An engineered Escherichia coli bacteria producing N-acetylneuraminic acid and its application

Abstract

The present invention relates to the field of genetic engineering technology, and in particular to an engineered Escherichia coli strain that produces N-acetylneuraminic acid, as well as its construction method and application. Based on existing engineered bacteria, the present invention further optimizes the metabolic pathway from glucose to N-acetylmannosamine and knocks out the glmM gene to reduce the production of non-related metabolites. The resulting genetically engineered bacteria significantly enhance the Escherichia coli's ability to produce Neu5Ac in fermentation experiments, demonstrating promising prospects for industrial fermentation applications.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, in particular to an engineered Escherichia coli bacterium for producing N-acetylneuraminic acid, a construction method thereof and an application thereof. Background Art

[0002] Sialic acid is a 9-carbon monosaccharide derivative widely distributed in natural organisms and involved in a variety of biological pathways, such as growth and development, reproductive processes, and immune recognition. N-acetylneuraminic acid (Neu5Ac) is the most important sialic acid and plays an important role in infant brain development and immune enhancement. Traditional methods of obtaining Neu5Ac include natural material extraction, enzymatic synthesis, and microbial fermentation. Microbial fermentation methods achieve high yields by genetically modifying microorganisms and using inexpensive substances for fermentation. Escherichia coli is widely used due to its clear genetic information, convenient gene editing, and low culture costs. Summary of the Invention

[0003] Problems to be solved by the invention

[0004] Current microbial fermentation methods for producing Neu5Ac typically utilize Escherichia coli as the base strain. By knocking out native genes such as the NeuAc transporter (nanT), NeuAc aldolase (nanA), N-acetylmnosamine kinase (nanK), N-acetylmnosamine-6-phosphate 2-epimerase (nanE), glucosamine-6-phosphate deaminase (nagB), and N-acetylglucosamine-6-phosphate acetylase (nagA), and overexpressing exogenous acetylneuraminic acid synthetase (neuB) and N-acetylglucosamine isomerase (neuC), or overexpressing exogenous N-acetylglucosamine-2-isomerase (AGE) and nanA with high catalytic activity, Neu5Ac can be synthesized de novo using substrates such as N-acetylglucosamine (GlcNAc) and pyruvate, or using glucose or glycerol as carbon sources. Fermentation-based synthesis methods have achieved some breakthroughs in yield, but remain subject to challenges such as expensive raw materials and demanding reaction conditions. The de novo synthesis fermentation method has problems such as weak metabolic flow of the target product, resulting in its yield being lower than that of the substrate fermentation method. However, the raw materials are cheap and the fermentation is easier to operate, and it has more application prospects in industrial production. Therefore, it is very important to find a more suitable synthesis route.

[0005] Solutions for solving problems

[0006] In one aspect, the present invention provides a recombinant Escherichia coli, wherein the recombinant Escherichia coli silences or knocks out the gene glmM encoding phosphoglucosamine mutase on the genome.

[0007] Preferably, the recombinant Escherichia coli also silences or knocks out the NeuAc aldolase gene nanA and / or the NeuAc transporter gene nanT and / or the N-acetylmannosamine-6-phosphate 2-epimerase gene nanE and / or the N-acetylmannosamine kinase gene nanK on the genome;

[0008] Preferably, the recombinant E. coli also silences or knocks out a gene cluster nanATEK consisting of four genes encoding nanA, nanT, nanE and nanK on the genome.

[0009] Preferably, the recombinant Escherichia coli also silences or knocks out the gene nagE encoding the N-acetylglucosamine-specific EIICBA component and / or the glucosamine-6-phosphate deaminase gene nagB and / or the N-acetylglucosamine-6-phosphate acetylase gene nagA on the genome;

[0010] Preferably, the recombinant E. coli also silences or knocks out a gene cluster nagEBA consisting of three genes encoding nagE, nagB and nagA on the genome.

[0011] Preferably, the recombinant Escherichia coli is introduced with the NeuAc aldolase gene nanA, and preferably, the nanA gene is derived from MG1655, Klebsiella quasipneumoniae, Staphylococcus hominis subsp.hominisC80 or a microorganism capable of expressing the same functional enzyme;

[0012] Preferably, the nucleotide sequence encoding the nanA gene is shown in the sequence listing SEQ ID NO.1.

[0013] Preferably, the recombinant Escherichia coli is introduced with the N-acetylglucosamine-2-isomerase gene AGE, and the AGE gene is derived from Anabaena sp. CH1, Synechocystis sp. PCC 6803 or a microorganism that can express the same functional enzyme;

[0014] Preferably, the nucleotide sequence encoding the AGE gene is shown in the sequence listing SEQ ID NO.2.

