A method for constructing a bacillus subtilis small RNA regulatory system

By designing non-coding sRNAs with specific structures and directly linking them to Bacillus subtilis expression vectors, the problem of complex genome modification in existing technologies has been solved, enabling rapid and efficient regulation of endogenous and exogenous genes, which is suitable for product regulation in metabolic engineering.

CN116064518BActive Publication Date: 2025-11-25JIANGNAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202210920352.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-02
Publication Date
2025-11-25
Estimated Expiration
2042-08-02

Smart Images

  • Figure CN116064518B_ABST
    Figure CN116064518B_ABST
Patent Text Reader

Abstract

The application discloses a kind of Bacillus subtilis small RNA regulatory system construction method, belong to the field of bioengineering technology.The present application can quickly design to produce a large number of sRNA regulatory tools to knock down the gene expression in Bacillus subtilis.Compared with other regulation methods, the present application does not need to express other RNA chaperone proteins and other genes, and does not need to modify the target gene, and is simple and efficient in operation.Secondly, the present application can quickly design a large number of artificial sRNA regulatory tools with different sequences, which enriches the types and quantities of the regulation element library.Using the sRNA of the present application can achieve different degrees of inhibition of Bacillus subtilis exogenous genes gfp, endogenous genes ftsZ, comER, aslR, aslD, ldh, pta, acoA, bdhA, etc., which can effectively regulate the expression of the target gene.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a method for constructing a small RNA regulatory system of Bacillus subtilis, and belongs to the technical field of bioengineering. BACKGROUND

[0002] Bacillus subtilis is considered to be the next generation of ultra-high efficient secretion cell factory due to its clear genetic background, superior secretion ability and simple culture conditions. Non-coding small RNA (sRNA) is an important post-transcriptional regulator in Bacillus subtilis, which can regulate the expression level of its corresponding target genes. In most cases, sRNA binds to target RNA through its sequence specificity to cause conformational changes to inhibit or activate mRNA translation, or through base pairing to form an RNase action site to promote the degradation of target RNA, thereby regulating gene expression at the post-transcriptional level.

[0003] The sRNA system that has been studied in the model microorganism Bacillus subtilis is the type I toxin-antitoxin (TA) system. The TA system usually includes a stable toxin that overexpression can cause cell growth arrest or death, and an unstable antitoxin that can counteract the effect of the toxin. The specific mechanism is 1. The toxin mRNA and the antitoxin mRNA have a pairing region at the 3' end, and after pairing, they form an endonuclease action site and are degraded by several RNases; 2. When the pairing region is at the 5' end of the toxin mRNA, it can block the translation of the toxin mRNA by base pairing to shield the RBS. By using the above mechanism, the type I TA system can be artificially modified into an sRNA targeting any gene.

[0004] The yonT-yoyJ / SR6 is a type I toxin-antitoxin system derived from the B. subtilis 168 genome source phage SPβ. Its antitoxin trans-acting sRNA SR6 is about 100 nt, and its 5' end can complementarily pair with the 5' end of the yoyJ mRNA of the toxin protein gene to form a double-stranded region, thereby causing translation repression of the yoyJ mRNA, inhibiting the expression of the toxin protein, and allowing the host cell to grow without being affected.

[0005] There are corresponding gene expression regulation tools for each stage of gene expression. The main tools for regulation at the transcription level are: promoters, which can achieve different intensity expression of target proteins by replacing the constitutive promoter upstream of the target gene, and can also use inducible promoters and change the expression intensity of the gene by inducers, but the disadvantage is that the sequence around the target gene on the genome needs to be modified, and the operation is complex; CRISPR-dCas9, dCas9 can be positioned to the target sequence by guide RNA to hinder the transcription of the gene, or by designing dCas9 to combine with the transcription activator and recruit RNA polymerase (RNA polymerase, RNAP) to promote gene transcription, but the disadvantage is that the dCas9 protein with certain toxicity needs to be expressed additionally to bring a burden to the growth of cells; riboswitch, riboswitch is composed of two parts: aptamer and expression platform. The aptamer can bind to a specific ligand to cause changes in the secondary structure of mRNA, thereby affecting the transcription of downstream genes, and the disadvantage is that the sequence around the target gene on the genome still needs to be modified, and the operation is complex. The tools for regulation at the post-transcriptional level are often achieved by sRNA, but the sRNA regulation tool naturally modified in Bacillus subtilis, such as MS-DOS (reference paper: Yang S, Wang Y, Wei C, et al. A new sRNA-mediated posttranscriptional regulation system for Bacillus subtilis. Biotechnol Bioeng. 2018; 115(12): 2986-2995. doi: 10.1002 / bit.26833), is to achieve the degradation of the mRNA of the target gene by inserting the OPR sequence after the stop codon of the target gene on the genome and pairing with sRNA, and the disadvantage is that the sequence around the target gene on the genome still needs to be modified, and the operation is complex. SUMMARY

