy sauce containing HEMF exhibits a more intense aroma over time. Furthermore, HEMF not only serves as a fundamental component of soy sauce's flavor but also has the unique effect of softening its saltiness. Soy sauce containing a very small amount (0.01 ppm) of HEMF significantly softens its saltiness. HEMF is a yeast metabolite, formed from the pentose sugars found in bran. Recent research indicates that soy sauce yeast, after utilizing D-xylose and 5-phosphate from the raw materials, can metabolize HEMF, a representative component of soy sauce's aroma, through a metabolic pathway involving pentoses and phosphates. HEMF is the substance that gives soy sauce its distinctive caramel aroma. Due to its tumor-suppressing properties, it is an important naturally active substance in soy sauce.

[0004] The soy sauces currently on the market are basically the same in traditional brewing technology and raw materials. However, due to the shortened brewing cycle, the HEMF content of the output is low, and the overall aroma of the brewed soy sauce is weak and the concentration of the soy sauce flavor is low, which cannot meet people's demand for soy sauce flavor. Summary of the Invention

[0005] The present invention aims to overcome the shortcomings of the above-mentioned prior art and provide a yeast strain (Wickerhamiella versatilis) ZB436 with high salt tolerance. When the yeast strain (Wickerhamiella versatilis) ZB436 is inoculated into soy sauce mash for fermentation, it can significantly improve the aroma of soy sauce, increase the HEMF content in soy sauce, and enhance the soy sauce flavor of the soy sauce. In addition, the strain can significantly increase the ethanol content in soy sauce, thereby increasing the richness of the soy sauce. The strain can also significantly reduce the acetic acid content in soy sauce and reduce the acidity of crude oil, making the soy sauce taste softer and thus improving the quality of the soy sauce.

[0006] To achieve the above objectives, the inventors, through extensive experiments and unremitting exploration, finally obtained the following technical solutions:

[0007] For the first purpose, the present invention provides a yeast (Wickerhamiella versatilis) ZB436, which was deposited in Guangdong Provincial Microbiological Culture Collection Center on June 29, 2021, with the deposit number GDMCC NO: 61754, and the deposit address is Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0008] The colony characteristics of the yeast (Wickerhamiella versatilis) ZB436 of the present invention are as follows:

[0009] The yeast (Wickerhamiella versatilis) ZB436 is cultured on a PDA solid culture medium at 30° C. for 2-3 days to grow opaque, milky white, round colonies with neat edges and a smooth, dry surface.

[0010] The yeast (Wickerhamiella versatilis) ZB436 of the invention is obtained from fermented mash through multiple plate screenings.

[0011] Specifically, the screening method of the yeast (Wickerhamiella versatilis) ZB436 of the present invention is as follows:

[0012] Different mashes from production were selected, gradiently diluted with physiological saline, and then spread on a solid culture medium containing 8% NaCl in malt extract. The colonies that grew were selected for further separation and purification on a solid culture medium containing 8% NaCl in malt extract. Ten single colonies with different morphologies were selected and inoculated into a solid culture medium containing 18% NaCl by dot-grafting for secondary screening. The colonies grown on the maltose solid culture medium were inoculated into a TTC double-layer culture medium by dot-grafting. Six strains with different alcohol fermentation abilities were selected based on the color development, which were the candidate salt-tolerant yeast strains. The cell morphology of the candidate yeasts was observed using an optical microscope to determine the yeast morphological characteristics.

[0013] The salt-tolerant strains screened out above were inoculated into mash for small-scale fermentation. Based on the aroma components of crude oil, a yeast strain with high HEMF production was screened out and named as yeast (Wickerhamiella versatilis) ZB436.

[0014] Yeast (Wickerhamiella versatilis) ZB436 was deposited in the Guangdong Provincial Microbiological Culture Collection Center on June 29, 2021, with the deposit number GDMCC NO: 61754, and the deposit address is Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0015] In some embodiments, the malt extract solid culture medium containing 8% NaCl is a commercial malt extract culture medium, and its formula (mass percentage) is: 8% NaCl, 2% agar, and 0.1‰ chloramphenicol.