[0015] Preferably, the recombinant Escherichia coli is introduced with the glucosamine-6-phosphate acetyltransferase gene GNA1, and the GNA1 gene is derived from Saccharomyces cerevisiae S288C, Pichiapastoris CBS 7435, or a microorganism capable of expressing the same functional enzyme;

[0016] Preferably, the nucleotide sequence encoding the GNA1 gene is shown in SEQ ID NO.3 in the sequence listing;

[0017] Preferably, the nucleotide sequence encoding the GNA1 gene is shown in the sequence listing SEQ ID NO.4.

[0018] Preferably, the Escherichia coli is selected from Escherichia coli BL21 (DE3), Escherichia coli K12 MG1655 and Escherichia coli JM109; preferably, it is Escherichia coli BL21 (DE3).

[0019] In one aspect, the present invention provides a method for producing N-acetylneuraminic acid, comprising using any of the above-described recombinant Escherichia coli as a fermentation strain and culturing the fermentation at 30-37° C. for at least 24 hours.

[0020] Preferably, the method utilizes glucose or glycerol as a carbon source for fermentation.

[0021] In one aspect, the present invention provides applications of the recombinant Escherichia coli in the fields of medicine, food, and chemical industry;

[0022] Preferably, the above-mentioned recombinant Escherichia coli is used in the production of products containing N-acetylneuraminic acid.

[0023] Effects of the Invention

[0024] Based on existing engineered bacteria, the present invention further optimizes the metabolic pathway from glucose to N-acetylmannosamine and knocks out the glmM gene to reduce the production of non-related metabolites. In fermentation experiments, the genetically engineered bacteria used ultimately significantly improve the ability of Escherichia coli to produce Neu5Ac, showing prospects for industrial fermentation applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a simplified diagram for the synthesis of N-acetylneuraminic acid.

[0026] Figure 2 This is the liquid phase diagram of the product N-acetylneuraminic acid standard and product sample. DETAILED DESCRIPTION

[0027] To make the technical solutions and beneficial effects of the present invention more clearly understood, the following detailed description is given by way of specific embodiments. The accompanying drawings are not necessarily drawn to scale, and local features may be enlarged or reduced to more clearly illustrate the details of the local features. Unless otherwise defined, the technical and scientific terms used herein have the same meanings as those in the technical field to which this application belongs.

[0028] In one aspect, the present invention provides a recombinant Escherichia coli, wherein the recombinant Escherichia coli silences or knocks out the gene glmM encoding phosphoglucosamine mutase on the genome.

[0029] In some embodiments, the recombinant Escherichia coli further silences or knocks out the nanA gene encoding NeuAc aldolase in the genome.

[0030] And / or, in some embodiments, the recombinant Escherichia coli further silences or knocks out the NeuAc transporter gene nanT on the genome.

[0031] And / or, in some embodiments, the recombinant Escherichia coli further silences or knocks out the nanE gene encoding N-acetylmannosamine-6-phosphate 2-epimerase on the genome.

[0032] And / or, in some embodiments, the recombinant Escherichia coli further silences or knocks out the nanK gene encoding N-acetylmannosamine kinase on the genome;

[0033] In some embodiments, the recombinant E. coli further silences or knocks out a gene cluster nanATEK consisting of four genes encoding nanA, nanT, nanE and nanK on the genome.

[0034] In some embodiments, the recombinant Escherichia coli also silences or knocks out the gene nagE encoding the N-acetylglucosamine-specific EIICBA component on the genome.

[0035] And / or, in some embodiments, the recombinant Escherichia coli further silences or knocks out the nagB gene encoding glucosamine-6-phosphate deaminase on the genome.

[0036] And / or, in some embodiments, the recombinant Escherichia coli further silences or knocks out the nagA gene encoding N-acetylglucosamine-6-phosphate acetylase on the genome.

[0037] In some embodiments, the recombinant E. coli also silences or knocks out a gene cluster nagEBA consisting of three genes encoding nagE, nagB and nagA on the genome.

[0038] In some embodiments, the recombinant Escherichia coli is introduced with the NeuAc aldolase gene nanA.

[0039] In some embodiments, the nanA gene is derived from MG1655, Klebsiella quasipneumoniae, Staphylococcus hominis subsp. hominis C80, or a microorganism capable of expressing the same functional enzyme.

[0040] In some embodiments, the nucleotide sequence encoding the nanA gene is as shown in SEQ ID NO.1 in the sequence listing.

