Recombinant Streptomyces freundii modified with nagB gene, preparation method and application thereof

Abstract

The present invention provides a recombinant Streptomyces freundii strain modified with nagB gene, a preparation method and an application thereof, wherein the recombinant strain contains P sco4503 The present invention is the first to overexpress the nagB gene in Streptomyces freundii and to express the exogenous fusion gene by P sco4503 The promoter is used to regulate the expression level of glucosamine-6-phosphate deaminase in Streptomyces freundii, thereby improving the neomycin synthesis ability of the recombinant bacteria, providing a new strategy for increasing the neomycin yield. Compared with the original Streptomyces freundii strain, the neomycin yield of the recombinant Streptomyces freundii strain obtained by the present invention was increased by 15.5%.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering bacteria transformation, in particular to a nagB gene-transformed Streptomyces freundii recombinant bacterium, a preparation method and an application thereof. Background Art

[0002] Streptomyces belongs to the family Streptomycetes in the order Actinomycetes of the kingdom Prokaryotes, with a diverse genome and a very high GC content (70-76%). About 70% of antibiotics in nature are produced by Streptomyces and its closely related actinomycetes. Neomycin is an aminoglycoside antibiotic produced by Streptomyces freundii, which can interfere with protein synthesis and is one of the most commonly used veterinary antibiotics at home and abroad. Its main components are neomycin B and C, as well as a small amount of neomycin A. Compared with other components, neomycin B has strong activity and low toxicity, and is the main component that needs to be monitored during the fermentation process.

[0003] At present, the neomycin produced in my country is mainly used for export to Europe, America and other places, and there is a tendency that supply cannot meet demand. However, the production of neomycin in my country is low and the cost is high. The research methods used by industrial manufacturers still remain at the random mutagenesis or optimization of culture conditions used in the 1980s. There is a lack of operations to rationally transform the strains themselves to improve the ability to synthesize neomycin. A new contradiction has formed between the relatively backward strain improvement technology and the growing supply demand. Therefore, how to rationally transform the neomycin production strains to further increase their production and meet the needs of the microbial pharmaceutical market is a key issue that needs to be solved urgently.

[0004] Glucosamine-6-phosphate deaminase (NagB) is present in the UDP-GlcNAc biosynthesis pathway in Streptomyces freundii. The UDP-GlcNAc synthesis pathway in Streptomyces freundii includes the following steps: UDP-GlcNAc is synthesized from fructose-6-phosphate (Fru-6-P) in four consecutive enzymatic reactions by three enzymes: GlcNAc kinase (GlmS), GlcNAc phosphomutase (GlmM) and UDP-GlcNAc pyrophosphorylase (GlmU), specifically: first, fructose-6-phosphate (Fru-6-P) is converted into glucosamine-6-phosphate (GlcN-6-P) by GlcNAc kinase (GlmS), and at the same time, glucosamine-6-phosphate (GlcN-6-P) is also reversely converted into fructose-6-phosphate (Fru-6-P) under the action of glucosamine-6-phosphate deaminase (NagB); then, under the phosphorylation state of GlcNAc phosphomutase (GlmM), GlcN-6-P catalyzes the generation of glucosamine-1-phosphate (D-GlcN-1P); finally, D-GlcN-1-P is acetylated to form acetylglucosamine-1-phosphate (GlcNAc-1-P) under the action of UDP-GlcNAc pyrophosphorylase (GlmU), and GlcNAc-1-P is further acetylated to form UDP-GlcNAc (such as Figure 1 As shown). It can be seen that NagB is the key enzyme for converting GlcN-6-P to Fru-6-P in Streptomyces freundii. However, the relationship between regulating the expression level of NagB and the production of neomycin by Streptomyces freundii after fermentation has not yet been resolved and is unpredictable. Summary of the invention

[0005] One of the purposes of the present invention is to provide a nagB gene-modified Streptomyces freundii ( Streptomyces fradiae ) recombinant bacteria to improve the strain's neomycin production capacity.

