A CRISPR-Cas9 plasmid and its construction method and application

Abstract

The present invention relates to a CRISPR-Cas9 plasmid and its construction method and application. The nucleotide sequence of the CRISPR-Cas9 plasmid is shown in SEQ ID No. 6. A CRISPR-Cas9 plasmid for Bifidobacterium was constructed using CRISPR-Cas9 technology. By transforming Bifidobacterium with this plasmid, a gene knockout strain can be obtained, which is conducive to more convenient and efficient application in Bifidobacterium genome engineering.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a CRISPR-Cas9 plasmid and a construction method and application thereof. Background Art

[0002] Bifidobacteria are Gram-positive, obligately anaerobic bacteria that are beneficial in the human and mammalian intestinal flora. They play a vital role in maintaining intestinal homeostasis, improving lactose intolerance, and enhancing immunity. However, due to a lack of effective molecular and genetic manipulation tools, the molecular mechanisms underlying their beneficial effects remain unclear.

[0003] According to relevant patent research, China Patent Publication No. CN103146739A, titled "Establishment of a Method for Scarless Knockout of Functional Genes in Bifidobacterium," primarily achieves scarless gene knockout through the Cre-loxp recombinase system. However, the invention has certain deficiencies, such as introducing targeting vectors and shuttle expression vectors into Bifidobacterium in steps, which increases the complexity of the experiment and may affect endogenous gene expression.

[0004] Chinese patent publication number CN101517076A, patent name is Genetic Reconstruction in Bifidobacterium. This invention mainly effectively knocks out functional genes in Bifidobacterium through homologous recombination. However, this invention has certain shortcomings. For example, determining the target strain by differences in culture conditions will result in false positive results, and the culture cycle is long and the operation is cumbersome.

[0005] The CRISPR-Cas9 system, a rapid, efficient, and scarless gene editing method, has been widely used for genetic modification of bacterial genomes. This technology can generate DNA double-strand breaks (DSBs) at target sites, inducing homologous recombination (HDR) and non-homologous end joining (NHEJ) repair pathways within the cell, thereby enabling site-specific genetic manipulations such as knockout, replacement, and insertion of genomic DNA. Applying CRISPR technology to Bifidobacteria can help elucidate and enhance beneficial properties. Summary of the Invention

[0006] The purpose of the present invention is to overcome the defects of the above-mentioned prior art and provide a CRISPR-Cas9 plasmid and its construction method and application.

[0007] The purpose of the present invention can be achieved by the following technical solutions:

[0008] The nucleotide sequence of a CRISPR-Cas9 plasmid is shown in SEQ ID No.6.

[0009] The method for constructing the CRISPR-Cas9 plasmid comprises the following steps:

[0010] (1) Enzyme digestion of the vector: Use restriction endonucleases to digest the pAM1-ldh2 plasmid to linearize it and recover the linearized fragment of the pAM1-ldh2 plasmid after digestion;

[0011] (2) Synthesis of CRISPR long fragments: The Cas9 fragment, synthetic promoter P23 fragment, sgRNA fragment and homologous fragment were synthesized into CRISPR long fragments by overlap PCR;

[0012] (3) Ligation and transformation: The CRISPR long fragment was ligated with the pAM1-ldh2 linearized fragment and transformed into Escherichia coli Top10 competent cells. A single clone was selected for culture and sequenced for verification. The recombinant plasmid was extracted to obtain the CRISPR-Cas9 plasmid.

[0013] The pAM1-ldh2 plasmid was constructed by the present inventors, and the original promoter on the plasmid pAM1 was replaced with the promoter Pldh2 of Bifidobacterium itself, forming the pAM1-ldh2 plasmid.

[0014] The nucleotide sequence of the pAM1-ldh2 plasmid is shown in SEQ ID No. 1.

[0015] It is further preferred that the nucleotide sequence of the Cas9 fragment is as shown in SEQ ID No.2.

[0016] It is further preferred that the nucleotide sequence of the synthetic promoter P23 fragment is shown as SEQ ID No.3.