[0041] SEQ ID NO.1

[0042] ATGGAAGAACAGCTGAAAGGTCTGTACGCTGCTCTGCTGGTTCCGTTCGACGAAAA

[0043] CGGTCAGGTTAAAGAAGAAGGTCTGAAACAGATCGCTAAAAACGCTATCGAAGTGGAA

[0044] CAGCTGGACGGTCTGTACGTTAACGGTTCTTCTGGTGAAAACTTCCTGATCTCTAAAGA

[0045] ACAGAAAAAACAGATCTTCAAAGTTGTTAAAGAAGCTGTTGGTAACGACGTTAAACTGA

[0046] TCGCTCAGGTTGGTTCTCTGGACCTGAACGAAGCTATCGAACTGGGTAAATACGCTACC

[0047] AACCTGGGTTATGACGCTCTGTCTGCTGTTACCCCGTTCTACTACCCGTTCTCTTTCGAA

[0048] GAAATCAAACAGTACTACTTCGACATCATCGAAGCCACCCAGAACAAAATGATCATCTA

[0049] CGCTATCCCGGACCTGACCGGTGTTAACATCTCTATCAACCAGTTCGAGGAACTGTTCGA

[0050] CAACGAAAAAATCGTTGGTGTTAAATACACCGCTCCGAACTTCTTCCTGCTGGAACGTAT

[0051] CCGTAAAGCTTTCCCGGACAAACTGATCCTGTCTGGTTTCGACGAAATGCTGGTTCAGG

[0052] CTGTTATCTCCGGGTGTTGACGGTGCTATCGGTTCTACCTACAACGTTAACGGTCGTCGTG

[0053] CCCGTCAGATCTACGACCTGGCTCGTGAAGGTAAAGTTGAAGAAGCTTACAAAATTCAG

[0054] CACGACACCAACAACATCATCGAAACCGTTCTGTCTATGGGTATCTACCCGACCCTGAA

[0055] AGAAATCCTGAAAACCCGCGGTATCGACGGTGGTGTTCCGAAACGTCCGTTCTCTCCGT

[0056] TCAACGAAGCTAACCGTAAAGAAC

[0057] In some embodiments, the recombinant Escherichia coli is introduced with the N-acetylglucosamine-2-isomerase gene AGE.

[0058] In some embodiments, the AGE gene is derived from Anabaena sp. CH1, Synechocystis sp. PCC 6803, or a microorganism that can express the same functional enzyme.

[0059] In some embodiments, the nucleotide sequence encoding the AGE gene is shown in the sequence listing SEQ ID NO.2.