[0016] In some embodiments, the formula of the TTC lower layer culture medium (mass percentage) is: 5% glucose, 1% tryptone, 0.8% yeast extract, 0.5% KH2PO4, 0.2% MgSO4·7H2O, 0.15% citric acid, and 2% agar.

[0017] In some embodiments, the formula of the TTC top layer medium (mass percentage) is: 0.05% TTC, 0.5% glucose, and 2% agar.

[0018] The second purpose of the present invention is to provide the use of the yeast (Wickerhamiella versatilis) ZB436 in the preparation of fermented seasonings.

[0019] As a preferred embodiment of the application of the present invention, the fermented condiment includes soy sauce or paste.

[0020] Yeast (Wickerhamiella versatilis) ZB436 was added to the soy sauce mash during the fermentation process. Subsequent fermentation was carried out according to the conventional fermentation method for soy sauce mash. After the fermentation, the aroma components of the soy sauce were analyzed by GC-MS. The HEMF content in the soy sauce with the addition of ZB436 yeast increased by about 7 times compared with the group without yeast. The soy sauce also had a rich sauce aroma, a mellow aroma, a soft taste, and a greatly improved flavor.

[0021] Adding the yeast Wickerhamiella versatilis ZB436 to the condiment fermentation process significantly increased the HEMF content in the resulting soy sauce's aroma. While the overall aroma richness increased, the proportion of ethanol also increased, while the proportion of acetic acid significantly decreased. This suggests that applying the yeast Wickerhamiella versatilis ZB436 to soy sauce fermentation can effectively increase the HEMF content in the sauce, while simultaneously increasing ethanol and reducing acetic acid, thereby improving the flavor profile of the sauce.

[0022] The third purpose of the present invention is to provide the use of the yeast (Wickerhamiella versatilis) ZB436 in increasing the HEMF content during the soy sauce fermentation process.

[0023] The fourth object of the present invention is to provide a method for preparing the above-mentioned soy sauce, comprising the following steps:

[0024] i) inoculating a bacterial solution containing the yeast (Wickerhamiella versatilis) ZB436 into the fermented mash;

[0025] ii) continuing to ferment the mash obtained in i) for 7-60 days;

[0026] iii) squeezing, filtering and sterilizing the fermented soy sauce mash obtained in ii) to obtain crude soy sauce.

[0027] As a preferred embodiment of the preparation method of the present invention, in step i), the concentration of yeast (Wickerhamiella versatilis) ZB436 in the bacterial solution is 5.0×10 7 -1.5×10 8 cfu / mL; the inoculation amount of the bacterial solution is 0.5-2%.

[0028] The concentration of yeast (Wickerhamiella versatilis) ZB436 was 5.0×10 7 -1.5×10 8 cfu / mL was inoculated into the fermented mash. On the 40th day, the fermented mash was inoculated with the mature bacterial solution containing the above yeast (Wickerhamiella versatilis) ZB436, and the yeast inoculation amount was 10 4 ~10 6 cfu / g mash.

[0029] The fifth purpose of the present invention is to provide a soy sauce, which is prepared by the soy sauce preparation method.

[0030] The present invention utilizes yeast (Wickerhamiella versatilis) ZB436 to ferment soy sauce, which significantly improves its aroma and overall taste. Sensory evaluation experiments show that the soy sauce fermented with yeast (Wickerhamiella versatilis) ZB436 has a rich aroma, a distinct sauce aroma, and a mellower aroma. Furthermore, the soy sauce has a smoother mouthfeel, a richer texture, and a more balanced taste.

[0031] In summary, adding yeast (Wickerhamiella versatilis) ZB436 to the mash for fermentation can significantly improve the taste and aroma of fermented soy sauce.

[0032] The sixth object of the present invention is to provide a method for increasing the HEMF content in fermented soy sauce, comprising adding the above-mentioned yeast (Wickerhamiella versatilis) ZB436 for fermentation.

