Plant circRNA expression framework and applications thereof

Abstract

The application discloses a plant circRNA expression framework and application thereof, and belongs to the technical field of molecular biology. The plant circRNA expression framework is constructed by placing a Vv-circSIZ1 upstream flanking intron sequence and a Vv-circSIZ1 downstream flanking intron sequence on both sides of a low-expression circRNA. Further, the plant circRNA expression framework is inserted into a vector skeleton between BamHI and PstI of a circRNA-OE carrier plasmid constructed in the early stage by a homologous recombination method, so as to construct a plant circRNA overexpression carrier. The plant circRNA expression framework and the plant circRNA overexpression carrier can greatly improve the circularization efficiency of the low-expression circRNA, reduce the difficulty of constructing a carrier containing a long intron circRNA, and provide an effective method for studying the function of the plant circRNA.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to a plant circRNA expression framework and its applications. Background Technology

[0002] circRNAs are covalently closed circular RNA molecules formed through trans-splicing. With the development of high-throughput sequencing and bioinformatics technologies, circRNAs have been found to be widely present in various organisms, exhibiting characteristics such as high stability, sequence conservation, and tissue specificity. In the past five years, reports on the identification of plant circRNAs have involved more than 30 species, including rice, Arabidopsis thaliana, tobacco, and grape. Plant circRNAs exhibit spatiotemporal expression specificity, and the expression levels of some circRNAs change significantly during abiotic stress.

[0003] Highly efficient overexpression vectors are crucial for studying the function of circRNAs. In previous research, the inventors developed a plant circRNA overexpression vector and its construction method (CN 109943586A) based on a strategy of using reverse complementary sequences to assist its own flanking introns, which can effectively overexpress plant circRNAs. However, subsequent use revealed the following problems with this plant circRNA overexpression vector:

[0004] (1) Some low-expression circRNAs, such as Vv-circRNA_4328 and Vv-circRNA_4363, can improve the expression efficiency of circular RNA, but are far lower than the expression level of the corresponding linear RNA.

[0005] (2) When the circRNA has multiple exons and long introns, the ligation vector operation is difficult.

[0006] Therefore, the plant circRNA overexpression vector designed in patent CN 109943586A still needs further improvement and refinement. Summary of the Invention

[0007] In view of the above-mentioned prior art, the purpose of this invention is to provide a plant circRNA expression framework and its applications. The plant circRNA expression framework of this invention can significantly improve circRNA circularization efficiency, reduce the difficulty of constructing vectors containing long intron circRNAs, and provide an effective method for studying the function of plant circRNAs.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] In a first aspect, the present invention provides a plant circRNA expression framework, comprising: an upstream flanking intron sequence of Vv-circSIZ1, a mature target circRNA sequence, and a downstream flanking intron sequence of Vv-circSIZ1;

[0010] The nucleotide sequence of the upstream flanking intron sequence of Vv-circSIZ1 is shown in SEQ ID NO.1;

[0011] The nucleotide sequence of the downstream flanking intron sequence of Vv-circSIZ1 is shown in SEQ ID NO.2.

[0012] Specifically as follows:

[0013] Vv-circSIZ1 upstream flanking intron sequence:

[0014] TATATGTATCCTGTAATGGGCTTGCGGTTGGACTTGAAATCACGAATGATATCATGCTAAGGTTTGTCTTACATCCATAGTCAAACCTATTTGCTGCCCGACACTTGCTTTGTACATACATGATTCAGAATGATTTTAAAGAATGCAGCATGTTGCTCTCCCTTTCCCTCTCCTCTTTTCTTTTTAATAGGTAAATGCAGATTGAATAAAAATTAAAAGTATACATGGCATATACAACACAAAAAAG GAAGAAGGTGGGAGCCCTCTCCTCTTCTGTAGCTCCTCTTCCTCAAACTGGCCTTCTTAGGTTTTTTTTGGTCGGGTCCTCTTTTTTTCCCTTTAGGGATTCATGTGCTTGTTATGTGTTTTG TCCAGAGAAGCTTTAAACTATGTTTTTTGGGGCTATCAACTTGGTCTTATTAATTCCTAAATATGAAGTTTTAATTCAGTGTCTCCACTATGAAAAATCTCAAGTGTTTGGCCTTCTTGCGCAG

