Application of sodium acetate in improving the differentiation efficiency of mammalian pluripotent stem cells into definitive endoderm cells
By adding components such as sodium acetate to the culture medium of mammalian pluripotent stem cells, the problem of low differentiation efficiency of pluripotent stem cells to the shaped endoderm cells is solved, and an efficient and stable differentiation process is achieved, shortening the differentiation time.
Patent Information
- Application Number
- CN202211390703.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-07
- Publication Date
- 2025-06-27
- Estimated Expiration
- 2042-11-07
AI Technical Summary
The prior art is difficult to effectively improve the differentiation efficiency of mammalian pluripotent stem cells to stereotypical endoderm cells, resulting in a longer differentiation time.
By adding sodium acetate to the cell culture medium, the concentration is preferably 5 to 15 mM, and combining components such as Activin A, Wnt3a protein, fatty acid-free bovine serum albumin and bianthan, an efficient medium for differentiation of mammalian pluripotent stem cells to the shaped endoderm cells is prepared.
The differentiation efficiency of pluripotent stem cells to stereotypical endoderm cells is significantly improved, and the stereotypical endoderm cells can be obtained in a short period of time (such as the 3rd or 4th day of differentiation), and the differentiation method is good repetitive and low cost.
Smart Images

Figure CN116064376B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of stem cells and regenerative medicine, and particularly to the application of sodium acetate in improving the differentiation efficiency of mammalian pluripotent stem cells into definitive endoderm cells. Background Art
[0002] Pluripotent embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) are a special type of cells with unlimited self-renewal and multi-lineage differentiation potential, and thus are widely used in the research of cell fate determination mechanisms and regenerative medicine. Embryonic stem cells or induced pluripotent stem cells can be induced to differentiate into the three germ layers, endoderm, mesoderm, and ectoderm in vitro, and ultimately differentiate into tissues and organs such as the pancreas, liver, lung, and intestine. This in vitro differentiation system can not only be used for the research of stem cell fate determination and embryonic development, but also for exploring the molecular mechanisms of disease occurrence, drug screening, cell therapy, and organ transplantation. Therefore, improving the endoderm differentiation protocol and increasing the endoderm differentiation efficiency are extremely important.
[0003] Sodium acetate is an inorganic substance. Numerous reports have shown that after sodium acetate added to the culture medium enters the cells, it can increase the abundance of acetyl-CoA in the cells. As a metabolite, acetyl-CoA participates in numerous metabolic processes, and thus plays an important role in the metabolic homeostasis of cells. In addition, as a substrate for protein acetylation, acetyl-CoA can affect protein stability, subcellular localization, enzyme activity, protein-protein interaction, and protein-DNA interaction by changing the protein acetylation level, thereby affecting almost all key cellular processes such as cell fate determination, cell division, signal transduction, and gene transcription. Therefore, acetyl-CoA is very likely to play an important role in the process of definitive endoderm differentiation. Improving the abundance of sodium acetate in the cell culture conditions is of great significance for increasing the definitive endoderm differentiation efficiency. Summary of the Invention
[0004] The object of the present invention is to provide the application of sodium acetate in improving the differentiation efficiency of mammalian pluripotent stem cells into definitive endoderm cells. Based on the role of sodium acetate in increasing the differentiation efficiency of mammalian pluripotent stem cells into definitive endoderm cells, the object of the present invention is also to provide a culture medium and a culture method for the differentiation of mammalian pluripotent stem cells into definitive endoderm cells.
[0005] To achieve the above object, the present invention adopts the following technical solutions:
[0006] In the first aspect of the present invention, there is provided an application of sodium acetate in improving the differentiation efficiency of mammalian pluripotent stem cells into definitive endoderm cells. The concentration of the sodium acetate is preferably 5-15 mM.
[0007] In the second aspect of the present invention, there is provided a culture medium for differentiating mammalian pluripotent stem cells into definitive endoderm cells, the culture medium comprising: a basal medium, sodium acetate.
[0008] Furthermore, the culture medium further comprises: Activin A, Wnt3a protein. Even further, the culture medium further comprises fatty acid-free bovine serum albumin and double antibody.
[0009] Furthermore, the concentration of the sodium acetate is preferably 5-15 mM. The concentration of the Activin A is preferably 100 ng / mL, and the concentration of the Wnt3a protein is preferably 25 ng / μL. The concentration of the fatty acid-free bovine serum albumin is preferably 0.2%, and the concentration of the double antibody is preferably 1%.