[0017] It is further preferred that the nucleotide sequence of the sgRNA fragment is as shown in SEQ ID No.4.

[0018] It is further preferred that the restriction enzyme sites are PstⅠ and SpeⅠ.

[0019] The nucleotide sequence of the CRISPR long fragment is shown in SEQ ID No.5.

[0020] The CRISPR-Cas9 plasmid is used for genetic modification of animal Bifidobacterium.

[0021] The CRISPR-Cas9 plasmid is used as a prokaryotic expression vector for knocking out genes in animal Bifidobacterium.

[0022] The application of the CRISPR-Cas9 plasmid comprises the following steps:

[0023] (1) preparing competent cells of Bifidobacterium animalis;

[0024] (2) transforming the CRISPR-Cas9 plasmid into competent cells of Bifidobacterium animalis;

[0025] (3) PCR verification screening and gene sequencing to obtain gene knockout strains.

[0026] Further preferred is Bifidobacterium animalis AR668.

[0027] The reagents used in the present invention are all commercially available.

[0028] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0029] (1) Convenient: Gene knockout strains can be obtained through only one plasmid construction and one plasmid transformation;

[0030] (2) Efficiency: The CRISPR-Cas9 system can be used to perform genetic operations such as site-specific knockout, replacement, and insertion of genomic DNA. It is an efficient and traceless gene editing strategy. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is the plasmid map of pAM1-ldh2, including the ampicillin resistance gene and erythromycin resistance gene, and the restriction sites PstⅠ and SpeⅠ;

[0032] Figure 2 Figure 1 is a gel electrophoresis diagram of the pAM1-ldh2 plasmid after double digestion with PstⅠ and SpeⅠ, where number 1 is the linearized fragment of the pAM1-ldh2 plasmid after digestion, and number 2 is the pAM1-ldh2 plasmid before digestion;

[0033] Figure 3 This is the CRISPR-Cas9 plasmid map, including the ampicillin resistance gene and erythromycin resistance gene, Cas9 fragment, synthetic promoter P23 fragment, and sgRNA fragment;

[0034] Figure 4 This is the gel electrophoresis diagram of the colony PCR verification of the knockout strain, where numbers 1-15 are single colonies picked;

[0035] Figure 5 This is a phenotypic verification diagram of the knockout strain, where AR668 represents the wild-type Bifidobacterium animalis strain and AR668△0208 represents the Bifidobacterium animalis knockout strain, which were cultured on BS plates and BS plates containing 100 ng / mL 5-fluorouracil, respectively. DETAILED DESCRIPTION

[0036] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0037] Example 1: Extraction of pAM1-ldh2 plasmid

[0038] Plasmids were extracted using the commercially available Axyprep plasmid miniprep kit, which contains the following reagents: RNase A, Buffer E1, Buffer E2, Buffer E3, Buffer E4, and Buffer E5.

[0039] The specific steps are as follows:

[0040] 1. Inoculate E. coli Top10 containing the pAM1-ldh2 plasmid into 4 mL of ampicillin-resistant LB culture medium and culture at 37°C in a shaking incubator for 12-16 hours to amplify the plasmid.

[0041] 2. Centrifuge at 12000 x g for 1 min to collect the bacteria.

[0042] 3. Discard the ampicillin-resistant LB culture medium and gently tap on absorbent paper to remove any remaining liquid. Add 250 μL of Buffer E1 / RNase A and gently resuspend the bacteria thoroughly. Note that RNase A must be added to Buffer E1 before use, and the bacteria must be resuspended without visible bacterial clumps, otherwise the yield will be affected.

[0043] 4. Add 250 μL of Buffer E2 to the resuspension and gently invert 6-8 times to mix thoroughly. Do not vortex. After complete lysis, the solution will become viscous and translucent. When processing multiple samples, the total operation time should not exceed 5 minutes.

[0044] 5. Add 350 μL of Buffer E3 to the lysate and immediately invert 6 to 8 times to prevent the precipitate from agglomerating and affecting the neutralization effect. The mixing process must be gentle and thorough.