[0060] SEQ ID NO.2

[0061] ATGATCGCTCACCGTCGTCAGGAACTGGCTCAGCAGTACTACCAGGCTCTGCACCA

[0062] GGACGTTCTGCCGTTCTGGGAAAAATACTCTCTGGACCGTCAGGGTGGTGGTTACTTCA

[0063] CCTGCCTGGACCGTAAAGGTCAGGTTTTCGACACCGACAAATTCATCTGGCTGCAGAAC

[0064] CGTCAGGTTTGGCAGTTCGCTGTTTTCTACAACCGTCTGGAACCGAAACCGCAGTGGCT

[0065] GGAAATCGCTCGTCACGGTGCTGACTTCCTGGCGCGTCACGGTCGTGACCAGGACGGTA

[0066] ACTGGTACTTCGCTCTGGACCAGGAAGGTAAACCGCTGCGTCAGCCGTACAACGTTTTC

[0067] TCTGACTGCTTCGCTGCTATGGCTTTCTCTCAGTACGCTCTGGCTTCTGGTGCTCAGGAA

[0068] GCTAAAGCTATCGCGCTGCAGGCTTACAACAACGTTCTGCGTCGTCAGCACAACCCGAA

[0069] AGGTCAGTACGAAAAATCTTACCCGGGTACCCGTCCGCTGAAATCTCTGGCTGTTCCGAT

[0070] GATCCTGGCTAACCTGACCCTGGAAATGGAATGGCTGCTGCCGCCGACCACCGTTGAAG

[0071] AAGTTCTGGCTCAGACCGTGCGTGAAGTTATGACCGACTTCCTGGACCCGGAAATCGGC

[0072] CTGATGCGTGAAGCTGTTACCCCGACCGGTGAATTCGTTGACTCTTTCGAAGGTCGTCT

[0073] GCTGAACCCGGGTCACGGTATCGAAGCTATGTGGTTTATGATGGACATCGCTCAGCGCTC

[0074] TGGCGACCGTCAGCTGCAGGAACAGGCTATCGCTGTTGTTCTGAACACCCTGGAATACG

[0075] CTTGGGACGAAGAATTCGGTGGTATCTTCTACTTCCTGGACCGTCAAGGTCACCCGCCG

[0076] CAGCAGCTGGAATGGGACCAGAAACTGTGGTGGGTTCACCTGGAAACCCTGGTTGCTC

[0077] TTGCTAAAGGTCACCAGGCTACCGGTCAGGAAAAATGCTGGCAGTGGTTCGAACGTGTT

[0078] CACGACTACGCTTGGTCTCACTTCGCTGACCCGGAATACGGTGAATGGTTCGGTTACCTG

[0079] AACCGTCGTGGCGAAGTTCTGCTGAACCTGAAAGGTGGTAAATGGAAAGGTGCTTTCC

[0080] ACGTTCCGCGTGCTCTGTGGCTGTGCGCTGAAACCCTGCAGCTGCCGGTTTCTTAA

[0081] In some embodiments, the recombinant Escherichia coli is introduced with the glucosamine-6-phosphate acetyltransferase gene GNA1.

[0082] In some embodiments, the GNA1 gene is derived from Saccharomyces cerevisiae S288C, Pichiapastoris CBS 7435, or a microorganism capable of expressing the same functional enzyme;

[0083] In some embodiments, the nucleotide sequence encoding the GNA1 gene is shown in SEQ ID NO.3 in the sequence listing;

[0084] SEQ ID NO.3

[0085] ATGTCTCTGCCGGACGGTTTCTACATCCGTCGTATGGAAGAAGGTGACTTAGAACAG

[0086] GTTACCGAAACCCTGAAAGTTCTGACCACCGTTGGTACCATCACCCCGGAATCTTTCTCT

[0087] AAATTAATCAAATACTGGAACGAAGCTACCGTTTGGAACGACAACGAAGACAAAAAAA

[0088] TCATGCAGTACAACCCGATGGTTATCGTTGACAAACGTACCGAAACCGTTGCTGCTACC

[0089] GGTAACATCATCATCGAACGTAAAATCATCCACGAACTGGGTCTGTGCGGTCACATCGA

[0090] AGACATCGCTGTTAACTCTAAATACCAGGGTCAGGGTCTGGGTAAACTGCTGATCGACC

[0091] AGTTAGTTACCATCGGTTTCGACTACGGTTGCTACAAAATCATCCTGGACTGCGACGAAA

[0092] AAAACGTTAAATTCTACGAAAAATGCGGTTTCTCTAACGCTGGTGTTGAAATGCAGATCC [[ID=!0]]

[0093] GTAAATAA

[0094] In some embodiments, the nucleotide sequence encoding the GNA1 gene is as shown in SEQ ID NO.4 in the sequence listing.

[0095] SEQ ID NO.4 <00002!0>ATGCAGCCGGTTTCTGTTCCGGCTCTGCCGCAGGGTTACAATCTGCGTCGTGTTGGT

[0097] AAAGAAGACTTCCAGGACAAAAACCTGTTTAAAACCCTGTCTATCCTGACCACCGTTGG

[0098] TGACATCCCGGAACCGAAATTCCACGCTCTGATCGAGTACTGGAACGACCGTAAAGAAA

[0099] TCTACAACCCGATGGTTATCACCAACGCTGAGAACGTTATCATCGCTACCGGTATGCTGT

[0100] TCGTTGAACACAAACTGATCCACGGCGGTGGCAAAGTTGGTCACATCGAAGACATCTCT

[0101] GTTAACCCGTCTGAACAGGGTAAAAAACTGGGTCTCATCATGATCCGTAACCTGATCCA

[0102] It should be noted that there seems to be an error in the original text where "!0" and "!0" are present in the tags. They should be corrected to "10" and "20" respectively for proper representation. The above translation is based on the corrected understanding.GATCGCTCAGACCGAAGGTTGTTACAAAGTTATCCTGGACTGCGACGAAAAAAACGTTCGTTTCTACGAAAAATGCGGTATGAAAATCGAAGGTGTTGAAATGGGTTACCGTTTCTAA

[0103] In some embodiments, the Escherichia coli is selected from Escherichia coli BL21 (DE3), Escherichia coli K12 MG1655 and Escherichia coli JM109.

[0104] In some embodiments, the Escherichia coli is selected from Escherichia coli BL21 (DE3).

[0105] In one aspect, the present invention provides a method for producing N-acetylneuraminic acid, comprising using any of the above-described recombinant Escherichia coli as a fermentation strain and culturing the fermentation at 30-37° C. for at least 24 hours.

[0106] In some embodiments, the method utilizes glucose or glycerol as a carbon source for fermentation.

[0107] In one aspect, the present invention provides applications of the recombinant Escherichia coli in the fields of medicine, food, and chemical industry;

[0108] In some embodiments, the above-mentioned recombinant Escherichia coli is used to produce a product containing N-acetylneuraminic acid.

