A key factor for regulating transient expression in tobacco and its application in improving transient expression efficiency

Abstract

The present invention relates to the field of plant transgenic technology, and in particular to a tobacco transient expression regulation key factor and its application in improving transient expression efficiency. It includes a tobacco transient expression regulation key factor TEF1, which can be applied as a promoting factor to improve the efficiency of tobacco transient expression. The specific method is to construct a 35S::TEF1 overexpression vector, infect explants, and improve the transient expression efficiency of tobacco, and the improvement of expression efficiency will greatly reduce the cost of protein expression.

Description

Technical Field

[0001] The invention relates to the technical field of plant transgenic technology, and in particular to a tobacco transient expression regulating key factor and its application in improving transient expression efficiency. Background Art

[0002] Plant transient expression technology is a technology that uses molecular biological methods to express exogenous genes in chassis plants in a short period of time. This technology does not require the integration of exogenous genes into the chassis plant genome, and there is no risk of gene drift. It has the characteristics of rapidity, high efficiency, and easy mass production. It is widely used in gene function research and bioreactor fields. As the latest generation of bioreactor technology, transient expression has begun to be used in the development of pharmaceutical proteins, vaccines, etc.; in 2022, the Canadian Ministry of Health has approved the new crown vaccine product Covifenz (plant-based virus-like particles [VLP], recombinant, adjuvant). The vaccine is suitable for people aged 18-64 for active immunization to prevent new coronary pneumonia caused by SARS-CoV-2. The production of this vaccine is completed through the tobacco transient expression system. Therefore, transient expression technology is driving technological innovation in the field of biopharmaceuticals.

[0003] The key to transient expression technology is the efficient expression of exogenous proteins. Only an efficient transient expression system can meet the industrialization needs of this technology. However, the current tobacco transient expression technology has low efficiency and high cost and cannot meet the needs of mass production. Summary of the invention

[0004] The technical problem to be solved by the present invention is that the current tobacco transient expression technology has low efficiency and high cost and cannot meet the needs of mass production.

[0005] To solve the above problems, the present invention discovered a key factor for regulating transient expression of tobacco, TEF1, which can be used as a promoting factor to improve the efficiency of transient expression of tobacco. By constructing a 35S::TEF1 overexpression vector and infecting explants, the transient expression efficiency of tobacco is improved, and the improvement of expression efficiency will greatly reduce the cost of protein expression.

[0006] To achieve the above object, the present invention is specifically implemented through the following technical solutions:

[0007] A tobacco transient expression regulation key factor, the nucleic acid sequence of which is SEQ ID NO.1.

[0008] SEQ ID NO.1:

[0009]

[0010] The invention names the key factor for transient expression regulation as TEF1_CDS. The transcription data show that the gene is significantly downregulated after Agrobacterium invades tobacco. It is speculated that the reduced expression of TEF1 can resist the invasion of exogenous bacteria. Tobacco transient expression is essentially the process of Agrobacterium invading leaves. Therefore, reducing the ability of tobacco to infect exogenous bacteria can improve the efficiency of transient expression. The reduction of TEF1 expression may increase the infection of plants to exogenous bacteria. Therefore, this patent can reduce the invasion of tobacco to exogenous bacteria by overexpressing TEF1, thereby improving the efficiency of transient expression.

[0011] An overexpression vector 35S::TEF1 constructed using the above-mentioned key factor for transient expression regulation has a nucleic acid sequence of SEQ ID NO.2.

[0012] SEQ ID NO.2:

[0013]

[0014] The 35S::TEF1 overexpression vector constructed by the present invention was co-transformed with Agrobacterium (35S::TEF1) and target Agrobacterium (containing pJL-TRBO-GFP, which can express green fluorescent protein) and found that after transient expression, the high expression of TEF1 significantly increased the expression level of GFP, indicating that TEF1 can be applied as a promoting factor to improve the efficiency of transient expression in tobacco. The method is simple and easy to operate, has no additional cost expenditure, has a good effect on improving the efficiency of transient expression, and the improvement of expression efficiency will greatly reduce the cost of protein expression.