[0006] The present application is based on yoyJ / SR6 in the endogenous TA system of Bacillus subtilis, and a method for quickly constructing small RNA regulatory elements of Bacillus subtilis is proposed.

[0007] In order to quickly construct a large number of target Bacillus subtilis endogenous target gene inhibitory elements, the sRNA sequence is designed according to the following rules based on the structure of SR6: the stem length of the artificial control design is 8 bp and 11 bp, the loop length is 4 nt, the total free energy is greater than -15 kcal / mol, a hairpin structure is added to the 3' end of 9 polyU, and a non-coding sRNA with gene regulation function is formed. Then, the reverse complementary sequence of the start codon and the 21 nt sequence after the target gene to be regulated is connected to the 5' end of the sRNA, and the sRNA is assembled on the Bacillus subtilis expression vector and transformed into Bacillus subtilis to realize the expression regulation of the target gene.

[0008] The sRNA of the application does not need to express other proteins to assist the function of the sRNA, and does not need to additionally modify the target gene, and only needs to be transformed into a plasmid to realize the rapid and convenient inhibition of the target gene.

[0009] The first object of the application is to provide a non-coding sRNA targeting Bacillus subtilis endogenous or exogenous genes, which is composed of a 24 nt long target gene complementary sequence, a hairpin structure and 9 polyU; the stem length of the hairpin structure is 8 bp or 11 bp, the loop length is 4 nt, and the total free energy is greater than -15 kcal / mol.

[0010] In one embodiment, the hairpin structure and the region of 9 polyU of the non-coding sRNA are respectively shown in the non-target gene complementary sequence region of Seq ID NO. 1-5, Seq ID NO. 7-14.

[0011] In one embodiment, the Bacillus subtilis is Bacillus subtilis SCK.

[0012] In one embodiment, the endogenous gene includes a gene on the Bacillus subtilis genome; the exogenous gene includes any non-Bacillus subtilis-derived gene that can be expressed in Bacillus subtilis.

[0013] In one embodiment, the endogenous gene includes ftsZ, comER, acoA, bdhA, aslR, aslD, ldh, pta.

[0014] In one embodiment, the exogenous gene includes green fluorescent protein, red fluorescent protein, yellow fluorescent protein and other exogenous genes that can be expressed in Bacillus subtilis.

[0015] The second object of the present application is to provide a method for inhibiting the expression of green fluorescent protein, which comprises introducing a recombinant expression vector containing a non-coding sRNA as shown in any one of Seq ID NO. 3-5 into a recombinant Bacillus subtilis expressing green fluorescent protein.

[0016] In one embodiment, the recombinant expression vector is P43NMK, which utilizes P 43 The expression of the non-coding sRNA is initiated.

[0017] The third object of the present application is to provide a method for inhibiting the expression of an endogenous gene in Bacillus subtilis, which comprises inhibiting the expression of the endogenous gene using the non-coding sRNA.

[0018] In one embodiment, the endogenous gene comprises ftsZ, comER, acoA, bdhA, aslR, aslD, ldh, pta.

[0019] In one embodiment, the non-coding sRNA sequence as shown in Seq ID NO. 7-14 is connected to the expression vector P43NMK using the promoter P 43 The expression of the non-coding sRNA is initiated, and a recombinant expression vector is constructed.

[0020] In one embodiment, the recombinant expression vector is introduced into Bacillus subtilis to construct a recombinant Bacillus subtilis, and the recombinant Bacillus subtilis is cultured at 30-40℃ for 30-50h.

[0021] Preferably, the Bacillus subtilis is Bacillus subtilis SCK.

[0022] The fourth object of the present application is to provide a method for increasing the production of acetoin, which comprises expressing a non-coding sRNA containing a target sequence of a gene related to acetoin metabolism in Bacillus subtilis.