[0010] Furthermore, the basal medium is DMEM / F12, IMDM / F12 or DMEM.
[0011] Specifically, the mammalian pluripotent stem cells include: one of human pluripotent stem cells, primate pluripotent stem cells, mouse pluripotent stem cells, rat pluripotent stem cells, canine pluripotent stem cells, feline pluripotent stem cells, porcine pluripotent stem cells, bovine pluripotent stem cells and equine pluripotent stem cells.
[0012] In the third aspect of the present invention, there is provided a culture method for differentiating mammalian pluripotent stem cells into definitive endoderm cells, the method comprising the following steps: culturing mammalian pluripotent stem cells with the culture medium to differentiate into definitive endoderm cells.
[0013] Furthermore, the method comprises the following steps:
[0014] Culturing mammalian pluripotent stem cells with a stem cell maintenance medium for 3-7 days, digesting and re-seeding them in a well plate coated with Matrigel, and culturing with the stem cell maintenance medium for 1-2 days;
[0015] When the cell density reaches 75-85%, replace it with the culture medium for culturing to obtain definitive endoderm cells.
[0016] In the above technical solution, the stem cell maintenance medium can specifically be mTeSR TM 1 or E8 + 1% double antibody, and Matrigel is coated in the well plate at a dilution ratio of 1:100, and the addition ratio can also be appropriately adjusted in other embodiments.
[0017] In the above technical solution, for a 24-well plate, cells were seeded at a density of 1×10 5 per well into a 24-well plate coated with Matrigel; in other embodiments, for different culture dishes, the number of seeded cells should be appropriately adjusted.
[0018] The CAS number of sodium acetate in the present invention is 127-09-3.
[0019] The present invention has at least the following technical effects or advantages:
[0020] The application of sodium acetate provided by the present invention in improving the differentiation efficiency of mammalian pluripotent stem cells into definitive endoderm cells, by adding sodium acetate to a basal medium to improve the differentiation efficiency of mammalian pluripotent stem cells into definitive endoderm cells; specifically:
[0021] (1) Adding sodium acetate to the medium enables a relatively high differentiation efficiency to be achieved on the 3rd or 4th day of pluripotent stem cell differentiation, which can shorten the differentiation time.
[0022] (2) The medium provided by the present invention differentiates mammalian pluripotent stem cells into definitive endoderm cells in an efficient and stable manner.
[0023] (3) The differentiation method provided by the present invention has good repeatability and low cost, and improves the differentiation efficiency of mammalian pluripotent stem cells into definitive endoderm.
[0024] The present invention provides a highly efficient research material for in vitro early embryonic development and regenerative medicine research, which will greatly promote the research and application of clinical cell therapy, has good application prospects, and can be widely applied to research on cell fate determination and organ repair, etc. Brief Description of the Drawings
[0025] Figure 1 Quantitative PCR results showing the effect of sodium acetate on the expression of endoderm differentiation marker genes in human embryonic stem cells in Example 1 and Comparative Example 1.
[0026] Figure 2 Flow cytometry results showing the effect of sodium acetate on the positive rate of endoderm differentiation in human embryonic stem cells in Example 1 and Comparative Example 1.
[0027] Figure 3 Immunofluorescence results showing the effect of sodium acetate on the expression of endoderm differentiation marker genes in human embryonic stem cells in Example 1 and Comparative Example 1.
[0028] Figure 4 Flow pattern diagram of the culture method for differentiating mammalian pluripotent stem cells into definitive endoderm cells of the present invention. Detailed Description of the Invention
[0029] In order to more clearly demonstrate the advantages and various effects of the present invention, the present invention will be described below in conjunction with specific embodiments and examples. For those skilled in the art, these specific embodiments and examples are used to illustrate the present invention, rather than limiting the present invention.
[0030] The terms used in this specification, unless otherwise specified, should be understood as having the meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as the general understanding of those skilled in the art to which the present invention pertains. In case of contradiction, this specification shall prevail.
[0031] Unless otherwise specifically stated, various raw materials, reagents, instruments, and equipment used in the present invention can be obtained through market purchases or by existing methods.
[0032] Below, a medium and a culture method for differentiating mammalian pluripotent stem cells into definitive endoderm cells of the present application will be described in detail in conjunction with examples, comparative examples, and experimental data.
[0033] Example 1
[0034] 1. A medium for differentiating human pluripotent stem cells into definitive endoderm cells
[0035] This medium is based on DMEM / F12 and further includes the following components: 100 ng / mL Activin A, 25 ng / μL Wnt3a, 0.2% fatty acid-free bovine serum albumin, 1% double antibody, 5, 10, or 15 mM sodium acetate.