[0033] The invention provides a yeast strain (Wickerhamiella versatilis) ZB436. Inoculating the yeast strain (Wickerhamiella versatilis) ZB436 during a soy sauce mash fermentation process for fermentation can significantly increase the HEMF content in soy sauce, enhance the richness of the soy sauce aroma, and improve the taste and flavor of the soy sauce.

[0034] The seventh purpose of the present invention is to provide the use of the yeast (Wickerhamiella versatilis) ZB436 in increasing the ethanol content and reducing the acetic acid content during the soy sauce fermentation process.

[0035] Inoculating the yeast (Wickerhamiella versatilis) ZB436 during the fermentation process of mash can significantly increase the ethanol content in soy sauce, increasing the richness of the soy sauce. The strain can also significantly reduce the acetic acid content in soy sauce and lower the acidity of crude oil, making the soy sauce taste softer. The strain screened by the present invention can be used as a fermentation functional bacteria in the soy sauce fermentation industry and the food industry, giving the soy sauce product a prominent soy sauce flavor and significantly improving the soy sauce flavor.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] The present invention provides a yeast (Wickerhamiella versatilis) ZB436 and its application. The yeast (Wickerhamiella versatilis) ZB436 is inoculated during the fermentation process of the soy sauce mash for fermentation, which can significantly increase the content of HEMF in soy sauce, improve the richness of the soy sauce aroma, and improve the taste and flavor of the soy sauce. In addition, the strain of the present invention can significantly increase the ethanol content in soy sauce, increase the richness of soy sauce, and can also significantly reduce the acetic acid content in soy sauce, reduce the acidity of crude oil, and make the soy sauce taste softer. The HEMF content in the soy sauce with the addition of yeast (Wickerhamiella versatilis) ZB436 is increased by about 7 times compared with the group without yeast, and the soy sauce has a strong sauce aroma, a mellow aroma, a soft mouthfeel, and a greatly improved flavor. Therefore, the strain obtained by screening the present invention can be used as a fermentation functional bacterium in the soy sauce fermentation industry and the food industry, so that the soy sauce product has a prominent sauce flavor and significantly improves the soy sauce flavor. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 The figure is a flow chart of the screening process of the yeast (Wickerhamiella versatilis) ZB436 of the present invention.

[0039] Figure 2 4 is a microscopic morphological diagram of the yeast (Wickerhamiella versatilis) ZB436 of the present invention. DETAILED DESCRIPTION

[0040] In order to promote understanding of the present invention, the following will be referenced to certain embodiments and will use specific language to describe the present invention. However, it should be understood that these specific embodiments are not intended to limit the scope of the present invention. Any changes and further modifications in the described embodiments, as well as any further applications of the present invention, are generally contemplated by those skilled in the art.

[0041] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0042] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0043] In the following examples, the percentages are by mass unless otherwise specified.

[0044] The present invention is based on fermented mash, and different mash samples are selected as screening samples. The selected mash is spread and cultured on a salted malt extract solid culture medium to preliminarily screen out salt-tolerant yeasts, and colonies with different colony sizes and morphologies are selected and separated and purified by streaking on this culture medium; single colonies are picked from the streaked plate and rescreened on a salted maltose culture medium and a TTC colorimetric screening culture medium to observe their growth characteristics, and strains with different growth traits are selected for microscopic examination, and finally 10 strains with different colony morphologies and growth traits are screened out. The screened strains are added to the mash for fermentation, and by measuring the aroma components of the fermented soy sauce, a yeast strain ZB436 that can significantly increase the HEMF content in the soy sauce aroma is selected. The screened yeast strains are sequenced and preserved. The effect of adding yeast to the mash for fermentation on the quality of soy sauce is evaluated by sensory evaluation and determination of physical and chemical indicators.