[0109] The following definitions and explanations are explanations of the terms used in the present invention. When describing the present invention, unless otherwise specified, the technical and scientific terms used herein should have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs, and the disclosures and documents mentioned herein are incorporated herein by reference.

[0110] nanA: NeuAc aldolase

[0111] nanT: NeuAc transporter

[0112] nanE: N-acetylmannosamine-6-phosphate 2-epimerase

[0113] nanK: N-acetylmannosamine kinase

[0114] nagE: N-acetylglucosamine-specific EIICBA component

[0115] nagB: glucosamine-6-phosphate deaminase

[0116] nagA: N-acetylglucosamine-6-phosphate acetylase

[0117] AGE: N-acetylglucosamine-2-isomerase

[0118] GNA1: glucosamine-6-phosphate acetyltransferase

[0119] glmM: phosphoglucosamine mutase

[0120] glmS: glucosamine synthase

[0121] neuB: acetylneuraminic acid synthase

[0122] neuC: N-acetylglucosamine isomerase

[0123] As used herein, the term "silencing" or "knockout" a gene refers to deleting all or part of the coding frame of the gene by using CRISPR gene editing and other technologies to inactivate the gene.

[0124] As used herein, the terms "include" or "comprising" mean that the method, structure or composition includes any of the steps / operations, parts, components, etc. mentioned in the examples, but does not exclude any other steps / operations, parts, components.

[0125] In the context of the present invention, when referring to a numerical range, it is understood that the upper and lower limits of the range, and each intervening value therebetween, and any other specified or intervening values ​​in the range are encompassed within the present invention. The upper and lower limits of these smaller ranges that may be independently included in the range are also encompassed within the present invention, subject to any explicitly excluded limitations in the specified range. When a specified range includes one or both of the limits, ranges excluding either of the two included limits are also encompassed within the present invention.

[0126] The present invention is described in more detail below with reference to the embodiments.

[0127] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0128] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0129] The gel recovery kit and high-fidelity enzyme used were purchased from Novozymes.

[0130] The seamless ligation kit and LB used were purchased from Sangon Biotechnology.

[0131] The pEcCas, pTargetS, and pTargetD plasmids used were retained in the laboratory, and the other vectors used were purchased from Youbao Bio.

[0132] The host bacteria used for transformation and plasmid extraction were DH5α competent cells purchased from Weidi Biotechnology.

[0133] The BL21 (DE3) host bacteria used were BL21 (DE3) competent cells purchased from Weidi Biotechnology.

[0134] The plasmid was extracted using a bacterial plasmid extraction kit purchased from Tiangen.

[0135] Gene synthesis, primer synthesis, and sequencing were all performed by GeneWeichi.

[0136] Comparative Example 1

[0137] Construction of control strains

[0138] 1 Construction of knockout strains

[0139] The strain used was BL21(DE3), and the knocked-out nanATEK gene was the collective name for the nanA gene, nanT gene, nanE gene, and nanK gene. The knocked-out nagEBA gene was the collective name for the nagE gene, nagB gene, and nagA gene.

[0140] 1.1 Knockout of nanATEK gene

[0141] The pTargetD plasmid was amplified using primers nan-N20-1 and nan-N20-2 to obtain a 193bp fragment containing the two N20s required for knockout of nanATEK. The pTargetS plasmid was then amplified using primers DPZL-1-F / R to obtain a 2128bp vector fragment. The 2128bp vector fragment and the 193bp double N20 fragment were ligated to construct the pTargetD plasmid containing the target N20, named nan-N20-pTargetD. A single clone of the nan-N20-pTargetD strain was selected for sequencing to verify that the target N20 was incorporated into the pTargetD plasmid. After sequencing results were obtained, the N20 plasmid that met the target was selected and subjected to shake-incubation.

[0142] The successfully constructed nan-N20-pTargetD plasmid was subjected to reverse PCR using primers pTargetD-HP-F / R to obtain the vector fragment, and then primers nan-HL-F / R were used to obtain the upstream homology arm of the knockout plasmid. The fragment size was 846 bp and was named nan-HL. The downstream homology arm of the knockout plasmid was obtained using primers nanR-R / nan-HR-R. The fragment size was 934 bp and was named nan-HR. The amplified upstream and downstream homology arms were connected to the vector fragment to construct the nanATEK knockout plasmid. After plating and culturing overnight, the single clones were identified using the identification primers: pTargetT-F / R. The successfully connected single clones were selected for sequencing, and the plasmid with correct sequencing was selected as the knockout plasmid to be used.