[0015] Vv-circSIZ1 downstream flanking intron sequence:

[0016] GTGAGTTTTCTCCTGCTAATGCACTTCTGTTTCTGGACTCTTATGGTTTATGATCCTTGTTTTTTTTATTCATTCTTGGACCTCTGTAGTAATTCTTGATTTGGGATAAACTTGCAAAAAGGTTTTTGTTTTATTGTTTGAATAGAATTACTTTAAGGACTTATATTGAAACTTATACTCACTGCTGATTTAGTTTTTGCAAAAGCCATTATGGTTTAATGTCATATGGAACCTATAAAAAAAGGTCTAA TGTTATATGTACTTTGCTGTAAAATCCAATAAATAGGTGATTTATGGCTTTAAAAATTTGTCTGGCTTGCCATTAAAGAAGAGGAATCAGTAACCTAAAGTTCTATCAAGAAAGAACCTGGTAGA GAAGTGTGAGTTGAGGATGGAGGATATGGTGATGCTTAGTGTTGGTGGAAGAGAACTCATGAAATTTTCTGTTTTCCTTTTGGGAGGTGAAGTGGAGTTGGTATATTACATTTCAATCTGATTTA

[0017] The mature sequence of the target circRNA does not contain its own introns or flanking introns. The target circRNA can be determined according to the actual application requirements. Preferably, the target circRNA is selected from Vv-circRNA_4328, Vv-circRNA_4363, and Vv-circRNA_1975; their mature sequences are shown in SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively. Specifically:

[0018] SEQ ID NO.3:

[0019]

[0020] SEQ ID NO.4:

[0021] GAATCCCCACTGCATGAGAAGGACCAATTACAGTCAGTGTCAACTTCAATGGATTCACAGATTCAATCCCGCTGCCTTGTCTGTTTGGGCAACAATAGTTGCCGGACGGTTCGTTCAAGAACAAAGCTGATGAACATTTTGATTGAAAAAGGAAAGCCTCAAGAAGCCCAGTTAATTTTCAACAGTTTAACCGAAGAAGGACACCGGCCAACTCTTATAACATATACAACTCTCTTAGCAGCCTTGACCCGCCAGAAGCGTTTCAAGTCCATTCCTTCACTCATCTCCAAGTTGGAAAAGAATGGTCTAAAGCCTGACTCTGTATTTTTCAATGCCATGATCAATGCTTTCTCTGAATCTGGGAATGTTAAAGAAGCCATGAAAATCTTTCGGAAAATGAAGGACAGGGGATGTAAGCCTACAACTAGTACCTTTAATACCTTGATTAAAGGGTAC GGGAATGCTGGTATGCCAGAAGAATGTCTGAAGCTGCTAGATTTAATGTCACAGGAAGAAAATGTGAAGCCTAATGATAGAACTTTCAATAGTCTTATCAGAGCATGGTGTAACAAGAAGAGAATAACAGAAGCATGGAATGTAGTGTACAAGATGGCTGCATCTGGTCTGCAACCCGATGTTGTCACATATAACACACTAGCAAGGGCTTATGCACAGAATGGGGAGACTAGTAGAGCCGAAGGAATGATATTAGAGATGCAGAACAACAGAGTTATGCCCAATGAGCGAACTTGTGGCATCATCATAAATGGATATTGCAAAGAAGGCAAAATGAAGGATGCCTTGAGGTTCTTGTACAGGATGAGGAATTATGGCGTGCATCCCAATCTTGTTATCTTCAACTCTCTTATCAAAGGATTTTTAGACATTACAGACACTGATGGAGTTGATGAG

[0022] SEQ ID NO.5:

[0023] ATCTGAAAGGGAGTTTCTCTATAAGATTCTAGGGGAAGTTATCAAGGCTGGTGCAACAACACTGAACATTCCTGACACCGTGGGTTATACCGTGCCTAATGAATTCGGACAATTGATTGCTGACATAAAATCCAACACCCCTGGAAT TGAAAATGTGATCATTTCAACGCACTGCCAAAATGATCTTGGGCTCTCTACTGCTAACACAATAGCGGGGGCATGTGCAGGGGCAAGACAAGTAGAAGTAACTATTAATGGAATTGGTGAAAGAGCTGGAAATGCTTCACTGGAGGAG

[0024] In a second aspect, the present invention provides a plant circRNA overexpression vector containing the above-described plant circRNA expression framework.