[0045] Example 1. Initial screening of yeast (Wickerhamiella versatilis) ZB436

[0046] Initial screening of strains:

[0047] Select different batches of production mash, dilute the mash to 10% with sterile saline. - 1, 10 -2 , 10 -3 , 10 -4 Concentration was obtained to prepare a mash dilution. 0.1 mL of the mash dilution was evenly spread on a solid wort medium (commercial wort medium, 8% NaCl, 2% agar, 0.1‰ chloramphenicol) supplemented with 8% NaCl and incubated at 30°C for 48 to 72 hours. During this period, single colonies with different sizes, colors, and colony morphologies were selected at different incubation times based on the growth of the colonies. The selected single colonies were numbered 1 to 10 in sequence. The growth time and colony morphology of each colony are detailed in Table 1. Colonies 1 to 10 were continuously streaked on a solid wort medium (commercial wort medium, 8% NaCl, 2% agar, 0.1‰ chloramphenicol) plate supplemented with 8% NaCl until single colonies with uniform morphology were isolated by streaking.

[0048] Table 1 Primary screening results of salt-tolerant yeast plate coating

[0049]

[0050]

[0051] Example 2, rescreening of yeast (Wickerhamiella versatilis) ZB436

[0052] 1. Rescreening of strain growth characteristics:

[0053] Single colonies 1 to 10 obtained by streaking were sequentially inoculated onto a maltose solid medium containing 18% NaCl by dot-grafting and incubated inverted at 30°C for 48 to 72 h. Single colonies that could grow on the maltose medium (5% maltose, 1% casein, 0.2% yeast extract, 0.2% KH2PO4, 0.05% MgSO4·7H2O, 18% NaCl, 2% agar, pH 4.8) were selected for subsequent screening. The maltose assimilation ability of each strain is detailed in Table 2.

[0054] Six bacterial strains that can grow normally on maltose medium were inoculated by spot inoculation into TTC lower medium (5% glucose, 1% tryptone, 0.8% yeast extract, 0.5% KH2PO4, 0.2% MgSO4·7H2O, 0.15% citric acid, 2% agar) and cultured inverted at 30°C for 48 h. Then, about 12 mL of TTC upper medium (0.05% TTC, 0.5% glucose, 2% agar) cooled to 46°C was poured onto the TTC lower medium. After solidification, the upper medium was cultured at 30°C in the dark for 3 to 5 h. The color change of the colonies is shown in Table 3.

[0055] Table 2 Results of maltose medium rescreening of salt-tolerant yeast

[0056]

[0057] Table 3 TTC medium rescreening results of salt-tolerant yeast

[0058]

[0059]

[0060] 2. Microscopic examination of yeast morphology:

[0061] Place 1 to 2 drops of sterile saline solution in the center of the slide. Use a sterile toothpick to pick up a small yeast colony and spread it evenly in the saline solution. Cover with a coverslip and examine under a microscope using a 10× eyepiece magnification and a 20× objective lens. The results are shown in Table 4.

[0062] Table 4 Microscopic morphological results of salt-tolerant yeast

[0063] strain number 1 3 4 7 9 10 Microscopic morphology round Oval round round round round

[0064] The cell morphologies of the selected yeasts were all different. The cell morphologies of yeasts 1 and 4 were relatively similar, with the individual cells being larger and round, while those of yeasts 7, 9, and 10 were relatively similar, with the cells being smaller and round, and only the cell morphology of yeasts 3 was oval.

[0065] Example 3: Effect of yeast (Wickerhamiella versatilis) ZB436 in soy sauce fermentation

[0066] The yeast strains selected in Example 2 were inoculated into the mash for fermentation. The specific operation steps were as follows: 1, 3, 4, 7, 9, and 10 were respectively subjected to liquid culture, and the liquid culture medium was a commercial malt extract medium containing 8% NaCl (purchased from Guangdong Huankai Microbiological Technology Co., Ltd., item number: 021120). Inoculation was performed at a 1% inoculum size, and cultured at 30°C and 150 rpm for 24-36 hours. When the yeast concentration reached 10 8 cfu / mL and inoculated into the mash.