[0023] In one embodiment, the gene related to acetoin metabolism comprises aslD, ldh, pta, acoA, bdhA.

[0024] In one embodiment, the non-coding sRNA as shown in any one of Seq ID NO. 10-14 is expressed in Bacillus subtilis.

[0025] In one embodiment, the Bacillus subtilis is cultured in a fermentation medium at an initial OD 600 = 0.1-0.5.

[0026] In one embodiment, the fermentation medium contains 8-12 g / L yeast extract, 5-6 g / L tryptone, 5-6 g / L (NH4)2SO4, 10-15 g / L K2HPO4·3H2O, 1-5 g / L KH2PO4, 1-5 g / L MgSO4, 10-30 g / L glucose, 5-15 mL / L trace elements.

[0027] In one embodiment, the culture is carried out at 37°C for 48 h.

[0028] The beneficial effects of the present application:

[0029] The present application can quickly design a large number of sRNA regulatory tools to knock down the expression of genes in Bacillus subtilis. Compared with other regulation methods, the present application does not require the expression of other RNA chaperone proteins and other genes, and does not require modification of the target gene, and is simple and efficient. Secondly, the present application can quickly design a large number of artificial sRNA regulatory tools with different sequences, enriching the types and quantities of the regulation element library. Using the sRNA of the present application, different degrees of inhibition of exogenous genes gfp, endogenous genes ftsZ, comER, aslR, aslD, ldh, pta, acoA, bdhA, etc. can be achieved, which can effectively regulate the expression of the target gene. BRIEF DESCRIPTION OF DRAWINGS

[0030] Figure 1 is a schematic diagram of the sRNA structure of the present application.

[0031] Figure 2 is a schematic diagram of the construction of Bacillus subtilis post-transcriptional regulation system based on SR6 structure and the mechanism.

[0032] Figure 3 is a schematic diagram of sRNA expression vector P43NMK-sRNA.

[0033] Figure 4 is a schematic diagram of the effect of sRNA expression system applied to inhibit gfp expression.

[0034] Figure 5 is a schematic diagram of the effect of sRNA system applied to Bacillus subtilis morphology and cell membrane modification.

[0035] Figure 6 is a schematic diagram of the regulation of sRNA system applied to Bacillus subtilis natural product acetoin production. DETAILED DESCRIPTION

[0036] The nucleotide sequence information involved in the examples is as follows:

[0037] The sequence information of SEQ ID NO. 1 is a constitutive promoter P 43Sequence;

[0038] SEQ ID NO. 2 is the sequence of sRNA-SR6mini;

[0039] SEQ ID NO. 3 is the sequence of sRNA-Random1;

[0040] SEQ ID NO. 4 is the sequence of sRNA-Random2;

[0041] SEQ ID NO. 5 is the sequence of sRNA-Random3;

[0042] SEQ ID NO. 6 is the sequence of gfp gene;

[0043] SEQ ID NO. 7 is the sequence of sRNA-Random4;

[0044] SEQ ID NO. 8 is the sequence of sRNA-Random5;

[0045] SEQ ID NO. 9 is the sequence of sRNA-Random6;

[0046] SEQ ID NO. 10 is the sequence of sRNA-Random7;

[0047] SEQ ID NO. 11 is the sequence of sRNA-Random8;

[0048] SEQ ID NO. 12 is the sequence of sRNA-Random9;

[0049] SEQ ID NO. 13 is the sequence of sRNA-Random10;

[0050] SEQ ID NO. 14 is the sequence of sRNA-Random11;

[0051] SEQ ID NO. 15 is the sequence of wild type SR6.

[0052] Preparation of Bacillus subtilis competence and plasmid transformation method refer to the paper: Bacillus subtilis gene regulation expression system construction and its application in fermentation engineering[D]. Yangsen, Jiangnan University, 2017.

[0053] P43NMK-P 43 -sRNA construction:

[0054] pHT01-P spove -GFP construction: use primer Pspove -GFP-F / P spove -GFP-R from the genome of strain B. subtilis GFP (Construction of Bacillus subtilis Gene Regulatory Expression System and Its Application in Fermentation Engineering[D]. Yangsen, Jiangnan University, 2017) spove -GFP; pHT01 vector was amplified using pHT01-GFP-F / pHT01-GFP-R and adding homologous arms. The above fragment was ligated by one-step cloning kit to obtain pHT01-P spove -GFP and its accuracy was confirmed by sequencing.