[0036] 2. A culture method for differentiating human pluripotent stem cells into definitive endoderm cells, using the above medium for culture, specifically including the following steps:
[0037] (1) Human embryonic stem cell HUES8 (Cowan CA, Klimanskaya I, McMahon J, Atienza J, Witmyer J, Zucker JP, Wang S, Morton CC, McMahon AP, Powers D, Melton DA. Derivation of embryonic stem-cell lines from human blastocysts. N Engl J Med. 2004 Mar 25; 350(13): 1353 - 6. doi: 10.1056 / NEJMsr040330.) is used with mTeSR TM1 + 1% dual antibody was used as a stem cell maintenance medium and cultured on Matrigel (BD Bioscience) at a dilution ratio of 1:100.
[0038] (2) When the human embryonic stem cells in step (1) were cultured to a cell density of about 80% - 90% of the bottom area of the well plate, dead cells were washed away with DPBS, and then incubated with Accutase in a 37°C cell culture incubator for about 3 minutes until the cells were spherical under a microscope. DMEM / F12 medium was added to terminate digestion and the cells were pipetted and resuspended. The cells were centrifuged at 1000 rpm for 3 min, and then resuspended with mTeSR TM 1 + 1% dual antibody to resuspend the cell pellet. After counting, the cells were seeded into a 24-well plate coated with Matrigel at a density of 1×10 5 per well.
[0039] (3) When the cells in step (2) were cultured for 1 - 2 days until the cell density reached about 80% of the bottom area of the well plate, the above freshly prepared medium was replaced to start definitive endoderm differentiation, denoted as differentiation D0.
[0040] (4) The fresh above-mentioned medium was replaced every 24 hours, and definitive endoderm cells could be obtained at D3.
[0041] Comparative Example 1
[0042] In this Comparative Example 1, except that sodium acetate was not added to the differentiation medium, other steps were the same as in Example 1.
[0043] Experimental Example 1
[0044] The mRNA levels or differentiation efficiencies of the marker genes of the definitive endoderm cells obtained in each example and each comparative example were detected.
[0045] I. The detection method was as follows:
[0046] 1. Detect the mRNA levels of the marker genes of the definitive endoderm cells obtained by real-time fluorescence quantitative PCR:
[0047] (1) Cell collection
[0048] The dead cells of the definitive endoderm cells differentiated at D3 above were washed away with DPBS, and then TrypLE was added and incubated in a 37°C cell culture incubator for 1 min. The digestion was terminated by gently pipetting the cells with DMEM / F12 medium, and the cells were collected in a 1.5 mL EPP tube and centrifuged at 4°C, 3000 rpm for 3 min. The supernatant was aspirated to obtain the cell pellet.
[0049] (2) Total RNA extraction of cells
[0050] Use the Total RNA Mini Kit (Double Column Type) from Meiji Bio to extract RNA from cells. The specific operation steps are as follows:
[0051] Take an appropriate amount of Buffer RL and add it to the cell pellet, then pipette and mix well. Transfer the above liquid to the gDNA filtration column and centrifuge at 14000g for 2 min; discard the gDNA filtration column, add an equal volume of 70% ethanol and pipette to mix evenly; transfer the above liquid to the RNA purification column, centrifuge at 12000g for 1 min, and discard the filtrate; reinstall the RNA purification column into the collection tube, add 500 μL of Buffer RW1 to the RNA purification column, centrifuge at 12000g for 1 min, and discard the filtrate; reinstall the RNA purification column into the collection tube, add 500 μL of Buffer RW2 to the RNA purification column, centrifuge at 12000g for 1 min, and discard the filtrate; reinstall the RNA purification column into the collection tube, add 500 μL of Buffer RW2 to the RNA purification column, centrifuge at 12000g for 1 min, and discard the filtrate; reinstall the RNA purification column into the collection tube, centrifuge at 12000g for 2 min, transfer the RNA purification column to a new 1.5 mL EP tube, add 30 μL of RNase-Free Water to the center of the purification column, and let it stand at room temperature for 2 min; centrifuge at 12000g for 1 min, discard the filtration column, detect the RNA concentration and quality, and store at -80 °C. The above steps are all carried out on ice.