[0006] The recombinant Streptomyces freundii transformed with nagB gene contains P sco4503 An exogenous fusion gene formed by sequentially splicing the promoter, nagB gene and terminator.

[0007] The present invention is the first to overexpress the nagB gene in Streptomyces freundii and to sco4503 The promoter is used to regulate the expression level of glucosamine-6-phosphate deaminase (NagB) in Streptomyces freundii, thereby improving the neomycin synthesis ability of the recombinant bacteria, providing a new strategy for increasing the neomycin yield. Compared with the original Streptomyces freundii strain, the neomycin yield of the recombinant Streptomyces freundii strain obtained by the present invention is increased by 15.5%.

[0008] Preferably, the P sco4503 The promoter was selected from Streptomyces coelicolor ( Streptomyces coelicolor ) sco4503 The promoter, whose nucleotide sequence is shown in SEQ ID NO.2; the nagB gene is selected from the nagB gene derived from Streptomyces freundii, whose nucleotide sequence is shown in SEQ ID NO.1.

[0009] Preferably, the terminator is the terminator Taph derived from Streptomyces freundii, and the nucleotide sequence of the terminator is shown in SEQ ID NO.6.

[0010] The second object of the present invention is to provide a method for constructing a recombinant Streptomyces freundii strain modified with the nagB gene as described in the first object of the present invention, wherein P sco4503 The promoter, nagB gene and terminator are sequentially spliced ​​by SOE-PCR to form an exogenous fusion gene, and the exogenous fusion gene is introduced into the original Streptomyces fragilis through an expression plasmid to obtain a recombinant Streptomyces fragilis, wherein the original Streptomyces fragilis is a Streptomyces fragilis that produces neomycin.

[0011] Preferably, the original Streptomyces freundii is Streptomyces freundii Sf01 ( Streptomyces fradiae Sf01), the Streptomyces freundii Sf01 was deposited in the China Center for Type Culture Collection in Wuhan on January 21, 2022, with the preservation number being CCTCC NO: M 2022111.

[0012] Preferably, the expression plasmid is plasmid pSET152. Plasmid pSET152 is an E. coli-Streptomyces shuttle plasmid, which has the oriT functional region for conjugative transfer, the Streptomyces selection marker-ampramycin resistance gene acc3 (IV), the integrase gene int (φC31), and the attP site of the Streptomyces temperate phage φC31. Therefore, plasmid pSET152 can be introduced into Streptomyces using a simple and efficient inter-generic conjugative transfer method, and can be integrated into the attB site of the Streptomyces chromosome through specific recombination, and replicated along with the replication of the host chromosome.

[0013] The method for constructing a recombinant Streptomyces freundii modified with the nagB gene according to the second object of the present invention comprises the following specific steps:

[0014] (1) Using the genomic DNA of Streptomyces freundii Sf01 as a template, PCR was performed to amplify the nagB gene and the terminator, wherein the terminator is specifically the terminator Taph; using the genome of Streptomyces coelicolor M145 as a template, PCR was performed to amplify the P sco4503 Promoter; the P sco4503 The promoter, the nagB gene and the terminator are sequentially spliced ​​together to form the exogenous fusion gene;

[0015] (2) The expression plasmid is pSET152, and the pSET152 plasmid is used as a template for PCR amplification to obtain the pSET152 linearized vector; the primers are G-T5-F and G-T5-R,

[0016] G-T5-F: atcgaattcgtaatcatgtcatagctgtttcctg,

[0017] G-T5-R: gcttggcactggccgtcgttttac;

[0018] (3) The pSET152 linearized vector obtained in step (2) was recombined with the exogenous fusion gene obtained in step (1) to obtain a recombinant product, and the recombinant product was transformed into the competent Escherichia coli DH5α, and the bacteria were spread on an apramycin resistance plate for screening, and cultured in a 37°C incubator to obtain transformants; and colony PCR was performed to verify that positive transformants were obtained, and sequencing was performed to confirm that the expression vector pSET-P sco4503 - nagB;

[0019] (4) The expression vector pSET-P obtained in step (3) was transferred into sco4503 - nagB was transferred into the original Streptomyces freundii, and the original Streptomyces freundii was specifically selected from Streptomyces freundii Sf01, and the binder Sf01 / pSET-P was obtained by screening. sco4503 - nagB, i.e., the recombinant Streptomyces freundii.