[0055] (1) Strains

[0056] Bacillus subtilis SCK (Bacillus subtilis 168, lacA::P xylA -comK, construction method reference: Zhang XZ, Zhang Y-. Simple, fast and high-efficiency transformation system for directed evolution of cellulase in Bacillus subtilis. Microb Biotechnol. 2011 Jan;4(1):98-105. doi: 10.1111 / j.1751-7915.2010.00230.x. PMID: 21255377; PMCID: PMC3815800.); Escherichia coli JM109

[0057] (2) Culture medium

[0058] Luria-Bertani (LB) medium: 10 g·L -1 Tryptone, 5 g·L -1 Yeast extract, 10 g·L - 1 NaCl; solid medium needs to add 1.5% (w·v -1 ) agar powder.

[0059] LBGM medium: 10 g·L -1 Tryptone, 5 g·L -1 Yeast extract, 5 g·L -1NaCl. Additional 1% (v / v) glycerol, 100 μM MnSO4were added when used, and 1.5% (w-v) agar powder was additionally added for solid medium. -1

[0060] Fermentation medium: 12 g / L yeast extract, 6 g / L tryptone, 6 g / L (NH4)2SO4, 12.5 g / L K2HPO4-3H2O, 2.5 g / L KH2PO4, 3 g / L MgSO4, 20 g / L glucose, 10 mL / L trace elements.

[0061] Trace element solution: 2.4 g / L FeCl3-6H2O, 0.8 g / L CoCl2-6H2O, 0.15 g / L CuCl2-2H2O, 0.3 g / L ZnCl2, 0.3 g / L Na2MoO4-2H2O, 0.075 g / L H3BO3, 1.2 g / L MnSO4, 10 g / L CaCl2-2H2O.

[0062] Antibiotic final concentration: Ampicillin (Amp) 100 μg-mL -1 , Chloramphenicol (Cm) 5 μg-mL -1 , Kanamycin (Kana) 50 μg-mL -1 .

[0063] The molecular biology experimental methods not specifically described in the following examples were performed according to the specific methods listed in the book "Molecular Cloning Experiment Guide" (third edition) by J. Sambrook, or according to the kit and product instructions.

[0064] Table 1 Primer sequences involved in the examples

[0065]

[0066]

[0067] Example 1: sRNA expression vector p43NMK-P 43 Construction of sRNAs

[0068] ​P43NMK was amplified using primers SR6-NO-F / R, SR6-F / R, SR6-mini-F / SR6-mini-R, SR6-11stem-F / R, Random1-F / Random1-R, Random2-F / Random2-R, Random3-F / Random3-R, Random4-F / Random4-R, Random5-F / Random5-R, Nowhere-F / Nowhere-R, respectively; two rounds of amplification were performed using primers antibdhA-F / R / R-2, antiacoA-F / R / R-2, antildh-F / R / R-2, antipta-F / R / R-2, antialsD-F / R / R-2, antiaslR-F / R / R-2, after which sRNA sequences were introduced into both ends of the linearized template using the amplification primers, obtaining DNA linear fragments with sRNA homologous arms at both ends, which were recovered and introduced into Escherichia coli JM109 competence by chemical transformation, constructing P43NMK-P 43 Nowhere-SR6, P43NMK-P 43 SR6-antiGFP, P43NMK-P 43 SR6-11stem-antiGFP, P43NMK-P 43 SR6-mini-antiGFP, P43NMK-P 43 Random1-antiGFP, P43NMK-P 43 Random2-antiGFP, P43NMK-P 43 Random3-antiGFP, P43NMK-P 43 Random4-antiComER, P43NMK-P 43 Random5-antiFtsZ, P43NMK-P 43 Random6-antiaslR, P43NMK-P 43 Random7-antiaslD, P43NMK-P 43 Random8-antildh, P43NMK-P 43 Random9-antipta, P43NMK-P 43 Random10-antiacoA, P43NMK-P 43 Random11-antibdhA. The above plasmids were confirmed for sequence accuracy by Sanger sequencing.