[0143] The pEcCas plasmid was transformed into BL21 (DE3) competent cells and cultured overnight on solid medium containing 50 μg / ml kanamycin. The next day, one of the monoclonal strains was selected for shaking and used as the chassis strain for subsequent knockout.

[0144] The BL21 (DE3) strain containing the pEcCas plasmid cultured overnight was transferred into 20 ml of liquid culture medium containing 50 μg / ml kanamycin at a ratio of 1:100. After culturing for 1.5 h, L-arabinose was added to a final concentration of 100 mM. The OD value was measured after further culturing for 1 h. 600 The value is 0.6~0.8.

[0145] The cultured bacterial solution was placed in an ice bath for 30 minutes, then centrifuged at 2000xg for 5 minutes in a 4°C centrifuge, the supernatant was discarded, and the solution was washed with pre-cooled pure water. After gently blowing and mixing, the solution was centrifuged at 2000xg for 5 minutes in a 4°C centrifuge; the supernatant was poured out again, and the solution was washed with pre-cooled 10% glycerol. After mixing, the solution was centrifuged under the same conditions, and the 10% glycerol washing was repeated. After the supernatant was poured out from the last centrifugation, 1 ml of pre-cooled 10% glycerol was added. After gently blowing and mixing, 100 ul of the solution was taken out and placed in a pre-cooled To an empty EP tube, add 200 ng of nanATEK knockout plasmid (the added volume should not exceed 10 ul), gently pipette to mix, and then add all the content to a pre-cooled 2 mm electric shock cup, use 3.0 kV for electric shock, then add 1 ml of pre-cooled antibiotic-free LB, mix well, and then aspirate all the content, put it into a 1.5 ml empty centrifuge tube, and culture in a shaker at 37 ° C, 220 rpm for 1 hour. After that, take 200 ul and apply it to a solid LB plate containing 50 ug / ml kanamycin and 50 ug / ml spectinomycin, and culture overnight.

[0146] The next day, the knockout of the nan gene was successfully determined using the nanQ-R and nan-IS-R primers.

[0147] The strain with successful knockout was selected and cultured in 2 ml liquid LB medium containing 10 mM rhamnose and 50 ug / ml kanamycin at 37°C and 220 rpm for 6 h; after the culture was completed, centrifuged at 2000xg for 5 min, the supernatant was discarded, and 2 ml of antibiotic-free liquid LB was added for resuspending, and cultured for another 2 h at 37°C and 220 rpm; 10 ul of bacteria was diluted 10 times and all were spread on solid LB medium containing 10 g / L sucrose and cultured overnight; the next day, single clones were randomly selected and plated on LB antibiotic-free medium, solid medium containing 50 ug / ml kanamycin, and solid medium containing 50 ug / ml spectinomycin for further culture. The strains that only grew on antibiotic-free LB medium and solid medium containing spectinomycin were our target strains; the strains that lost the plasmid were shaken and maintained with glycerol at a final concentration of 15%, named BNC, and set aside.

[0148] 1.2 Knockout of the nagEBA gene

[0149] The pTargetD plasmid was amplified using primers nagE-N20-F and nagE-N20-2 to obtain a 193bp fragment containing the two N20s required for knocking out nagEBA. The pTargetS plasmid was then amplified using primers DPZL-1-F / R to obtain a 2128bp vector fragment. The 2128bp vector fragment and the 193bp double N20 fragment were ligated to construct the pTargetD plasmid containing the target N20, named nag-N20-pTargetD. A single clone of the nag-N20-pTargetD strain was selected for sequencing to verify that the target N20 was incorporated into the pTargetD plasmid. After sequencing results were available, the appropriate N20 plasmid was selected and subjected to shake-incubation. The successfully constructed nag-N20-pTargetD plasmid was subjected to reverse PCR using primers pTargetD-HP-F / R to obtain the vector fragment, and then primers nag-HL-F / R were used to obtain the upstream homology arm of the knockout plasmid. The fragment size was 677bp and was named nan-HL. The downstream homology arm of the knockout plasmid was obtained using primers nag-HR-F / nagE-HR-R. The fragment size was 860bp and was named nan-HR. The amplified upstream and downstream homology arms were connected to the vector fragment to construct the knockout plasmid of nagEBA. After plating and culturing overnight, the single clones were identified using the identification primers: pTargetT-F / R. The successfully connected single clones were selected for sequencing, and the plasmid with correct sequencing was selected as the knockout plasmid to be used and named nag-pTargetD.

[0150] The knockout and plasmid loss methods are the same as above. The identification primers are nag-IS-F and nag-IS-R2. Strains that grow only in antibiotic-free LB medium and LB medium containing spectinomycin are designated BNNC and are reserved. Strains that grow only in antibiotic-free LB medium are designated BNN and are reserved.