[0045] 6. Centrifuge at 12,000 x g for 10 minutes.

[0046] 7. Carefully transfer the supernatant to a 2 mL preparation tube, centrifuge at 12,000 x g for 1 min, and discard the liquid.

[0047] 8. Add 500 μL of Buffer E4 to the preparation tube, centrifuge at 12,000 x g for 1 min, and discard the solution. Repeat this operation once.

[0048] 9. Add 700 μL of Buffer E5 to the preparation tube, centrifuge at 12,000 x g for 1 min, and discard the liquid.

[0049] 10. Centrifuge at 12,000 x g for 1 minute, transfer the preparation tube to a 2 mL collection tube, and let it stand at room temperature for 5 minutes.

[0050] 11. Add 30-50 μL of sterile deionized water preheated to 65°C, let it stand for 2 minutes, and then centrifuge at 12,000 x g for 1 minute.

[0051] 12. Discard the column and store the pAM1-ldh2 plasmid at -20°C.

[0052] Example 2: Linearization of pAM1-Idh2 plasmid

[0053] The enzyme digestion system (20 μL) is as follows:

[0054] pAM1-ldh2 plasmid: 4 μL

[0055] PstⅠ: 1 μL

[0056] SpeⅠ: 1μL

[0057] 2 x Qcut Buffer: 2 μL

[0058] dd HO: 12 μL

[0059] After the above system is mixed evenly, enzyme digestion is performed at 37°C for 3 h.

[0060] PCR products were detected by 1% agarose gel electrophoresis. The target fragment was cut from the gel and recovered using a commercially available Axyprep DNA gel recovery kit. The recovered pAM1-Idh2 plasmid linearized fragment was stored in a -20°C refrigerator for later use.

[0061] The plasmid map of pAM1-ldh2 is as follows Figure 1 As shown, the agarose gel electrophoresis of the pAM1-ldh2 plasmid after double enzyme digestion is shown in Figure 2 As shown, the linearized fragment of the pAM1-ldh2 plasmid was verified and recovered by tapping to obtain the linearized fragment of the pAM1-ldh2 plasmid. The nucleotide sequence of the pAM1-ldh2 plasmid is shown in SEQ ID No. 1.

[0062] Example 3: Ligation of a long CRISPR sequence fragment with a linearized fragment of the pAM1-ldh2 plasmid

[0063] To complete this step, the ClonExpress II OneStep Cloning Kit produced by Nanjing Novezan Biotechnology Co., Ltd. was used. The kit includes the following reagents: 5× CEⅡ buffer, ExnaseⅡ;

[0064] Preferably, the upp gene (encoding uracil phosphoribosyltransferase) is knocked out, and the Cas9 fragment, synthetic promoter P23, sgRNA fragment and homologous fragment are synthesized into a long fragment CRISPR. The nucleotide sequence of the Cas9 fragment is shown in SEQ ID No. 2, the nucleotide sequence of the synthetic promoter P23 fragment is shown in SEQ ID No. 3, the nucleotide sequence of the sgRNA fragment is shown in SEQ ID No. 4, and the nucleotide sequence of the CRISPR long fragment (upp-CRISPR) is shown in SEQ ID No. 5.

[0065] The specific steps are as follows:

[0066] 1. Prepare the following reaction system components (20 μL) on ice:

[0067] pAM1-ldh2 linearized fragment: 1.5 μL

[0068] CRISPR long fragment: 1 μL

[0069] 5×CEⅡ buffer: 4μL

[0070] Exnase II: 2 μL

[0071] dd HO: 11.5 μL

[0072] (Note: The optimal amount of cloning vector used in the recombination reaction system is 0.03 pmol, and the optimal amount of insert used is 0.06 pmol (vector to insert molar ratio is 1:2). The DNA mass corresponding to these molar amounts can be roughly calculated using the following formula:

[0073] The optimal amount of cloning vector used = [0.02 × number of base pairs of cloning vector] ng (0.03 pmol); the optimal amount of insert fragment used = [0.04 × number of base pairs of insert fragment] ng (0.06 pmol).