[0015] Among them, the nucleic acid sequence of pJL-TRBO-GFP is SEQ ID NO.3.

[0016] SEQ ID NO.3:

[0017]

[0018] Application of TEF1, a key factor for regulating tobacco transient expression, in improving the efficiency of tobacco transient expression.

[0019] A method for improving tobacco transient expression efficiency by using tobacco transient expression regulation key factor TEF1 comprises the following steps:

[0020] (1) Activating Agrobacterium strains;

[0021] (2) Expand cultivation;

[0022] (3) Agrobacterium infection.

[0023] Furthermore, step (1) includes taking out the frozen Agrobacterium from the ultra-low temperature refrigerator, streaking and culturing it on a solid culture medium containing specific antibiotics for 3 days; picking a single colony with good growth and inoculating it into 10mL YEP culture medium containing the corresponding antibiotics.

[0024] Furthermore, in step (1), the antibiotics added to the 35S::TEF1 Agrobacterium culture medium are rifampicin and kanamycin; and the antibiotics added to the pJL-TRBO-GFP Agrobacterium culture medium are Rif and kanamycin.

[0025] Further, step (2) includes preparing 2 portions of YEP culture medium, inoculating 35S::TEF1 and pJL-TRBO-GFP respectively, marking them as 35S::TEF1 and pJL-TRBO-GFP, and shaking the culture at 220 rpm and 28°C overnight.

[0026] Further, step (3) includes preparing an infection liquid; determining the OD600 value of Agrobacterium in step (2) to be about 1.2, centrifuging at room temperature, and adding an appropriate amount of infection liquid; determining that the OD600 value is about 0.6, adding Agrobacterium to the infection liquid in a ratio of 35S::TEF1:pJL-TRBO-GFP1:1, preparing 200mL of a mixed infection liquid of 35S::TEF1 and pJL-TRBO-GFP, and a single infection liquid of pJL-TRBO-GFP as a control; standing at room temperature for 2 hours, preparing for infection, placing Nicotiana benthamiana with good growth in a beaker containing the infection liquid, vacuum infecting for 1 minute, repeating twice, and after the infection is completed, rinsing the Nicotiana benthamiana in pure water twice, placing it in a dark place for 24 hours, and then culturing it under normal conditions for 3 days.

[0027] Furthermore, in step (3), the infection liquid is 10 mM MgCl2, 10 mM MES, 100 nM AAS.

[0028] The beneficial effects of the present invention are:

[0029] (1) A key factor for regulating tobacco transient expression, TEF1, was discovered. The expression of this gene was significantly downregulated after Agrobacterium invaded tobacco and can be used to regulate the efficiency of tobacco transient expression.

[0030] (2) A 35S::TEF1 overexpression vector was constructed. After infecting explants, transient expression resulted in high expression of TEF1, which further significantly increased the expression level of GFP.

[0031] (3) A method for improving the transient expression efficiency of tobacco was given. By constructing a 35S::TEF1 overexpression vector and infecting explants, the transient expression efficiency of tobacco was improved. The improvement of expression efficiency will greatly reduce the cost of protein expression. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 It is the expression level of TEF1 gene 3 hours and 12 hours after Agrobacterium infection.

[0033] Figure 2 This is a graph showing that 35S::TEF1 increases the efficiency of virus-mediated transient expression in Nicotiana benthamiana. DETAILED DESCRIPTION

[0034] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0035] Embodiment 1:

[0036] (1) Design TEF1 gene-specific primers and add adapters (TEF1-P004F: CGAGCCCGGGACTAGTATGCTTACTTTGCTTCTTGG; TEF1-P004R: GTGGCGGTCCGGATCCTTATTGACTGCTGCAGAAATC). The yellow mark is the adapter, which is used to connect to the vector after enzyme digestion by homologous recombination.