[0069] Example 2: Exogenous gene GFP expression vector pHT01-P spove Construction of -GFP

[0070] P spove -GFP-F / P spove -GFP; P spove -GFP was amplified from the genome of strain B. subtilis GFP (Construction of B. subtilis gene regulatory expression system and its application in fermentation engineering[D]. Yangsen, Jiangnan University, 2017) using pHT01-GFP-F / pHT01-GFP-R and adding homologous arms. The above-mentioned fragment was ligated by one-step cloning kit to obtain pHT01-P spove -GFP and its accuracy was confirmed by sequencing.

[0071] Example 3: Application of sRNA regulation tool to achieve inhibition of exogenous gene GFP

[0072] A small amount of B. subtilis SCK bacterial liquid was taken from the bacteria preservation tube using an inoculation loop and streaked on the corresponding resistant LB plate, and then placed in a 37°C constant temperature incubator for overnight culture. Then a single colony on the plate was picked up using an inoculation loop into a shaking tube containing 2 mL of LB liquid medium and cultured at 37°C, 220 r·min -1 After overnight culture, LB medium and 10% xylose solution with a final concentration of 10% were added to dilute to OD 600 = 1, and 300 μL of each was dispensed into a 1.5 mL sterile EP tube after 2 h of induction, and 2-10 μg of the target plasmid was added, and then cultured at 37°C, 220 r·min -1 spring shaker for 2 h, and finally plated on the corresponding resistant plate and cultured in a 37°C constant temperature incubator.

[0073] According to the above method, the single colonies containing pHT01-P spove -GFP and P43NMK-P 43 -sRNA (SR6, SR6-mini, Random1, Random2, Random3)-antiGFP recombinant strains were inoculated into 50 mL shaking tubes containing 5 mL of corresponding LB medium and cultured overnight as seed liquid, and inoculated into 250 mL flat-bottomed shake flasks containing 25 mL of corresponding LB medium at OD 600 = 0.1 at 37°C, 220 r·min -1The cells were cultured in a shaker and sampled at intervals, diluted at a certain ratio, and 200 μL of the solution was loaded into a 96-well black plate. The cell optical density and relative fluorescence intensity were determined using a multifunctional microplate reader (F.L., excitation wavelength: 490 nm, emission wavelength: 530 nm, gain: 50). Three biological replicates and two technical replicates were set for each sample. The inhibition efficiency was found to be above 80% from the fluorescence density data, indicating that SR6 (inhibition efficiency 83.03%), SR6-11stem (85.78%), SR6-mini (87.02%), and Random 1 (inhibition efficiency 85.81%), Random 2 (inhibition efficiency 84.54%), and Random 3 (inhibition efficiency 84.36%) based on the structure design can achieve inhibition of pHT01-P spove Inhibition of the expression of fluorescent proteins on the GFP vector.

[0074] Example 4: Application of sRNA regulation tool to achieve inhibition of endogenous genes ftsZ and comER

[0075] ftsZ is a gene in Bacillus subtilis associated with the initiation of cell division, and when severely inhibited, the cell division of the bacterial cells is disturbed, resulting in a change in cell morphology from short rod-shaped to elongated; comER is a gene in Bacillus subtilis associated with biofilm formation, and when knocked out or severely inhibited, it will interfere with the formation of biofilm in Bacillus subtilis.

[0076] The constructed and transformed plasmid P43NMK-P 43 -Nowhere-SR6 (as a control for not targeting the target gene), P43NMK-P 43 -Random4-antiComER, P43NMK-P 43 -Random5-antiFtsZ to the corresponding resistant LBGM plate, after incubation at 37°C for 36 h, the colonies were resuspended with PBS buffer and examined under a microscope, and the inhibition efficiency was calculated from the number of cells in the field of view. Figure 5 It can be seen from the above table that compared with the control P43NMK-P 43 -Nowhere-SR6 and P43NMK-P 43 -Random4-antiComER, recombinant strain pP43NMK-P 43 -Random5-antiFtsZ, the bacterial cells were significantly elongated.

[0077] P43NMK-P 43 -Nowhere-SR6, P43NMK-P 43 -Random5-antiFtsZ, P43NMK-P 43-Random4-antiComER to 50mL shake tubes containing 5mL LBGM with corresponding resistance were cultured for 12h, then inoculated to 6-well VWR plates at 1‰ (v / v) (each well was loaded with 3mL LBGM containing corresponding resistance), and observed for biofilm formation after 72h incubation in a 30℃ incubator. From Figure 5 It can be seen from P43NMK-P 43 The biofilm formation of Random4-antiComER was inhibited.