[0052] (3) Obtain cDNA by reverse transcription
[0053] Use the Abclonal reverse transcription kit to prepare cDNA. The specific operation steps are as follows:
[0054] Add 4 μL of Abclonal's 5×qRT SuperMix and 1 μg of the above-obtained RNA to an EP tube, add RNase-Free Water to make up the volume to 20 μL, mix well and centrifuge with a handheld centrifuge until the liquid aggregates at the bottom of the tube, and perform reverse transcription reaction in a Bio-rad PCR instrument. The reverse transcription conditions are 25 °C for 5 min; 42 °C for 20 min; 85 °C for 5 sec. After completion, store at -20 °C.
[0055] (4) Real-time fluorescence quantitative PCR
[0056] Add 20 ng of the above cDNA, 5 μL of Bimake 2×SYBR Green qPCR MasterMix, 0.5 μL of 5 μM forward primer, and 0.5 μL of 5 μM reverse primer to each well of a 384-well plate, and add RNase-Free Water to make the volume up to 10 μL; use a CFX384 quantitative PCR instrument from Bio-rad for amplification, and the reaction conditions are: 95°C for 5 min, 95°C for 15 s, 60°C for 30 s, repeat 39 cycles. The experimental results were analyzed using the ΔΔCT method by comparing with the housekeeping gene GAPDH.
[0057] The primer sequences used in this experiment are as follows:
[0058] GAPDH forward primer: AATGAAGGGGTCATTGATGG (as shown in SEQ ID NO.1), reverse primer: AAGGTGAAGGTCGGAGTCAA (as shown in SEQ ID NO.2);
[0059] FOXA2 forward primer: GGAGCAGCTACTATGCAGAGC (as shown in SEQ ID NO.3), reverse primer: CGTGTTCATGCCGTTCATCC (as shown in SEQ ID NO.4);
[0060] SOX17 forward primer: GCATGACTCCGGTGTGAATCT (as shown in SEQ ID NO.5), reverse primer: TCACACGTCAGGATAGTTGCAGT (as shown in SEQ ID NO.6);
[0061] CXCR4 forward primer: TACACCGAGGAAATGGGCTCA (as shown in SEQ ID NO.7), reverse primer: AGATGATGGAGTAGATGGTGGG (as shown in SEQ ID NO.8).
[0062] 2. Detect the efficiency of human embryonic stem cell differentiation into definitive endoderm by flow cytometry:
[0063] Wash the specified definitive endoderm cells obtained from the differentiation with DPBS to remove dead cells, then add TrypLE and incubate in a 37 °C cell culture incubator for 1 min. Gently pipette the cells with DPBS + 2% FBS to terminate digestion, evenly divide the cells and collect them into two 1.5 mL EP tubes, centrifuge at 4 °C and 3000 rpm for 3 min, and aspirate the supernatant. Dilute the CXCR4-APC and APC-Isotype (negative control group) antibodies with DPBS + 2% FBS at a dilution ratio of 1:200. Take 200 μL of the diluted antibody respectively to disperse and mix the cell pellet, place it on ice and incubate in the dark for 30 min. Centrifuge at 4 °C and 3000 rpm for 3 min, discard the supernatant, resuspend the cells with DPBS + 2% FBS, centrifuge at 4 °C and 3000 rpm for 3 min, and discard the supernatant. Finally, resuspend the cells with ice-cold DPBS and transfer them to a flow tube, and detect the positive rate of CXCR4 by flow cytometry. The antibody used in this experiment is Ant-CXCR4 (555976, 1:200, BD Biosciences).
[0064] 3. Detect the efficiency of human embryonic stem cell differentiation into definitive endoderm by immunofluorescence:
[0065] Wash the specified definitive endoderm cells obtained from the differentiation with DPBS to remove dead cells, add an appropriate amount of 4% PFA to each well, incubate at room temperature for 15 min, and wash once with DPBS; add an appropriate amount of blocking solution (8.7 mL DPBS + 1 mL donkey serum + 0.3 mL 10% Triton-X100) to each well, incubate at room temperature for 30 min; discard the blocking solution, add an appropriate amount of primary antibody diluted with the blocking solution, incubate at room temperature for 2 h, and wash three times with DPBS, 5 min each time; discard the DPBS, add an appropriate amount of secondary antibody diluted with the blocking solution, incubate at room temperature in the dark for 2 h, and wash three times with DPBS, 5 min each time; discard the DPBS, add an appropriate amount of DAPI diluted with DPBS, incubate at room temperature in the dark for 10 min, and wash once with DPBS; finally, soak the cells with DPBS, place them under an inverted fluorescence microscope for fluorescence observation and collect pictures. The primary antibodies used in this experiment are Anti-FOXA2 (ET1703-76, 1:200, HuaBio); Anti-OCT4 (sc-5279, 1:200, SANTACRUZ). The fluorescent secondary antibodies used in this experiment are DoαMs TRITC (1:200, Jackson ImmunoResearch); DoαRb 488 (1:200, Jackson ImmunoResearch); nuclear dye: DAPI (Roche, USA).