[0067] On the 40th day, the fermented mash was inoculated with the culture solution containing the above yeast strains. The inoculation amount of the yeast strain was 10 5 cfu / g sauce mash, and subsequent fermentation was carried out according to conventional methods until the sauce mash was fermented to maturity. The physical and chemical indicators and aroma components of the fermented crude oil were detected. Among them, the HEMF content of the fermented crude oils No. 1, 7, and 9 was increased compared with the control crude oil. The HEMF increase effect in the fermented crude oil No. 9 was the most significant. The No. 9 strain was named yeast (Wickerhamiella versatilis) ZB436. The test results of the physical and chemical indicators and aroma components of the crude oil are detailed in Tables 5 and 6. Its microscopic morphology is shown in Figure 2 .

[0068] Table 5 Physical and chemical indicators of soy sauce fermented by yeast (Wickerhamiella versatilis) ZB436

[0069]

[0070]

[0071] As shown in Table 5, when yeast (Wickerhamiella versatilis) ZB436 was added to the mash for fermentation, the key physical and chemical indicators of the soy sauce in the experimental group did not change significantly at the end of fermentation compared with the control group. That is, the addition of yeast (Wickerhamiella versatilis) ZB436 for mash fermentation did not affect the key quality indicators of the soy sauce.

[0072] The aroma components of fermented crude oil were measured using gas chromatography-mass spectrometry. Under the existing analytical conditions, a total of 141 aroma compounds were detected in the control soy sauce (fermented without yeast strains), and a total of 146 aroma compounds were detected in the experimental soy sauce (fermented with the yeast Wickerhamiella versatilis ZB436). The number of aroma compounds in each category in the experimental and control crude oils is detailed in Table 6.

[0073] Table 6 Quantity of alcohols and acids in fermented soy sauce

[0074]

[0075] In terms of aroma compound types, crude oil fermented with the yeast Wickerhamiella versatilis ZB436 exhibited a higher aroma abundance. The proportion of aroma compounds such as alcohols and esters in crude oil fermented with the yeast Wickerhamiella versatilis ZB436 increased significantly, while the proportion of acids decreased significantly. The increase in alcohols was primarily due to increased phenylethanol and ethanol content, while esters benefited from a significant increase in their abundance. The decrease in acids was primarily due to a decrease in acetic acid content. Detailed data are shown in Tables 7 and 8.

[0076] Table 7 Components of different aroma categories of fermented soy sauce

[0077]

[0078]

[0079] Table 8 Contents of key aroma substances in soy sauce fermented with yeast (Wickerhamiella versatilis) ZB436

[0080] type Substance name No yeast added Add yeast ZB435 Alcohols ethanol 39.56% 48.16% Ketones HEMF 0.13% 0.91% Acids Acetic acid 12.47% 4.04%

[0081] Note: Aroma ratio is the ratio of the sum of the peak area integral values ​​of a certain flavor substance to the sum of the peak area integral values ​​of all flavor substances.

[0082] The results in Table 8 show that the HEMF content in soy sauce fermented with the yeast Wickerhamiella versatilis ZB436 was significantly higher than that in the unfermented soy sauce, with a 7-fold increase, the most significant among all aroma compounds. While the overall aroma richness increased, the ethanol intensity also increased, and the proportion of acetic acid decreased significantly. This indicates that the application of the yeast Wickerhamiella versatilis ZB436 to soy sauce fermentation can effectively increase the HEMF content in soy sauce, while simultaneously increasing ethanol and reducing acetic acid, thereby improving the flavor profile of the soy sauce.

[0083] Example 4: Sensory Evaluation of Soy Sauce Fermented with Yeast (Wickerhamiella versatilis) ZB436

[0084] Eighteen assessors with rich experience in sensory evaluation were recruited to conduct a sensory evaluation of soy sauce with and without the addition of yeast (Wickerhamiella versatilis) ZB436. The sensory evaluation method was based on GB 2717-2018. The sensory evaluation indicators included five key indicators of the soy sauce: umami flavor, body, overall taste, color, and aroma. The score ranged from 0 to 5 points. A higher score indicated that the soy sauce had a better indicator.