[0078] Example 5: Application of sRNA regulation tool to achieve expression regulation of acetoin production

[0079] The aslR and aslD genes directly related to the pathway of methylglyoxal metabolism were selected for regulation. The ldh and pta genes in the pathway of methylglyoxal synthesis precursor metabolism, and the acoA and bdhA genes in the pathway of methylglyoxal degradation were selected for regulation. The plasmid P43NMK-P 43 -Nowhere-SR6, P43NMK-P 43 -Random6-antiaslR, P43NMK-P 43 -Random7-antiaslD, P43NMK-P 43 -Random8-antildh, P43NMK-P 43 -Random9-antipta, P43NMK-P 43 -Random10-antiacoA, P43NMK-P 43 -Random11-antibdhA were transformed into Bacillus subtilis SCK, respectively, to construct recombinant strains. The recombinant bacteria were cultured on LB plates with corresponding resistance, and after overnight culture, the bacterial bodies were picked into 5mL LB solution containing corresponding resistance and cultured for 12h as seed liquid. Then, the initial OD 600 = 0.1 was transferred to a 250mL flat-bottomed flask containing 25mL fermentation medium and cultured at 37℃ for 48h. Then, the supernatant was collected by centrifugation at 13000rpm for 5min and the methylglyoxal yield was determined by high performance liquid chromatography (HPLC, Agilent 1260). The detection conditions are as follows (Design, Construction and Application of CRISPR-based Bacillus subtilis Gene Editing and Expression Regulation System[D]. Wu Yaokang, Jiangnan University, 2021.): The injection volume was 10μL, the mobile phase was 10mM dilute sulfuric acid, the column type was HPX-87H (300×7.8mm, 250×4.6mm, 5μm), the RID detector temperature was set to 40℃, and the flow rate was 0.6mL / min. All experiments were repeated at least three times. The measured yield is shown in the accompanying HPX-87H (300×7.8mm, 250×4.6mm, 5μm), RID detector temperature set to 40℃, flow rate 0.6mL / min. All experiments were repeated at least three times. The measured yield is shown in the accompanying Figure 6, compared with the control strain P43NMK-P 43 Nowhere-SR6, the regulation range of acetoin production activity of the recombinant strain can reach 38% to 220%. When alsD is inhibited, the acetoin production activity of the recombinant strain can be down-regulated to 38% of the control strain; when acoA is inhibited, the acetoin production activity of the recombinant strain can be up-regulated to 220% of the control strain; when bdhA is inhibited, the acetoin production activity of the recombinant strain can be up-regulated to 173% of the control strain; when ldh is inhibited, the acetoin production activity of the recombinant strain can be up-regulated to 191% of the control strain. It is shown that the sRNA strategy can be applied in the field of metabolic engineering to regulate the production of metabolites.

[0080] Seq ID NO. 1 sequence of constitutive promoter P43

[0081] TGATAGGTGGTATGTTTTCGCTTGAACTTTTAAATACAGCCATTGAACATACGGTTGATTTAATAACTGACAAACATCACCCTCTTGCTAAAGCGGCCAAGGACGCTGCCGCCGGGGCTGTTTGCGTTTTTGCCGTGATTTCGTGTATCATTGGTTTACTTATTTTTTTGCCAAAGCTGTAATGGCTGAAAATTCTTACATTTATTTTACATTTTTAGAAATGGGCGTGAAAAAAAGCGCGCGATTATGTAAAATATAAA