[0037] (2) PCR amplification was performed using high-fidelity enzyme, tobacco cDNA as template, and TEF1-P004F / R as primers; the program was 95°C for 3 min; (95°C for 30 s, 56°C for 10 s, 72°C for 30 s) for 35 cycles; 72°C for 10 min; and maintained at room temperature;

[0038] (3) Run the PCR product on agarose gel and recover the target fragment;

[0039] (4) digesting the p004 vector with endonucleases SpeI and BamH1, and recovering the vector fragments after digestion by gel gel;

[0040] (5) Connect the fragment to the digested vector by infusion method, the procedure is: 50°C for 15 min; keep at 4°C;

[0041] (6) The above ligation products were transformed into E. coli DH5a; cultured at 37°C overnight, three single clones were picked and sent to the company for sequencing;

[0042] (7) Extract the correct clone plasmid and name it 35S::TEF1

[0043] Embodiment 2:

[0044] The reagents and concentrations used in this example are: 500 mM MES, 50 mM AAS (acetosyringone), 1 M MgCl2; the Agrobacterium strain used is GV3101.

[0045] A method for improving tobacco transient expression efficiency by using tobacco transient expression regulation key factor TEF1 comprises the following steps:

[0046] (1) Activation of strains: Take out the glycerol-frozen Agrobacterium from the -70°C ultra-low temperature freezer, and streak culture on a solid medium containing specific antibiotics (35S::TEF1 Agrobacterium culture medium with antibiotics rifampicin (Rif) and kanamycin (Kan); pJL-TRBO-GFP Agrobacterium culture medium with Rif and kanamycin (Kan)) for 3 days; pick a single colony with good growth and inoculate it into 10 mL YEP medium (containing the corresponding antibiotics);

[0047] (2) Expansion culture: prepare two 200 mL YEP medium, inoculate 35S::TEF1 and pJL-TRBO-GFP, respectively, labeled as 35S::TEF1 (antibiotics kanamycin and rifampicin), pJL-TRBO-GFP (antibiotics kanamycin and rifampicin), shake at 220 rpm and 28°C overnight;

[0048] (3) Agrobacterium infection: Prepare infection liquid (10 mM MgCl2, 10 mM MES, 100 nM AAS); measure the OD600 value of the above Agrobacterium to about 1.2, centrifuge at 5000 rpm for 10 minutes at room temperature, add appropriate amount of infection liquid, and measure the OD600 to be about 0.6. Prepare 200 mL of 35S::TEF1 and pJL-TRBO-GFP mixed infection liquid in a 1:1 ratio, and use pJL-TRBO-GFP infection liquid alone as a control; let it stand at room temperature for 2 hours, prepare for infection, place well-growing Nicotiana benthamiana leads in a beaker containing infection liquid, and vacuum infect for 1 minute, repeat twice, vacuum condition: 12 psi, after the infection, rinse the Nicotiana benthamiana twice in pure water, place in the dark for 24 hours, and then culture under normal conditions for 3 days.

[0049] Detection of green fluorescent protein:

[0050] The infected Nicotiana benthamiana was observed under ultraviolet light to observe the GFP expression. The GFP expression levels were observed under two infection conditions of 3 days, 4 days, and 5 days respectively to clarify the promoting effect of 35S::TEF1 on the virus-mediated transient expression system.

[0051] Experimental results:

[0052] Figure 1 :Agrobacterium GV3101 infected tobacco leaves, extracted RNA at 0 hours, 3 hours, and 12 hours, reverse transcribed into cDNA, and detected the expression of TEF1 gene by qRT-PCR. The results showed that after Agrobacterium invasion, the expression of TEF1 gene decreased, suggesting that the gene resisted the infection of foreign bacteria by reducing its expression after the invasion of foreign bacteria.

[0053] Figure 2 :pJL-TRBO-GFP is a vector for expressing GFP protein. Through comparative analysis, the expression of green fluorescent protein GFP is higher in tobacco leaves infected with a mixture of 35S::TEF1 and pJL-TRBO-GFP Agrobacterium than in tobacco leaves infected with pJL-TRBO-GFP alone. The expression is more obvious on the 4th day, and both reach peak values ​​on the 5th day, indicating that 35S::TEF1 promotes the expression of transiently expressed proteins best 4 days after infection.