[0085] The scores of all sensory evaluators were counted, and the average scores of various indicators were calculated. The sensory evaluation results are summarized in Table 9.

[0086] Table 9 Sensory evaluation results of soy sauce

[0087]

[0088] As shown in the results in Table 9, soy sauce fermented with the yeast Wickerhamiella versatilis ZB436 showed significant improvements in aroma and overall taste, scoring higher than soy sauce fermented without yeast. The reviewers noted that soy sauce fermented with the yeast Wickerhamiella versatilis ZB436 had a rich aroma, a distinct sauce flavor, and a mellower flavor. The soy sauce also had a smoother, fuller mouthfeel, and a more balanced taste. In summary, adding the yeast Wickerhamiella versatilis ZB436 to fermented soy sauce mash significantly improved its taste and aroma.

[0089] Example 5, Identification of yeast (Wickerhamiella versatilis) ZB436

[0090] A liquid culture of yeast (Wickerhamiella versatilis) ZB436 was obtained as in Example 3, and the yeast genome was extracted using the Ezup column-based yeast genomic DNA extraction kit (Shanghai Sangon) for PCR amplification and molecular identification.

[0091] The PCR reaction system included: Taq PCR Master Mix (2×) 15 μL, universal primers NL1 (GCATATCAATAAGCGGAGGAAAAG) and NL4

[0092] The reaction volume was 30 μL, with 1 μL each of the primers (GGTCCGTGTTTCAAGACGG) and 1 μL of genomic template. After the reaction, 5 μL of the PCR amplification product was analyzed by agarose gel electrophoresis, revealing a single, clear, bright band in each lane. The remaining PCR amplification product was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0093] The 26S rDNA region of yeast (Wickerhamiella versatilis) ZB436 was amplified using PCR, and the sequencing result of the PCR amplification product is shown in SEQ ID NO: 1.

[0094] The sequencing results were compared using BLAST sequencing on NCBI. The results showed that the strain had a high degree of homology with the Wickerhamiella versatilis strain. Therefore, the strain was considered to be a Wickerhamiella versatilis yeast derived from mash.

[0095] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A yeast strain ( Wickerhamiella versatilis ) ZB436, characterized in that The yeast ( Wickerhamiella versatilis ) ZB436 was deposited in the Guangdong Provincial Microbiological Culture Collection on June 29, 2021, with the deposit number GDMCC NO: 61754, and the deposit address is Building 59, No. 100 Xianlie Middle Road, Guangzhou.

2. The yeast according to claim 1 ( Wickerhamiella versatilis ) Application of ZB436 in the preparation of soy sauce.

3. The yeast according to claim 1 ( Wickerhamiella versatilis ) Application of ZB436 in increasing HEMF content during soy sauce fermentation.

4. A method for preparing soy sauce, characterized in that: The following steps are involved: i) inoculating the fermented mash with the yeast ( Wickerhamiella versatilis ) ZB436 bacterial solution; ii) continuing to ferment the mash obtained in i) for 7-60 days; iii) The fermented soy sauce mash obtained in ii) is squeezed, filtered, and sterilized to obtain crude soy sauce.

5. The preparation method according to claim 4, wherein In step i), the yeast in the bacterial solution ( Wickerhamiella versatilis ) The concentration of ZB436 was 5.0×10 7 -1.5×10 8 cfu / mL; the inoculation amount of the bacterial solution is 0.5~2%.

6. A method for increasing the HEMF content in fermented soy sauce, characterized in that: comprising adding the yeast according to claim 1 ( Wickerhamiella versatilis )ZB436 for fermentation.

7. The yeast according to claim 1 ( Wickerhamiella versatilis ) Application of ZB436 in increasing ethanol content and reducing acetic acid content during soy sauce fermentation.