[0074] 2. Use a pipette to gently pipette to mix (do not oscillate), and briefly centrifuge the reaction solution to collect it at the bottom of the tube.

[0075] 3. React at 37°C for 30 min, then cool to 4°C or immediately place on ice to obtain the ligation product.

[0076] Example 4: Recombinant product transformation

[0077] 1. Take out 100 μL of E. coli Top10 competent cells from -80℃ refrigerator, place on ice to dissolve, and mark;

[0078] 2. Add 10 μL of ligation product, mix carefully by pipetting, and place on ice for 20-30 minutes. This process is used to allow the ligation product to fully adsorb to the surface of the competent E. coli Top10 cells.

[0079] 3. Heat shock in a 42°C water bath for 90 seconds, then quickly place on ice to cool and keep for 3-5 minutes;

[0080] 4. Add 900 μL LB medium and culture at 37°C, 200 rpm for 1 h;

[0081] 5. Centrifuge at 5000 rpm for 5 min;

[0082] 6. Remove approximately 900 μL of LB medium and mix the remaining 100 μL by pipetting. Apply the mixture to an ampicillin-resistant LB plate and incubate at 37°C for 10-14 hours.

[0083] 7. Pick a single colony and place it in a 2 mL centrifuge tube. Add 1 mL of LB liquid culture medium with ampicillin resistance to the centrifuge tube. Incubate at 37°C and 180 rpm for 4 to 8 hours before performing PCR verification of the bacterial solution.

[0084] The bacterial solution with the same PCR band was sent to a sequencing company for sequencing. The bacterial solution with the correct sequencing was amplified and the plasmid was extracted. The plasmid was named CRISPR-Cas9 plasmid. The CRISPR-Cas9 plasmid map is as follows Figure 3 The nucleotide sequence of the CRISPR-Cas9 plasmid is shown in SEQ ID No.6.

[0085] Example 5: Preparation of Bifidobacterium competent cells

[0086] 1. Bifidobacterium AR668 is preferred. Streak AR668 onto a BS solid plate and culture anaerobically at 37°C to grow a single colony of 1-2 mm in size. Transfer a single colony to 50 mL of BS liquid medium and incubate at 37°C for 10-12 hours.

[0087] 2. Take 1% of the bacterial solution and inoculate it into 50 mL of BS liquid medium containing 0.5 mol / L sucrose. Incubate at 37°C for 4-6 hours until the OD600 reaches 0.3-0.4. Incubate on ice for 30 minutes and centrifuge to discard the supernatant.

[0088] 3. Resuspend the cells in pre-chilled washing buffer (containing 0.5 mol / L sucrose and 1 mmol / L ammonium citrate), centrifuge and discard the supernatant, repeat twice. Finally, resuspend in washing buffer containing 10% glycerol by volume to prepare Bifidobacterium competent cells.

[0089] 4. Finally, aliquot 100 μL of Bifidobacterium competent cells into 1.5 mL sterile EP tubes and store at -80°C for electroporation.

[0090] All the above centrifugation conditions were 4°C, 5000×g, 10 min.

[0091] Example 6: Transformation of Bifidobacterium

[0092] 1. Mix 1000ng of CRISPR-Cas9 plasmid with a strain of Bifidobacterium competent cells and quickly transfer them into a pre-chilled 2mm electroporation cuvette.

[0093] 2. Use an electroporator to perform electroporation, quickly add 900 μL of pre-cooled recovery medium (BS liquid medium containing 0.4 mol / L sorbitol, 2 mmol / L CaCl2, and 20 mmol / L MgCl2), and incubate at 37°C for 4 hours;

[0094] 3. Take 100 μL of bacterial solution and spread it on BS plate containing 5 μg / mL erythromycin resistance. Incubate anaerobically at 37°C for 48 hours and record the results.