[0054] Embodiment 3:

[0055] Steps that do not require verification of results:

[0056] (1) Activating Agrobacterium: Take out the frozen Agrobacterium from the ultra-low temperature refrigerator and streak it overnight. The next day, pick out the plaques with good growth, add kan and Rif antibiotics in 10mL YEP, and shake the bacteria at 200rpm for 24 hours.

[0057] (2) Expand the culture strain: Take 1 mL of the above Agrobacterium and add it to 50 mL of YEP medium (add kan and Rif antibiotics)

[0058] (3) Add 50 mL of 35S::TEF1 Agrobacterium to a centrifuge tube, centrifuge at 5000 rpm for 10 min, remove the supernatant, add 50 mL of infection solution, adjust the OD600 to about 0.6, and let it stand for 3 hours;

[0059] (4) Use a syringe (without a needle) to absorb the above liquid and inject it into tobacco from the back of the tobacco leaves. There is no limit on the amount and culture it in the dark for 24 hours;

[0060] (5) Move the above tobacco to a place under light and culture normally for about 7 days. Mark the infected leaves, which can be used as a base material for efficient infection of tobacco. After the target Agrobacterium infection solution is prepared, it can be directly injected or vacuum infected.

[0061] It should be noted that, although the specific embodiments of the present invention have been described, those skilled in the art may make various modifications and improvements to the present invention based on the basic concept of the invention. As long as they do not deviate from the basic concept of the present invention, they should all be within the scope of protection of the present invention.

Claims

1. A tobacco transient expression regulation key factor TEF1, whose nucleic acid sequence is SEQ ID NO.

1.

2. An overexpression vector 35S::TEF1 constructed using the transient expression regulation key factor TEF1 in claim 1, whose nucleic acid sequence is SEQ ID NO.

2.

3. A use of the tobacco transient expression regulation key factor TEF1 according to claim 1 in improving the efficiency of tobacco transient expression.

4. A method for improving tobacco transient expression efficiency by using the tobacco transient expression regulation key factor TEF1 in claim 1, characterized in that The following steps are involved: (1) Activating Agrobacterium strains; (2) Expanding cultivation; (3) Agrobacterium infection.

5. The method as claimed in claim 4, characterized in that: Step (1) comprises taking out the frozen Agrobacterium from the ultra-low temperature refrigerator, streaking and culturing it on a solid culture medium containing specific antibiotics for 3 days; picking a single colony with good growth and inoculating it into 10 mL YEP culture medium containing the corresponding antibiotics.

6. The method as claimed in claim 5, characterized in that: In step (1), the antibiotics added to the 35S::TEF1 Agrobacterium culture medium are rifampicin and kanamycin; the antibiotics added to the pJL-TRBO-GFP Agrobacterium culture medium are Rif and kanamycin.

7. The method as claimed in claim 4, characterized in that: Step (2) includes preparing two portions of YEP culture medium, inoculating 35S::TEF1 and pJL-TRBO-GFP respectively, marking them as 35S::TEF1 and pJL-TRBO-GFP, and shaking the culture at 220 rpm and 28°C overnight.

8. The method of claim 4, wherein: Step (3) comprises preparing an infection liquid; determining the OD600 value of Agrobacterium in step (2) to be 1.2, centrifuging at room temperature, and adding an appropriate amount of infection liquid; determining that the OD600 value is 0.6, adding Agrobacterium to the infection liquid in a ratio of 1:1, preparing 200 mL of a mixed infection liquid of 35S::TEF1 and pJL-TRBO-GFP, and using a single infection liquid of pJL-TRBO-GFP as a control; standing at room temperature for 2 hours, preparing for infection, placing a well-growing Nicotiana benthamiana plant in a beaker containing the infection liquid, vacuum infecting for 1 minute, repeating twice, and after the infection is completed, rinsing the Nicotiana benthamiana plant in pure water twice, placing it in a dark place for 24 hours, and then culturing it under normal conditions for 3 days.

9. The method as claimed in claim 8, characterized in that: The infection liquid in step (3) is 10 mM MgCl2, 10 mM MES, 100 nM AS.

Images