[0020] The third object of the present invention is to use the nagB gene modified Streptomyces freundii recombinant bacteria in the production of neomycin. Further, the application includes fermentation culture, and the fermentation medium formula used for the fermentation culture is: 10-30g / L glucose, 50-90g / L corn starch, 10-30g / L peptone, 3-9g / L yeast powder, 20-40g / L peanut meal, 3-9g / L ammonium sulfate, 2-10g / L sodium chloride, 0.1-0.5g / L disodium hydrogen phosphate, 1-8g / L light calcium carbonate, 0.1-0.5g / L amylase, pH 7.2-7.7. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a schematic diagram of the existing UDP-GlcNAc synthesis pathway. DETAILED DESCRIPTION

[0022] The specific implementation mode of the present invention is described in detail below:

[0023] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art; the reagents or materials described, unless otherwise specified, are all from commercial channels.

[0024] The nagB gene-modified recombinant Streptomyces freundii of the present invention contains P sco4503 An exogenous fusion gene formed by sequentially splicing the promoter, nagB gene and terminator.

[0025] The method for constructing the recombinant Streptomyces freundii transformed with the nagB gene is as follows: sco4503 The promoter, nagB gene and terminator were sequentially spliced ​​by SOE-PCR (i.e., overlap extension PCR) to form an exogenous fusion gene, and the exogenous fusion gene was introduced into the original Streptomyces freundii through an expression plasmid to obtain a recombinant Streptomyces freundii strain, wherein the original Streptomyces freundii was a neomycin-producing Streptomyces freundii strain. The specific construction steps are:

[0026] (1) Using the genomic DNA of Streptomyces freundii Sf01 as a template, PCR was performed to amplify the nagB gene (primers used were: nagB-F and nagB-R) and the terminator, wherein the terminator was specifically the terminator Taph (primers used were: Taph-F and Taph-R); using the genome of Streptomyces coelicolor M145 as a template, PCR was performed to amplify the P sco4503 promoter (primers used were: 4503-F and 4503-R); the P sco4503 The promoter, the nagB gene and the terminator Taph are sequentially spliced ​​together to form the exogenous fusion gene;

[0027] Among them, the P sco4503 The nucleotide sequence of the promoter is shown in SEQ ID NO.2; the nucleotide sequence of the nagB gene is shown in SEQ ID NO.1; the nucleotide sequence of the terminator is shown in SEQ ID NO.6;

[0028] The primers used are as follows:

[0029] nagB-F:gtggaagttgtcatcgtcca、

[0030] nagB-R:ctagagcccctgccaggagg;

[0031] Taph-F:cctcctggcaggggctctagcgagttcttctagagccgcc、

[0032] Taph-R: gctatgacatgattacgaattcgatcggctcccggccaggccg;

[0033] 4503-F: gtaaaacgacggccagtgccaagccctcgccgagcggggaggg,

[0034] 4503-R: tggacgatgacaacttccacgggcggctcctgggacgtg;

[0035] (2) The expression plasmid is pSET152. The pSET152 plasmid is used as a template for PCR amplification to obtain a pSET152 linearized vector. The primers are G-T5-F and G-T5-R.