[0025] Furthermore, the plant circRNA overexpression vector also includes a vector backbone. The vector backbone refers to a DNA molecule capable of inserting exogenous DNA, introducing the exogenous DNA into recipient cells, and replicating itself. Preferably, the vector backbone is the circRNA-OE vector plasmid constructed in patent CN 109943586A.

[0026] A third aspect of the present invention provides a method for constructing the above-mentioned plant circRNA overexpression vector, comprising the following steps:

[0027] (1) Preparation of upstream flanking intron sequence of Vv-circSIZ1 - mature target circRNA sequence - downstream flanking intron sequence of Vv-circSIZ1;

[0028] (2) Connect the upstream flanking intron sequence of Vv-circSIZ1-target circRNA mature sequence-Vv-circSIZ1 downstream flanking intron sequence to the vector backbone.

[0029] Preferably, in step (1), using the grape genome as a template, the upstream flanking intron sequence of Vv-circSIZ1 is amplified using the primers shown in SEQ ID NO.6 and SEQ ID NO.7, SEQ ID NO.12 or SEQ ID NO.16, and the downstream flanking intron sequence of Vv-circSIZ1 is amplified using the primers shown in SEQ ID NO.10, SEQ ID NO.15 or SEQ ID NO.19 and the primer shown in SEQ ID NO.11, and then the mature sequence of the target circRNA is amplified using grape cDNA as a template.

[0030] Preferably, in step (2), the upstream flanking intron sequence of Vv-circSIZ1-target circRNA mature sequence-downstream flanking intron sequence of Vv-circSIZ1 is inserted into the space between BamHI and PstI of the vector backbone by homologous recombination.

[0031] In a fourth aspect, the present invention provides the use of the above-described plant circRNA expression framework or plant circRNA overexpression vector in any of the following (1)-(3):

[0032] (1) Overexpression of plant circRNA;

[0033] (2) Improve the circulation efficiency of low-expression circRNAs;

[0034] (3) Reduce the difficulty of constructing vectors containing long intron circRNAs.

[0035] The beneficial effects of this invention are:

[0036] This invention constructs a plant circRNA expression framework by placing upstream and downstream flanking intron sequences of Vv-circSIZ1 on either side of a low-expression circRNA. Furthermore, using a previously constructed circRNA-OE vector plasmid as the vector backbone, the plant circRNA expression framework is inserted between BamHI and PstI in the vector backbone via homologous recombination to construct a plant circRNA overexpression vector. Using the plant circRNA expression framework and overexpression vector of this invention significantly improves the circularization efficiency of low-expression circRNAs and reduces the difficulty of constructing vectors containing long intron circRNAs, providing an effective method for studying the function of plant circRNAs. Attached Figure Description

[0037] Figure 1 This is a structural diagram of the plant-based high-efficiency circRNA overexpression plasmid of the present invention.

[0038] Figure 2 The results of quantitative fluorescence detection of the grape circRNA overexpression vector according to the present invention; the figure shows the dual Y coordinates, with the coordinates of the back primer and the front primer being left Y and right Y, respectively. Detailed Implementation

[0039] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0040] As mentioned earlier, the inventors constructed a plant circRNA overexpression vector in their previous research, which can effectively overexpress plant circRNAs. However, in subsequent applications, it was found that for low-expression circRNAs, such as Vv-circRNA_4328 and Vv-circRNA_4363, although the plant circRNA overexpression vector can improve the expression efficiency of circular RNA, it is far lower than the expression level of the corresponding linear RNA; moreover, when the circRNA has multiple exons and contains long introns, the ligation vector is difficult to manipulate.

[0041] Based on this, the present invention modified the plant circRNA overexpression vector. The present invention unexpectedly discovered that after stable transformation of Vv-circSIZ1 flanking introns and Vv-circSIZ1 in tobacco, almost all transcripts formed circular sequences. Therefore, it was considered that placing the Vv-circSIZ1 flanking introns on both sides of the low-expression circRNA, replacing the target circRNA's own flanking introns in the original plant circRNA overexpression vector, might improve the circularization efficiency of the low-expression circRNA. Simultaneously, deleting the target circRNA's own introns in the original plant circRNA overexpression vector reduced the difficulty of vector ligation.