[0095] Example 7: Transformant Verification

[0096] 1. Colony PCR verification: Pick a single colony on the BS plate and perform PCR verification on the gene knockout. The results are as follows: Figure 4 .

[0097] 2. Phenotypic verification of knockout strains: Isolate 5-fluorouracil-resistant colonies to screen gene knockout strains. The results are as follows: Figure 5 The wild-type strain and the gene knockout strain were streaked on BS plates and BS plates containing 100 ng / mL 5-fluorouracil, respectively. The wild-type strain could not grow on the BS plates containing 5-fluorouracil, while the strain with the upp gene knockout could grow on the BS plates containing 5-fluorouracil.

[0098] The above description of the embodiments is intended to facilitate understanding and use of the invention by those skilled in the art. It will be apparent that those skilled in the art can readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without requiring inventive effort. Therefore, the present invention is not limited to the above-described embodiments. Improvements and modifications made by those skilled in the art based on the disclosure of the present invention, without departing from the scope of the present invention, should be within the scope of protection of the present invention.

[0099] SEQ ID No.1

[0100] pAM1-ldh2 plasmid

[0101]

[0102] SEQ ID No. 2

[0103] Cas9 fragment

[0104]

[0105] SEQ ID No.3

[0106] Synthetic promoter P23 fragment

[0107] Aacatcattgtcattcatatttttcattatatttggcctccctttttaatttaattctaagactattttatcaaaattttctctttttgtcatcagtcttaggtctgattttttatttctattatttactgaccgaacgcttattcctttttaggaacaagggttgtcagggcttttcg

[0108] SEQ ID No.4

[0109] sgRNA fragment

[0110] aaaaaaagcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctatttctagctctaaaactcgcggtccttggacgacag

[0111] SEQ ID No.5

[0112] CRISPR long fragment

[0113]

[0114] SEQ ID No.6

[0115] CRISPR-Cas9 Plasmids

[0116]

Claims

1. A CRISPR-Cas9 plasmid, characterized in that The nucleotide sequence of the CRISPR-Cas9 plasmid is shown in SEQ ID No.

6.

2. A method for constructing the CRISPR-Cas9 plasmid according to claim 1, characterized in that: The steps include: S1. Enzyme digestion of vector: Use restriction endonuclease to digest the pAM1-ldh2 plasmid to linearize it and recover the linearized fragment of the pAM1-ldh2 plasmid after digestion. The restriction endonuclease is Pst Ⅰ and Spe I, the nucleotide sequence of the pAM1-ldh2 plasmid is shown in SEQ ID NO: 1; S12. Synthesizing a long CRISPR fragment: The Cas9 fragment, the synthetic promoter P23 fragment, the sgRNA fragment, and the homologous fragment were synthesized into a long CRISPR fragment by overlap PCR. The nucleotide sequence of the long CRISPR fragment is shown in SEQ ID No.

5. S13. Ligation and Transformation: Ligate the long CRISPR fragment with the linearized fragment of the pAM1-ldh2 plasmid and transform into competent E. coli Top10 cells. Isolate a single colony, culture it, and verify it by sequencing. Extract the recombinant plasmid to obtain the CRISPR-Cas9 plasmid.

3. A use of the CRISPR-Cas9 plasmid according to claim 1, characterized in that: The CRISPR-Cas9 plasmid is used for genetic modification of animal Bifidobacterium.

4. The use of the CRISPR-Cas9 plasmid according to claim 3, characterized in that The CRISPR-Cas9 plasmid is used as a prokaryotic expression vector for knocking out genes in animal Bifidobacterium.

5. The use of the CRISPR-Cas9 plasmid according to claim 3, characterized in that The steps include: S21. Preparation of competent cells of Bifidobacterium animalis; S22. Transform the CRISPR-Cas9 plasmid into competent cells of Bifidobacterium animalis; S23. PCR verification and gene sequencing were performed to obtain gene knockout strains.

6. The use of the CRISPR-Cas9 plasmid according to claim 5, characterized in that The animal Bifidobacterium is AR668.

Images