[0036] G-T5-F: atcgaattcgtaatcatgtcatagctgtttcctg,

[0037] G-T5-R: gcttggcactggccgtcgttttac;

[0038] The pSET152 plasmid is an existing commonly used plasmid, which can be constructed by yourself or purchased;

[0039] (3) The pSET152 linearized vector obtained in step (2) was recombined with the exogenous fusion gene obtained in step (1) to obtain a recombinant product (using ClonExpress II Recombination Cloning Kit, purchased from Nanjing Novogene Biotechnology Co., Ltd.), and the obtained recombinant product was transformed into Escherichia coli DH5α competent cells, and the bacteria were spread on apramycin resistance plate for screening, and cultured in a 37°C incubator to obtain transformants; and the transformants were verified by colony PCR, using primers M13-47 and M13-48. If the target band of 1387 bp appeared, the next step of sequencing was performed. The nucleotide sequence of the vector was determined by Sangon Biotechnology (Shanghai) Co., Ltd.; after sequencing, the expression vector pSET-P was obtained. sco4503 -nagB, where

[0040] M13-47:agggttttcccagtcacg、

[0041] M13-48:gagcggataacaatttcacac;

[0042] (4) The expression vector obtained in step (3) is transferred into the original Streptomyces freundii by conjugation transfer, wherein the original Streptomyces freundii is specifically selected from Streptomyces freundii Sf01, and the conjugate Sf01 / pSET-P is obtained by screening. sco4503 - nagB, i.e., the recombinant Streptomyces freundii;

[0043] Furthermore, using the same method as above, the inventors selected a variety of promoters during the experiment, including P sco4658 (whose sequence is shown in SEQ ID NO.3), P sco2468 (whose sequence is shown in SEQ ID NO.4), P sco5768 (whose sequence is shown in SEQ ID NO. 5), etc., respectively using the above P sco4658 , P sco2468 , P sco5768 Promoter to expression vector pSET-P sco4503 -P in nagB sco4503 The promoter was replaced and these expression vectors were transferred into Streptomyces freundii Sf01 to construct recombinant Streptomyces freundii mediated by different promoters, namely: Sf01 / pSET- P sco4658 - nagB, Sf01 / pSET-P sco2468 - nagB, Sf01 / pSET-P sco5768- nagB. In addition, as a control group, a recombinant strain of Streptomyces freundii without the exogenous fusion gene formed by splicing the promoter and the nagB gene was constructed, namely Sf01 / pSET152;

[0044] The primers used are as follows:

[0045] 4658-F:gtaaaacgacggccagtgccaagcgcgccgggtagagcgggaag

[0046] 4658-R: tggacgatgacaacttccaccgcgcctccctcctcatgaccttg

[0047] 2468-F:gtaaaacgacggccagtgccaagccgcgcgcacggcggcggcatc

[0048] 2468-R: tggacgatgacaacttccacgcgtgaagtctacgggggcggac

[0049] 5768-F: gtaaaacgacggccagtgccaagccccgaggactcggggccgtag

[0050] 5768-R: tggacgatgacaacttccacgtgcgtcccctctccgacct

[0051] Among them, the Streptomyces freundii Sf01 was deposited in the China Center for Type Culture Collection in Wuhan on January 21, 2022, with the deposit number of CCTCC NO: M 2022111;

[0052] The inventors also separately transformed the above-mentioned Sf01 / pSET152, Sf01 / pSET-Psco 4503 -nagB, Sf01 / pSET-Psco 4658 -nagB, Sf01 / pSET-Psco 2468 -nagB, Sf01 / pSET-Psco 5768-nagB was used in the production of neomycin. First, each recombinant bacterium was inoculated into 25 mL of TSBY liquid medium at 1% by volume from a glycerol tube, and cultured in a shaking incubator at 230 r / min and 35°C for 48 h to obtain the seed culture solution required for fermentation. Next, fermentation culture is carried out. The formula of the fermentation medium is: 10-30g / L glucose, 50-90g / L corn starch, 10-30g / L peptone, 3-9g / L yeast powder, 20-40g / L peanut meal, 3-9 g / L ammonium sulfate, 2-10g / L sodium chloride, 0.1-0.5g / L disodium hydrogen phosphate, 1-8g / L light calcium carbonate, 0.1-0.5g / L amylase, and the pH is adjusted to 7.2-7.7 before sterilization; the specific steps of fermentation culture are: the fermentation medium is loaded into a 250 mL conical flask (the liquid volume of each bottle is 25 mL), and then the seed culture solution is inoculated into the corresponding fermentation medium at an inoculation rate of 4% (v / v), and after the inoculation is completed, it is cultured in a shaking incubator at 230 r / min and 35°C for 7 days.