[0066] II. Test Results and Analysis
[0067] 1. Example 1 and Comparative Example 1
[0068] Detect the mRNA and protein expression levels of definitive endoderm marker genes in the cells of Example 1 and Comparative Example 1. The specific results are shown in Figures 1-3 .
[0069] Figure 1 are the mRNA expression levels of definitive endoderm marker genes FOXA2, SOX17, and CXCR4 in the cells of Example 1 and Comparative Example 1, where "ACE-0mM" is Comparative Example 1. The results show that compared with 1-fold of the comparative example, after adding 5, 10, and 15 mM of sodium acetate in Example 1, the expression level of FOXA2 increased by 1.1, 1.3, and 1.6 times, the expression level of SOX17 increased by 1.0, 1.3, and 1.4 times, and the expression level of CXCR4 increased by 1.2, 1.4, and 1.5 times.
[0070] Figure 2 are the flow cytometry results of the proportion of CXCR4-positive cells of definitive endoderm marker genes in Example 1 and Comparative Example 1. Compared with the 30% positive rate of the comparative example "ACE-0mM", with the addition of sodium acetate in Example 1, the proportion of CXCR4-positive cells increased significantly in a concentration-dependent manner. When the concentration of added sodium acetate was 15 mM, the proportion of positive cells in Example 1 increased by 15%.
[0071] Figure 3 are the immunofluorescence results of the proportion of FOXA2-positive cells of definitive endoderm marker genes and OCT4-positive cells of pluripotency marker genes in Example 1 and Comparative Example 1. The results show that compared with Comparative Example 1, after adding sodium acetate during the differentiation process, the positive rate of the pluripotency gene OCT4 decreased significantly, and the positive rate of the definitive endoderm marker gene FOXA2 increased significantly.
[0072] Figures 1-3 The results all show that the addition of sodium acetate can significantly promote the differentiation of definitive endoderm and has concentration dependence.
[0073] Finally, it should also be noted that the term "comprising", "including" or any other variant thereof is intended to cover non-exclusive inclusion, so that a process, method, article or device comprising a series of elements not only includes those elements, but also includes other elements not expressly listed, or also includes elements inherent to such process, method, article or device.
[0074] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these embodiments once they learn the basic creative concept. Therefore, the appended claims are intended to be construed as including the preferred embodiments and all changes and modifications falling within the scope of the present invention.
[0075] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention also intends to include these modifications and variations.
Claims
1. Use of sodium acetate in enhancing the differentiation efficiency of human pluripotent stem cells into definitive endoderm cells, characterized in that: The human pluripotent stem cell described is the human embryonic stem cell HUES8.
2. The application according to claim 1, wherein The concentration of the sodium acetate described is 5-15 mM.
3. A culture medium for differentiating human pluripotent stem cells into definitive endoderm cells, characterized in that, The culture medium described comprises: the basal medium DMEM / F12, 100 ng / mL Activin A, 25 ng / μL Wnt3a, 0.2% fatty acid-free bovine serum albumin, 1% double antibody, 5-15 mM sodium acetate.
4. A culture method for differentiating human pluripotent stem cells into definitive endoderm cells, characterized in that, The method described comprises the following steps: culturing human pluripotent stem cells with the culture medium described in claim 3 to direct their differentiation into definitive endoderm cells; the human pluripotent stem cell described is the human embryonic stem cell HUES8.
5. The culture method for differentiating human pluripotent stem cells into definitive endoderm cells according to claim 4, characterized in that, The method described comprises the following steps: culturing human pluripotent stem cells with a stem cell maintenance medium, and when the cell density reaches 75-85%, replacing it with the culture medium described in claim 3 for culture to obtain definitive endoderm cells.
6. The culture method for differentiating human pluripotent stem cells into definitive endoderm cells according to claim 5, characterized in that, The stem cell maintenance medium described comprises E8.
Citation Information
Patent Citations
Methods of specifying mesodermal, endodermal and mesoendodermal cell fates
CN101365784A
Application of thiamine in promoting differentiation of human pluripotent stem cells into finalized endoderm cells
CN111304148A