[0082] Seq ID NO. 2 sRNA sequence of sRNA-SR6mini

[0083] GAAAAGTTCTTCTCCTTTACTCAT GGCGTATACGTTGTTGCGTATACGCTTTTTTTTTT

[0084] Seq ID NO. 3 sRNA-Random1 sequence

[0085] GAAAAGTTCTTCTCCTTTACTCAT GGCTAGCGACCGAGCGGTCGCTAGCCTTTTTTTTT

[0086] Seq ID NO. 4 sRNA-Random2 sequence

[0087] GAAAAGTTCTTCTCCTTTACTCAT GCCATTCGTACACTTGTACGAATGGCTTTTTTTTT

[0088] Seq ID NO. 5 sRNA-Random3 sequence

[0089] GAAAAGTTCTTCTCCTTTACTCAT GGAACACTTCCCGTCGGAAGTGTTCCTTTTTTTTT

[0090] Seq ID NO. 6 gfp gene sequence

[0091] ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAGCTTCCTGTTCCTTGGCCAACACTTGTCACTACTCTTACTTATGGTGTTCAATGCTTTTCAAGATACCCAGATCATATGAAGCGGCACGACTTCTTCAAGAGCGCCATGCCTGAGGGATACGTGCAGGAGAGGACCATCTTCTTCAAGGACGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAGGGAGACACCCTCGTCAACAGAATCGAGCTTAAGGGAATCGATTTCAAGGAGGACGGAAACATCCTCGGCCACAAGTTGGAATACAACTACAACTCCCACAACGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAA

[0092] Seq ID NO. 7 sRNA sequence targeting ftsZ sRNA-Random4

[0093] TATGTTTGTTTCGAACTCCAACATGAGTACGCTCTGGCGTACTCTTTTTTTTTT

[0094] Seq ID NO. 8 sRNA sequence targeting comER sRNA-Random5

[0095] TGTGCCGATAAAGCCTATCTTCAA GCGAGATCGCACGATCTCGCTTTTTTTTTT

[0096] Seq ID NO. 9 sRNA sequence targeting aslR sRNA-Random6

[0097] GTATTGAAGATGGCGAAGCTCCAT GGCCTGGCCTCGGCCAGGCCTTTTTTTTT

[0098] Seq ID NO. 10 sRNA sequence targeting aslD sRNA-Random7

[0099] TTGAATGTTGCTTTCTCGTTTCAT GGGGAGGCGAGCGCCTCCCCTTTTTTTTT

[0100] Seq ID NO. 11 sRNA sequence targeting pta sRNA-Random8

[0101] CACTGTTGAAAATAAATCTGCCAC GCCCGCACGAACGTGCGGGCTTTTTTTTT

[0102] Seq ID NO. 12 sRNA sequence targeting ldh sRNA-Random9

[0103] TTTATTTACATGTTTGTTCATCAT AGTGGGCCGGATGGCCCACTTTTTTTTTT

[0104] Seq ID NO. 13 sRNA sequence targeting bdhA sRNA-Random10

[0105] GTTATGCCATCTTGCTGCCTTCAT GGGGGATCAGCAGATCCCCCTTTTTTTTT

[0106] Seq ID NO. 14 sRNA sequence targeting acoA sRNA-Random11

[0107] GCCTTCTCGTTTTAACAATTTCAT GGCCCCTGTGACCAGGGGCCTTTTTTTTT

[0108] Seq ID NO. 15 Wild type SR6 sequence

[0109] GAACTAAAGGAGAAGTTCATTCCCCTTTAGCTTAGCTCTCATCGGCGTATACGTTGGCGTTGTCTCTTTGGTCGGAGCCGCTTGCGTATACGCTTTTTCTTTTTGCTTGTCCCATTCTTTAGGTTTCTTACCTTCTCAACTATTGTTAGACTGTTGATTGTAAGAACCGTTAAAGATATGAGGAAAGCAACTACGATACCCATTTTCTCAAGCAC

[0110] Although the present application has been disclosed in its preferred embodiments as above, it is not intended to limit the present application, and any person skilled in the art can make various modifications and modifications without departing from the spirit and scope of the present application, and the scope of protection of the present application should be defined by the claims.

Claims

1. A method for increasing the production of acetoin, characterized in that, The method is to express the non-coding sRNA containing the gene related to the metabolism of acetoin in Bacillus subtilis acoA The sequence of the non-coding sRNA is shown as SEQ ID NO.

14.

2. The method of claim 1, wherein, The Bacillus subtilis is cultured in a fermentation medium containing 8-12 g / L yeast extract, 5-6 g / L tryptone, 5-6 g / L (NH4)2SO4, 10-15 g / L K2HPO4-3H2O, 1-5 g / L KH2PO4, 1-5 g / L MgSO4, 10-30 g / L glucose, 5-15 mL / L trace elements at an initial OD 600 = 0.1-0.

5.

3. The non-coding sRNA targeting Bacillus subtilis acoA gene characterized in that, The sequence is shown as SEQ ID NO. 14.

Citation Information

Patent Citations

  • Method for fine-tuning gene expression levels using synthetic regulatory sRNA

    CN107109396A