[0053] And for the above-mentioned Sf01 / pSET152, Sf01 / pSET-Psco 4503 -nagB, Sf01 / pSET-Psco 4658 -nagB, Sf01 / pSET-Psco 2468 -nagB, Sf01 / pSET-Psco 5768 -nagB fermentation broth for neomycin production detection. The specific detection method is: using HPLC-ELSD method to determine, first weigh a certain weight of the fermentation broth sample, dilute it several times with pH=2 sulfuric acid aqueous solution, centrifuge at 12000 r / min for 10 min, filter the supernatant through the filter membrane, and place it in the injection bottle. The detection conditions are: C18 chromatographic column (250 mm×4.6 mm, 5 μm); mobile phase: 0.2 mol / L trifluoroacetic acid-acetonitrile (95:5), flow rate: 1.0 mL / min; injection volume 20 μL, atomization temperature: 40℃, drift tube temperature: 40℃, nitrogen carrier gas flow rate of 1.8 L / min, column temperature of 30℃. The neomycin production in the fermentation broth of each recombinant bacteria was calculated according to the standard curve (specific data are shown in Table 1).

[0054] Table 1

[0055]

[0056] The results showed that: 4503 -nagB was significantly increased compared with the recombinant strain Sf01 / pSET152 in the control group, while Sf01 / pSET-Psco 4658-nagB, Sf01 / pSET-Psco 2468 -nagB, Sf01 / pSET-Psco 5768 -nagB titer was lower than that of the control strain, and the titer change trend had no significant correlation with the nagB expression intensity. 4503 -nagB titer increased by up to 15.5% compared to the control, producing an unexpected technical effect.

[0057] The original Streptomyces flexneri described in the present invention is not limited to Streptomyces flexneri Sf01, and it may also be a wild-type neomycin-producing Streptomyces flexneri screened from nature, or an artificially modified neomycin-producing Streptomyces flexneri.

[0058] The nagB gene described in the present invention is published in the gene bank of the National Center for Biotechnology Information (NCBI). The method of obtaining the exogenous nagB gene is not limited to obtaining it by PCR amplification using the genomic DNA of Streptomyces freundii sf01 as a template; it can also be obtained by artificial synthesis, etc. Of course, the nagB gene can theoretically also be derived from other microorganisms containing the gene. The source strains of the nagB gene are different, and there will be differences in individual bases in the nucleotide sequence of the obtained gene fragments, but these nagB gene fragments from different sources theoretically have basically the same function.

[0059] Similarly, the above Psco 4503 The promoter is published in the gene bank of the National Center for Biotechnology Information (NCBI). 4503 The promoter is not limited to being obtained by PCR amplification using the genomic DNA of Streptomyces coelicolor M145 as a template; it can also be obtained by artificial synthesis. 4503 The promoter can theoretically also be derived from other microorganisms containing the gene. Different source strains may result in differences in individual bases in the nucleotide sequence of the obtained gene fragment, but these Psco 4503 In theory, promoters have basically the same functions.

[0060] The expression plasmid in the present invention can be, but is not limited to, plasmid pSET152, and can also be any expression plasmid suitable for Streptomyces freundii, such as pIB139, pSET152, pLB1, pLSV1, pLTG1, pLR4, etc.

Claims

1. nagB gene-modified Streptomyces freundii ( Streptomyces fradiae ) A recombinant bacterium, characterized in that: The recombinant bacteria contain P sco4503 An exogenous fusion gene formed by sequentially splicing the promoter, nagB gene and terminator.