[0042] This invention ultimately constructs a highly efficient plant circRNA overexpression vector. This vector uses the previously constructed circRNA-OE vector plasmid as its backbone, and consists of a plant circRNA expression framework formed sequentially by the upstream flanking intron sequence of Vv-circSIZ1, the mature target circRNA sequence, and the downstream flanking intron sequence of Vv-circSIZ1. The plant circRNA expression framework is inserted between BamHI and PstI in the vector backbone via homologous recombination. The mature target circRNA sequence does not contain its own introns or flanking introns. Results show that, compared to the previously constructed plant circRNA overexpression vector (CN 109943586A), the plant circRNA overexpression vector constructed in this invention can significantly improve the expression efficiency of low-expression circRNAs while reducing the expression level of linear RNA. The operation is simple, providing a reference method for the efficient overexpression of plant circRNAs, thus this invention is proposed.

[0043] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0044] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions.

[0045] Example 1: Method for constructing the grape circRNA overexpression vector of the present invention

[0046] A circRNA-OE vector plasmid containing a pair of inversely complementary sequences was constructed according to the method in Example 1 of patent CN 109943586A. Two restriction enzyme sites, BamHI and PstI, exist between the inversely complementary sequences, allowing for the insertion of a sequence between these sites. In this example, homologous recombination is used to insert the upstream flanking intron sequence of Vv-circSIZ1 – the mature target circRNA sequence – the downstream flanking intron sequence of Vv-circSIZ1 between BamHI and PstI. To distinguish it from circRNA-OE, the vector constructed using this invention's strategy is called circRNA-OE2.

[0047] The upstream flanking intron sequence and the downstream flanking intron sequence of Vv-circSIZ1 were cloned from grape genomic DNA; the mature circRNA sequence was cloned from cDNA. This invention uses Vv-circRNA_4328, Vv-circRNA_4363, and Vv-circRNA_1975 as examples, and their mature nucleotide sequences are shown in SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively. Primers for three amplification fragments were designed according to the requirements of the ClonExpress MultiS One Step Cloning Kit.

[0048]

[0049] Note: In the table, (1) represents the amplified upstream flanking intron sequence of Vv-circSIZ1; (2) represents the amplified mature sequence of the target circRNA; and (3) represents the amplified downstream flanking intron sequence of Vv-circSIZ1.

[0050] PCR was performed using PrimeSTAR Max Premix high-fidelity enzyme (20 μL reaction mixture: 10 μL PrimeSTAR Master Mix, 0.3 μM forward and reverse primers, 1 μL template, water to bring the total to 20 μL). The program was as follows: 98℃ for 10 s, 55℃ for 5 s, 72℃ for 10 s for 34 cycles; extension at 72℃ for 5 mins. PCR products were separated by 1.5% agarose gel electrophoresis and purified using a SanPrep DNA gel extraction kit (B518131, Sangon Biotech) according to standard operating procedures.

[0051] The circRNA-OE vector plasmid was digested with enzymes. The enzyme digestion reaction system is as follows:

[0052]

[0053] The above reaction solution was kept at 37°C for 30 minutes, and then the gel was removed and recovered after agarose gel electrophoresis.

[0054] The upstream flanking intron sequence, the mature circRNA sequence, and the downstream flanking intron sequence were ligated according to the standard operating procedure of the ClonExpress II One Step Cloning Kit. The recombinant plasmid was used for DH5α transformation of *E. coli*. Positive clones were screened by colony PCR and sent to Sangon Biotech for sequencing. For single colonies with correct sequencing, the colonies were shaken overnight, and the plasmid was extracted according to the standard operating procedure of the SanPrep Column Plasmid DNA Mini-Extraction Kit (Sangon Biotech). This yielded an overexpression vector plasmid containing the target grape circRNA.

[0055] Example 2: Efficacy test of the grape circRNA overexpression vector of the present invention

[0056] The efficiency and accuracy of circRNA back splicing mediated by Agrobacterium-mediated transient expression system in tobacco were tested.