[0151] Table 1 Gene knockout and identification primers

[0152]

[0153] Table 2 Characteristics of knockout bacteria

[0154]

[0155] 2 Overexpression vector construction

[0156] The nanA gene used is the ShNAL gene from Staphylococcus hominis subsp. hominis C80. The AGE gene used is the slr1975 gene from Synechocystis sp. PCC 6803. The GNA1 genes used are the ScGNA1 gene from Saccharomyces cerevisiae S288C and the PpGNA1 from Pichiapastoris CBS 7435, respectively. All genes used have been codon-optimized, and their sequences are shown in SEQ ID NOs. 1 to 4, respectively. The optimized genes were synthesized by Jin Weizhi and contain T7 promoter, RBS, and T7 terminator sequences.

[0157] 1. Construction of pET28a(+)-slr1975-ShNAL-ScGNA1 vector

[0158] Using the synthetic gene as a template, 5-F and 3-R primers were used to amplify the pT7-slr1975-tT7, pT7-ShNAL-tT7, pT7-ScGNA1-tT7, and pT7-PpGNA1-tT7 fragments, respectively. Linearized vector fragments were obtained by inverse PCR using the pET28a(+) plasmid as a template and pET-F / R primers.

[0159] Table 3 Primers for constructing pET28a(+)-slr1975-ShNAL-ScGNA1 vector

[0160]

[0161] The target gene fragment and the linearized vector fragment were homologously recombined using a seamless cloning kit, and the vectors with the correct gene sequence were obtained by sequencing. They were named pET28a(+)-slr1975-ShNAL-ScGNA1 vector and pET28a(+)-slr1975-ShNAL-PpGNA1 vector, respectively.

[0162] 3 Construction of control bacteria

[0163] The preparation and electroporation methods of the knockout bacteria BNN were the same as above. The pET28a(+)-slr1975-ShNAL-ScGNA1 and pET28a(+)-slr1975-ShNAL-PpGNA1 vectors were electroporated into the knockout bacteria, and the strains grown on kanamycin-resistant plates were named BNNS and BNNP, respectively.

[0164] Table 4 Characteristics of control bacteria

[0165]

[0166] Example 1

[0167] Construction of genetically engineered bacteria

[0168] The constructed genetically engineered bacteria further knocked out the glmM gene based on the control bacteria BNNC, as follows:

[0169] The pTargetD plasmid was amplified using primers glmM-N20-F and glmM-N20-2 to obtain a 193 bp fragment containing the two N20s required for glmM knockout. The pTargetS plasmid was then amplified using primers DPZL-1-F / R to obtain a 2128 bp vector fragment. The 2128 bp vector fragment and the 193 bp double N20 fragment were ligated to construct the pTargetD plasmid containing the target N20, named glmM-N20-pTargetD. A single clone of the glmM-N20-pTargetD strain was selected for sequencing to verify that the target N20 was incorporated into the pTargetD plasmid. After sequencing results were available, the appropriate N20 plasmid was selected and subjected to shake-incubation. The successfully constructed glmM-N20-pTargetD plasmid was subjected to reverse PCR using primers pTargetD-HP-F / R to obtain the vector fragment, and then the upstream homology arm of the knockout plasmid was obtained using primers glmM-HL-F / R. The fragment size was 634 bp and was named glmM-HL. The downstream homology arm of the knockout plasmid was obtained using primers glmM-HR-F / glmM-HR-R. The fragment size was 547 bp and was named glmM-HR. The amplified upstream and downstream homology arms were connected to the vector fragment to construct the glmM knockout plasmid. After plating and culturing overnight, the single clones were identified using the identification primers: pTargetT-F / R. The successfully connected single clones were selected for sequencing, and the plasmid with correct sequencing was selected as the knockout plasmid to be used and named glmM-pTargetD.

[0170] The knockout and plasmid loss methods are the same as above. The identification primers are glmM-IS-F and glmM-IS-R2. Knockout strains that grow only on antibiotic-free LB medium are designated BNNG and are kept for future use.

[0171] The preparation and electroporation methods of BNNG electroporation competent cells were the same as above. The pET28a(+)-slr1975-ShNAL-PpGNA1 vector was electroporated into bacteria. The bacteria that grew on the kanamycin resistance plate were genetically engineered bacteria and were named BNNGP.

[0172] Table 5 glmM knockout and identification primers

[0173]

[0174] Table 6 Characteristics of genetically engineered bacteria

[0175]

[0176] Example 2

[0177] Induced synthesis and product detection

[0178] 1. Induction

[0179] The three strains BNNS, BNNP, and BNNGP were cultured overnight in LB liquid medium. 1 mL of overnight bacteria was added to 2 mL of fermentation medium (90% M9 glucose medium + 10% LB medium). After culturing for 2 h, 100 uL was added to 10 mL of fermentation medium and continued to be cultured overnight.