2. The nagB gene-modified recombinant Streptomyces freundii according to claim 1, characterized in that: The P sco4503 The promoter was selected from Streptomyces coelicolor ( Streptomyces coelicolor ) sco4503 The promoter, whose nucleotide sequence is shown in SEQ ID NO.2; the nagB gene is selected from the nagB gene derived from Streptomyces freundii, whose nucleotide sequence is shown in SEQ ID NO.

1.

3. The nagB gene-modified recombinant Streptomyces freundii of claim 1, characterized in that: The terminator selected is the terminator Taph derived from Streptomyces freundii, and the nucleotide sequence of the terminator is shown in SEQ ID NO.

6.

4. The method for constructing a recombinant Streptomyces freundii modified with the nagB gene according to any one of claims 1 to 3, characterized in that: P sco4503 The promoter, nagB gene and terminator are sequentially spliced ​​by SOE-PCR to form an exogenous fusion gene, and the exogenous fusion gene is introduced into the original Streptomyces fragilis through an expression plasmid to obtain a recombinant Streptomyces fragilis, wherein the original Streptomyces fragilis is a Streptomyces fragilis that produces neomycin.

5. The method for constructing a recombinant Streptomyces freundii strain modified with nagB gene according to claim 4, characterized in that: The original Streptomyces flexneri is Streptomyces flexneri Sf01, which was deposited in the China Center for Type Culture Collection in Wuhan on January 21, 2022, with a deposit number of CCTCC NO: M 2022111.

6. The method for constructing a recombinant Streptomyces freundii with nagB gene modification according to claim 5, characterized in that: The expression plasmid selected was plasmid pSET152.

7. The method for constructing a recombinant Streptomyces freundii with nagB gene modification according to claim 5, characterized in that: The specific steps are as follows: (1) Using the genomic DNA of Streptomyces freundii Sf01 as a template, PCR was performed to amplify the nagB gene and the terminator, wherein the terminator is specifically the terminator Taph; using the genome of Streptomyces coelicolor M145 as a template, PCR was performed to amplify the P sco4503 Promoter; the P sco4503 The promoter, the nagB gene and the terminator are sequentially spliced ​​together to form the exogenous fusion gene; (2) The expression plasmid is pSET152, and the pSET152 plasmid is used as a template for PCR amplification to obtain the pSET152 linearized vector; the primers are G-T5-F and G-T5-R, G-T5-F: atcgaattcgtaatcatgtcatagctgtttcctg, G-T5-R: gcttggcactggccgtcgttttac; (3) The pSET152 linearized vector obtained in step (2) was recombined with the exogenous fusion gene obtained in step (1) to obtain a recombinant product, and the recombinant product was transformed into the competent Escherichia coli DH5α, and the bacteria were spread on an apramycin resistance plate for screening, and cultured in a 37°C incubator to obtain transformants; and colony PCR was performed to verify that positive transformants were obtained, and sequencing was performed to confirm that the expression vector pSET-P sco4503 - nagB; (4) The expression vector pSET-P obtained in step (3) was transferred into sco4503 - nagB was transferred into the original Streptomyces freundii, and the original Streptomyces freundii was specifically selected from Streptomyces freundii Sf01, and the binder Sf01 / pSET-P was obtained by screening. sco4503 - nagB, i.e., the recombinant Streptomyces freundii.

8. Use of the recombinant Streptomyces freundii modified with the nagB gene according to any one of claims 1 to 3 in the production of neomycin.

9. Use of the recombinant Streptomyces freundii modified with the nagB gene according to claim 8 in the production of neomycin, characterized in that: The application includes fermentation culture, and the fermentation medium formula used for the fermentation culture is: 10-30g / L glucose, 50-90g / L corn starch, 10-30g / L peptone, 3-9g / L yeast powder, 20-40g / L peanut meal, 3-9 g / L ammonium sulfate, 2-10g / L sodium chloride, 0.1-0.5g / L disodium hydrogen phosphate, 1-8g / L light calcium carbonate, 0.1-0.5g / L amylase, pH7.2-7.7.

Images