[0057] 1. Agrobacterium-mediated transformation and verification of positive clones

[0058] Agrobacterium competent cells GV3101 stored at -80℃ were thawed at room temperature and then placed on ice. Successfully ligated plasmids were transformed into Agrobacterium GV3101 via a freeze-thaw method. Single colonies were selected and screened by PCR to obtain positive clones.

[0059] 2. Methods for expressing the instantaneous nature of tobacco infection

[0060] Agrobacterium tumefaciens strain GV3101 containing the recombinant plasmid was inoculated into Luria-Bertani medium (containing 50 μg / mL kanamycin and 50 μg / mL rifampin) and cultured in a shaker at 28°C and 200 rpm. The OD600 value of the bacterial suspension was measured. When OD600 = 1.0, the Agrobacterium was collected and resuspended in infection buffer (10 mM MgCl2, 10 mM MES, 100 μM acetylsylphenone, pH 5.8), and then incubated at 28°C with shaking for 2 h. The bacterial suspension was then injected into tobacco leaves using a 1 mL syringe. Three days after injection, samples were collected, and RNA was extracted.

[0061] 3. RT-qPCR detection of RNA expression levels

[0062] Design back-to-back and back-to-back primers:

[0063]

[0064] RNA expression levels were detected by RT-qPCR using back-directed and front-directed primers, respectively. Back-directed primers could detect only circRNA expression levels, while front-directed primers could detect the total amount of circRNA and linear RNA, thereby assessing circRNA expression efficiency.

[0065] The expression level of circRNA as a percentage of all transcripts is the expression level of the back primer / the expression level of the front primer.

[0066] RT-qPCR based on Premix Ex Taq™ II (Tli RNaseH Plus) (RR820L, TaKaRaBio) was used according to the manufacturer's instructions. Actin was used as an internal control, and the relative expression level of the gene was analyzed using the 2-ΔΔct method (Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔct method). -ΔΔCT method.Methods 2001,25(4):402-408.).

[0067] After transfection with the tobacco overexpression vector, quantitative real-time analysis revealed that the expression levels of the target circRNA driven by the circRNA-OE2 vector of this invention were all higher than those of circRNA-OE1 (constructed using the method described in ZL 2019 1 0199215.3). Furthermore, the expression levels of Vv-circRNA_4328, Vv-circRNA_4363, and Vv-circRNA_1975 as a percentage of all transcripts increased from 3.3%, 3.1%, and 2.2% to 22.9%, 16.8%, and 19.1%, respectively. These experimental results demonstrate that the circRNA overexpression vector frame and method constructed in this invention can efficiently overexpress grape circRNA.

[0068] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A method for increasing the expression level of circRNA in transcripts, characterized in that, circRNA expression was performed using a plant circRNA overexpression vector. The plant circRNA overexpression vector was constructed using the following steps: (1) Using the grape genome as a template, amplification was performed using the primers shown in SEQ ID NO.6 and SEQ ID NO.7, SEQ ID NO.12 or SEQ ID NO.16 to obtain Vv-circSIZ1 The upstream flanking intron sequence was amplified using primers shown in SEQ ID NO. 10, SEQ ID NO. 15, or SEQ ID NO. 19 and primers shown in SEQ ID NO.

11. Vv-circSIZ1 The downstream flanking intron sequence was then used as a template to amplify the mature target circRNA sequence. (2) Through homologous recombination Vv-circSIZ1 Upstream flanking intron sequence - target circRNA mature sequence - Vv-circSIZ1 Downstream flanking intron sequences are inserted between BamHI and PstI in the backbone vector; The Vv-circSIZ1 The nucleotide sequence of the upstream flanking intron is shown in SEQ ID NO.1; The Vv-circSIZ1 The nucleotide sequence of the downstream flanking intron is shown in SEQ ID NO.2; The mature target circRNA sequence does not contain its own introns or its own flanking introns, and the nucleotide sequence of the mature target circRNA sequence is shown in SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5; The backbone vector is a circRNA-OE vector containing a pair of inverse complementary sequences, constructed using the method described in Example 1 of Patent CN 109943586A.

Images