[0180] The cultured bacteria were inoculated into a baffled shake flask containing 200 mL of fermentation medium at a ratio of 1:50. The culture was carried out at 37°C and 220 rpm until the OD600 value was about 0.8. IPTG was added at a final concentration of 0.2 mM. The culture was continued for 48 h before sampling.

[0181] The formula of M9 glucose medium is as follows:

[0182]

[0183] 2. Product testing

[0184] Take 1 mL of the above culture sample, centrifuge at 12000g for 5 min, and take the supernatant for HPLC detection. The separation column used is Pezex TM ROA-Organic Acid H+ (8%) was used with a mobile phase of 5 mM sulfuric acid at a flow rate of 0.6 ml / min. The column oven temperature was set at 50°C. The sampling volume for each sample was 10 μl, and the detection time was 25 min. Neu5Ac standard was purchased from Xinyang Zhongjian Metrology Biotechnology Co., Ltd. The final HPLC yields were: BNNS shake flask yield: 0.144 g / L; BNNP shake flask yield: 1.171 g / L; BNNGP shake flask yield: 2.360 g / L.

[0185] It should be understood that the above embodiments are exemplary and are not intended to encompass all possible implementations of the claims. Various modifications and variations may be made to the above embodiments without departing from the scope of this disclosure. Similarly, the various technical features of the above embodiments may be arbitrarily combined to form additional embodiments of the present invention that may not be explicitly described. Therefore, the above embodiments merely illustrate several implementations of the present invention and do not limit the scope of protection of the patent of this invention.

Claims

1. A recombinant Escherichia coli, characterized in that The recombinant Escherichia coli silences or knocks out the gene glmM encoding phosphoglucosamine mutase on the genome; The recombinant E. coli also silences or knocks out a gene cluster nanATEK consisting of four genes encoding nanA, nanT, nanE and nanK on the genome; The recombinant E. coli also silences or knocks out a gene cluster nagEBA consisting of three genes encoding nagE, nagB and nagA on the genome; The recombinant Escherichia coli is introduced with the NeuAc aldolase gene nanA; The recombinant Escherichia coli is introduced with the N-acetylglucosamine-2-isomerase gene AGE; The recombinant Escherichia coli is introduced with the glucosamine-6-phosphate acetyltransferase gene GNA1.

2. The recombinant Escherichia coli according to claim 1, characterized in that The nanA gene is derived from MG1655, Klebsiella quasipneumoniae or Staphylococcus hominis subsp. hominis C80.

3. The recombinant Escherichia coli according to claim 2, characterized in that The nucleotide sequence encoding the nanA gene is shown in the sequence table as SEQ ID NO.

1.

4. The recombinant Escherichia coli according to claim 1, characterized in that The AGE gene is derived from Anabaenasp. CH1 or Synechocystis sp. PCC 6803.

5. The recombinant Escherichia coli according to claim 4, characterized in that The nucleotide sequence encoding the AGE gene is shown in the sequence table SEQ ID NO.

2.

6. The recombinant Escherichia coli according to claim 1, characterized in that The GNA1 gene is derived from Saccharomyces cerevisiae S288C or Pichiapastoris CBS 7435.

7. The recombinant Escherichia coli according to claim 6, characterized in that The nucleotide sequence encoding the GNA1 gene is shown in the sequence listing SEQ ID NO.

3.

8. The recombinant Escherichia coli according to claim 6, characterized in that The nucleotide sequence encoding the GNA1 gene is shown in the sequence listing SEQ ID NO.

4.

9. The recombinant Escherichia coli according to claim 1, characterized in that The Escherichia coli is selected from Escherichia coli BL21 (DE3), Escherichia coli K12 MG1655 and Escherichia coli JM109.

10. The recombinant Escherichia coli according to claim 9, characterized in that The Escherichia coli is Escherichia coli BL21 (DE3).

11. A method for producing N-acetylneuraminic acid, characterized in that: The recombinant Escherichia coli according to any one of claims 1 to 10 is used as a fermentation strain and fermented at 30-37° C. for at least 24 hours.

12. The method for producing N-acetylneuraminic acid according to claim 11, wherein Fermentation is carried out using glucose or glycerol as the carbon source.

13. Use of the recombinant Escherichia coli according to any one of claims 1 to 10 in the fields of medicine, food and chemical industry.

14. The use according to claim 13, characterized in that The application is the application of the recombinant Escherichia coli in producing products containing N-acetylneuraminic acid.

Images